105 subjects: results from a population-based study. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine 1994, 7.
View Article Online View Journal
Metallomics Accepted Manuscript
This is an Accepted Manuscript, which has been through the RSC Publishing peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, which is prior to technical editing, formatting and proof reading. This free service from RSC Publishing allows authors to make their results available to the community, in citable form, before publication of the edited article. This Accepted Manuscript will be replaced by the edited and formatted Advance Article as soon as this is available. To cite this manuscript please use its permanent Digital Object Identifier (DOI®), which is identical for all formats of publication. More information about Accepted Manuscripts can be found in the Information for Authors. Please note that technical editing may introduce minor changes to the text and/or graphics contained in the manuscript submitted by the author(s) which may alter content, and that the standard Terms & Conditions and the ethical guidelines that apply to the journal are still applicable. In no event shall the RSC be held responsible for any errors or omissions in these Accepted Manuscript manuscripts or any consequences arising from the use of any information contained in them.
www.rsc.org/metallomics Registered Charity Number 207890
Page 1 of 10
Journal Name
►
View Article Online
Metallomics
ARTICLE TYPE Selenoprotein P and Selenoprotein M block Zn2+-mediated Aβ42 aggregation and toxicity
5
10
15
20
Received (in XXX, XXX) Xth XXXXXXXXX 20XX, Accepted Xth XXXXXXXXX 20XX DOI: 10.1039/b000000x Aggregation and cytotoxicity of amyloid-β (Aβ) peptide with transition metal ions in neuronal cells have been suggested to be involved in the progression of Alzheimer’s disease (AD). A therapeutic strategy to combat this incurable disease is to design chemical agents to target metal- Aβ species. Selenoproteins are a group of special proteins that contain the 21st amino acid Sec in their sequence. Due to the presence of Sec, studies of this group of proteins are basically focused on their roles in regulating redox potential and scavenging reactive oxygen species. Here, we reported that the His-rich domain of selenoprotein P (SelPH) and the Sec-to-Cys mutant selenoprotein M (SelM′), are capable of binding transition metal ions and modulating the Zn2+-mediated Aβ aggregation, ROS production and neurotoxicity. SelM′ (U48C) and SelP-H were found to coordinate 0.5 and 2 molar equivalents of Zn2+/Cd2+ with micromolar and submicromolar affinities, respectively. Metal binding induced the structural changes of SelP-H and SelM′ according to the circular dichorism spectra. Zn2+ binding to Aß42 almost completely surpressed Aß42 fibrillization, which could be significantly restored by SelP-H and SelM′, as observed by thioflavin T (ThT) fluorescence and transmission electron microscopy (TEM). Interestingly, both SelP-H and SelM′ inhibited Zn2+-Aß42-induced neurotoxicity and the intracellular ROS production in living cells. These studies suggest that SelP and SelM may play certain roles in regulating redox balance as well as metal homeostasis.
Introduction
25
30
35
40
45
Alzheimer’s disease (AD), the leading cause of dementia in elderly people, is now the most common neurodegenerative disease, affecting more than 35 million people worldwide.1 One of the main histopathological hallmarks of the AD brain is the formation of extracelluar amyloid plaques, composed mainly of fibrillar amyloid-β (Aβ) peptide.2 Aβ peptides, the main forms of which are 42 and 40 amino acids long (Aβ42 and Aβ40, respectively),3 were generated via cleavage of the amyloid precursor protein (APP) by β- and γ- secretases. Aβ40 is present in larger amounts in the brain, yet Aβ42 is more neurotoxic and has a higher tendency to aggregate.4 Transition metal ions including Cu, Fe and Zn are found in the amyloid plaques at high levels (approximately 0.4 mM for Cu and 1 mM for Fe and Zn).5 These metal ions binding to the side chain of His in Aβ peptide, promoted Aβ aggregation,6 as well lead to formation of reactive oxygen species (ROS) which further result in extensive impairment of cellular functions.7 Dyshomeostasis of transition metals (Cu, Zn and Fe) in AD has attracted more and more attention and one of the therapeutic strategies is to design agents that can chelate metal ions and prevent metal ions from the interaction with Aβ peptide as well as to attenuate the metal-induced redox activity and neurotoxicity of the peptides.8 Beside chemical agents, some native copper- and
This journal is © The Royal Society of Chemistry [year]
50
55
60
65
70
zinc binding proteins, metallothionine in particular are found to be capable of regulating the metal-mediated Aβ aggregation and toxicity.9 Selenoproteins are a group of special proteins that contain the 21st amino acid, selenocysteine (Sec, U) in their sequence. Sec is encoded by TGA which is generally used as a terminal signal in protein translation. The due functions of UGA codon make it difficult for Sec insertion into selenoproteins. Selenoprotein P (SelP) is the only protein containing multiple (ten) Sec residues in the human selenoprotein family. The function of SelP is suggested to encompass oxidant defense and Se homeostasis.10 SelP is required for the protective role of GPx against ROS in astrocytes when cultured in Se-free medium.11 Expression of SelP is upregulated in age-dependent manner12 and necessary for the expression of other selenoenzymes, such as GPx4.10a Moreover, SelP was found to be co-localized with Aβ plaques in the postmortem tissue from individuals with the hallmark lesions of AD.13 The direct association of SelP expression with the pathology of AD suggests that this protein is involved in the response or progression of the disorder. Knockdown of SelP rendered N2A cell more sensitive to the toxicity of Aβ.14 However, the exact function and mechanism of SelP in AD prevention remain unknown. In addition to the high Sec content, SelP is also a Cys- and His- rich protein. It encodes two His-rich regions, located at residue 204-217 and residue 244-250, respectively (Fig. 1). The His-rich domain of SelP (188-263) was [journal], [year], [vol], 00–00 | 1
Metallomics Accepted Manuscript
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
Xiubo Du, a Haiping Li, b Zhi Wang, a Shi Qiu,b Qiong Liu* b and Jiazuan Ni* a
Journal Name
Metallomics
Page ► 2 of 10
View Article Online
Fig. 1 Sequences of SelP and SelM. The signal peptides were highlighted in gray. In SelP, the His-rich domain was highlighted in yellow, and named as SelP-H. In SelM, the CxxU redox motif was underlined. All Sec (U) residues were highlighted in red.
5
10
15
20
25
30
35
predicted to be on the surface of the protein via PROFace program. Both the redox motif (UXXC or CXXC) and the Hisrich motif are good Cu2+ and Zn2+ binder. Therefore, we propose, in addition to its roles in oxidant defense and Se homeostasis, SelP may also mediate the metal (especially Cu2+ and Zn2+) homeostasis and thus regulate the metal-induced Aβ aggregation and neurotoxicity in AD. Selenoprotein M (SelM) is another important protein that may function in AD. SelM is expressed in various tissues, but with high level in brain.15 Recent experiments with mouse neurons indicated a role of SelM in protecting against ROS in the brain and calcium regulation,16 and these findings underlined the potential function of SelM in AD. Most recently, we found SelM reduced the intracellular ROS level and inhibited Aβ aggregation in HEK293T cells, which relied on the presence of the CXXU motif.17 The CXXU (or UXXC, CXU and UXC) redox active motif is widely present in selenoproteins, including SelM, SelP, SelW, SelH and SelT, etc.18 Notably, CXXC-like motif was often found to bind Zn2+ and Cu+ in proteins. Due to the high similarities between Sec and Cys, SelM as well as other CXXUlike motif containing selenoproteins may also function as metal regulators and modulate metal induced Aβ aggregation and neurotoxicity in AD. Due to the difficulty of preparing selenoproteins in heterologous expression system, a Cys homolog was commonly used to investigate the functional and structural properties of the native selenoprotein form. Selenium and sulfur are in the same group of elements in the periodic table and share some properties. In the present study, we cloned and expressed the His-rich domain of SelP (residues 188-263, named SelP-H) and a mutant SelM (U48C, named SelM′,). The metal binding properties of SelP-H and SelM′ are characterized by different approaches and their abilities to regulate Zn2+-induced Aβ aggregation and neurotoxicity are examined.
45
50
55
60
65
70
75
UV/Vis Spectroscopy
Experimental 40
Proteins Expression and Purification Because recombinant selenoproteins are difficult to prepare in heterologous expression systems, the single selenocysteine This journal is © The Royal Society of Chemistry [year]
residue (U48) in SelM was mutated to cysteine (U48C) to facilitate the study. The coding regions of SelM′ gene and the His-rich domain of SelP (SelP-H) were PCR-amplified from pET-HSV-2A-SelM′ (constructed by this lab previously) and a cDNA clone with the following primers: 5’-TTGGATCC CATCATCATCATCATCACTCTTCT-3’ and 5’-TTGAATTC CTACAGGTCAGCGTGGTCGGC-3’ (residues 25-145 of SelMU48C, including a N-terminal hexahistidine tag and a thrombin enzymatic digestion site, designated as SelM′); 5’CTTGATCGGATCCCGTGTATCTTTGGCTAC -3’ and 5’CCCCTCGAGTCATTACATATCTCGGTTC -3’ (residues 188263 of SelP, designated as SelP-H). PCR products were digested with BamHI/EcoRI and BamHI/XhoI respectively, ligated into pGBTNH plasmid (A gift from Prof. Hong-Yu Hu, Shanghai Institute for Biological Sciences, CAS), and verified by DNA sequencing. SelM′ and SelP-H were expressed in Escherichia coli BL21(DE3) cells. Cell cultures were grown at 37 oC until the A600 reached 0.6. Protein expression was induced by the addition of isopropyl-ß-D-thiogalactoside (IPTG) to 0.4 mM. Cells were cultured for a further 4 hours at 37ºC before harvested. Cells expressing SelM′ and SelP-H were collected and resuspended in ice-cold lysis buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0) and ruptured by sonication. The lysate was centrifuged at 15 000 g at 4ºC for 30 min, and the supernatant was filtered through a 0.45-m-pore-size cellulose acetate syringe filter (Iwaki Glass). Due to the presence of an N-terminal hexahistidine tag in SelM′ and two His-rich motifs in SelP-H, both proteins in fusion with GB1-tag were purified by a NiSO4-impregnated HiTrapTM HP column (GE Healthcare). The GB1-tag as well as the His-tag in the case of SelM′, were removed by thrombin digestion (at 0.2U/0.1mg protein, room temperature, 16 h) followed with a second round immobilized Ni2+–chelate affinity chromatography and gel filtration.
80
UV/Vis spectra were recorded on LAMBDA 25 UV-visible spectrophotometer (Perkin Elmer) with a 1-cm cuvette at room temperature. For SelM′, 1 μM apo- protein in Tris buffer (20 mM, 100 mM NaCl, pH 7.5) was titrated with 0.1 mM ZnCl 2. The [journal], [year], [vol], 00–00 | 2
Metallomics Accepted Manuscript
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
ARTICLE TYPE
Metallomics
absorption spectra were monitored over the wavelength range 200-800 nm, and normalized with absorbance at 800 nm. The UV/vis spectra of apo- and Zn2+/Cd2+ bound SelP-H were also recorded in the range of 200-800 nm. 5
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
10
15
20
25
30
35
40
45
Circular Dichroism Spectroscopy Circular dichroism experiments were carried out with 0.1-cmpathlength quartz cell on a Jasco J-815 spectropolarimeter calibrated with 0.06% (+)-10-camphorsulphonic acid solution (Sigma-Aldrich). During experiments, the instrument optics and sample chamber were flushed with 5 liters/min of high purity N2 gas continually. Parameters were set as followed: scan range, 255-190 nm; speed, 50 nm/min; wavelength step, 0.1 nm; response time: 0.25 s; sensitivity, 50 mdeg. CD spectra of 20 μM apo- or metal-bound SelM′/SelP-H in 5 mM K2HPO4/KH2PO4 buffer (10 mM, pH 8.0) were collected. The spectra were corrected for the corresponding buffer and smoothed using a fast Fourier transform (FFT) filter. Contents of secondary structures were estimated with CDPro software using SELCON3, CDSSTR and CONTINLL programs. Isothermal Titration Calorimetry (ITC) ITC measurements were performed on a MicroCal iTC-200 microcalorimeter (GE healthcare) at 25 ºC.The purified proteins were treated with 10 mM EDTA for 3 hours and then subjected to three rounds of dialysis against Tris buffer (50 mM, pH 7.4). The protein concentration was determined by using BCA Protein Assay Kit with BSA as a standard. The titrant was made by mixing appropriate amount of stock metal solution (20 mM ZnSO4 /CdCl2 in nanopure Milli-Q water) with a buffer retained from the final dialysis of the protein sample. The metal concentration of the stock solution was determined by ICP-MS. In a typical titration, 2 µl of 0.4-1.25 mM ZnSO4 or CdCl2 was titrated into 200 µl of 33-50 µM proteins over 4 s with a 3-min interval between each injection. Twenty injections were made in total. The reaction solution was stirred at 1000 rpm. The heat of dilution, mechanical effects and non-specific interactions were accounted for by averaging the last three points of titration and the value was subtracted from all data points. All of the experiments were repeated three times under the same conditions. The results were analyzed with the models using the Origin Software package (Microcal). A nonlinear least squares method was used to obtain the best fit parameters for the number of binding sites, n, the association constant, K, and the change of enthalpy ΔH and entropy ΔS. Several binding models including one set of sites model (n identical sites, 3 parameters), two sets of sites model (independent sites, 6 parameters) and sequential binding model, were used in the fitting. The goodness-of-fit with different models were compared according to the calculated χ2 value, and one set of sites model was found to give the best fit.
60
65
55
Stock solutions of Aß42 (purchased from Chianpeptides Co., Ltd.) were prepared as followed: Aß42 peptide was dissolved in hexafluoroisopropanol (HFIP) to a concentration of 0.5 mg/ml. The solution was incubated at room temperature overnight with shaking and then sonicated in water bath for 15-20 min and dried with N2 gas. The peptide was finally dissolved in DMSO
thoroughly and sonicated in water bath for another 15-20 min and used for experiments. For CCK-8 and ROS assay, the Aß42 stock solution was diluted to a final concentration of 20 µM in FBS-free DMEM containg 20 µM ZnCl2, and incubated at 37 ºC for 1 hour; then appropriate amount of apo-SelM′ or apo-SelP-H in DMEM were added to the solution and the mixture was incubated at 37 ºC for 24 h before added to the cells. For TEM imaging, the Aß42 stock solution was diluted in PBS containg 75 µM ZnCl2; then appropriate amount of apo-SelM′ or apo-SelP-H in PBS were added to the solution and the mixture was incubated at 37 ºC for 24 h before imaging. The final concentrations of Aß42, ZnCl2 and SelM′ /SelP-H are 25 µM. Monitoring Aß42 fibrillization by thioflavin T fluorescence
70
75
80
85
For Aß42 fibrillization, freshly prepared stock solution of Aß42 were diluted to a final concentration of 20 µM in 20 mM PBS and 100 mM NaCl, pH 7.4 containing 20 µM Thioflavin T (ThT, Sigma). To investigate the effects of SelP-H/SelM′ or Zn2+ on Aß42 fibrillization, SelP-H/SelM′ or Zn2+ in PBS were added to the above fibrillization mixture (20 µM Aß42 and 20 µM ThT, in PBS) with the final concentrations of 10 µM. To examine the effects of selenoproteins on Zn2+-induced Aß42 aggregation, Zn2+ in PBS was added to the Aß42 fibrillization mixture, and then SelP-H/SelM′ in PBS was added immediately. The final concentrations of Zn2+ as well as SelP-H/SelM′ are 10 µM. Samples in 200 µl were added to 96-well plates and incubated at 37 ºCºC. The ThT fluorescence intensity of each sample was recorded using a microplate reader (Fluoroskan Ascent FL, Thermo Scientific) with 444/485 nm excitation/emission filters at different time point. The assay was performed in triplicate and repeated at least twice. Transmission Electron Microscopy
90
95
Aß42 samples (25 µM, 5 µl) were put on glow-discharge, Formvar/carbon 300 mesh copper grids, and incubated at room temperature for 2 min. Excess solution was removed with filter paper and the grids were rinsed twice with H2O. Then the grids were stained with uranyl acetate (1% w/v, H2O, 5µl) for 1 min, blotted with filter paper, and dried for 15 min at room temperature. Samples were visualized with a transmission electron microscope (FEI Tecnai G2 S-Twin TEM) at 200 kV and ×200,000 magnification. Cell Culture
100
Aß42 Sample Preparation 50
View Article Online
105
110
N2A cells were maintained in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% FBS, 100 U/ml penicillin G, 100 µg/ml streptomycin, and cultured at 37 ºC, 5% CO2 incubator. Cells in the logarithmic phase were dissociated with trypsin and seeded in 96-well or 6-well plates, resulting in about 0.5×103 cells in 100 µl medium or 105 cells in 2 ml medium per well, for CCK-8 assay or ROS measurement respectively. Cells were incubated at 37 ºC, 5% CO2 for 24 h to attach the plates. For CCK-8 or ROS assay, 50 µl or 2 ml of each pre-incubated Aß42 sample (with or without the addition of Zn2+ and/or selenoproteins) was diluted with fresh FBS-free DMEM medium and added individally to the cell well. The final concentrations of Aß42, Zn2+ and SelM′/SelP-H are 10 µM. The
Metallomics Accepted Manuscript
Page 3 of 10
Metallomics
5
View Article Online
Page 4 of 10
same volume of serum-free medium was added into control cultures (only N2A cells present). The cells were then incubated for additional 24 h at 37 ºC. At the end of incubation, the cell viability was determined by CCK-8 assay and the ROS level was determined by DCF staining. Cell viability experiments
Measurement of ROS
15
20
25
Before measurement, the old medium was removed from the cells and 2 ml 2',7'-Dichlorofluorescin diacetate (DCFH-DA, 10 µM in FBS-free medium) were added into each well. Cells were incubated at 37 ºC for further 20 min and washed three times with FBS-free medium. Cells were harvested and washed three times with ice-cold PBS and resuspended in PBS. The intensity of fluorescence was analyzed by flow cytometry (FACS Calibur, Becton Dickinson) with excitation at 488 nm and emission at 535 nm. A gate was set to exclude signals from debris and aggregates. Results are expressed as fold change compared with corresponding controls. Ten thousand cells were analyzed in each assay and assays were run in duplicate.
55
Fig.2 Left: SDS-PAGE image of purified SelP-H and SelM′. Right: Elution profiles of apo- and Zn2+-bound SelM′ from gel filtration on Superdex 75 10/300 GL column. Proteins were eluted with 20 mM Na2HPO4/NaH2PO4, pH 7.4, and 100 mM NaCl. 60
65
70
Results and discussion 75
Metal binding properties of SelM′
30
35
40
45
50
To avoid the difficulty of producing Sec-containing protein in E. coli, the Sec residue (U48) in SelM was replaced with Cys, and the protein (SelM′) was successfully overexpressed in E. coli and purified with high purity (Fig. 2, left). The identities of both SelPH and SelM′ were confirmed by MALDI-TOF mass spectrometry. According to the mass spectra, proteins were not significantly modified. (supporting information) The CXXC motif of SelM′ is a potential metal binding site. Binding of Zn2+ to SelM′ was monitored by UV-Vis spectrometry. As shown in Fig. 3-A, titration of Zn2+ to SelM′ led to a linear increase of absorbance at 218 nm. Based on a previous report, 19 this band can be assigned to S-Zn charge transfer, suggesting Zn2+ coordinated to the CXXC motif of SelM′. The absorbance change at 218 nm was plotted versus the molar ratio of Zn 2+ to SelM′. The stoichiometry value was determined to be 0.5. Zn2+ frequently binds with a tetrahedral coordination to cysteine and histidine side chains, for example, in many DNAbinding proteins,20 where it plays primarily structural role. Therefore, two SelM′ molecules may coordinate one Zn2+ cation in the form of a typical C4 type zinc figure, and a protein dimer may formed. To test this hypothesis, apo- and Zn2+-bound SelM′ were analyzed via gel filtration. As shown in Fig. 2 (Right), the apo- form and Zn2+-bound SelM′ was eluted at ca. 73.5 ml and 65.2 ml, corresponding to a monomer and dimer, respectively. During protein purification, we found SelM′ binds to the Ni2+impregnated column, while the U48S variant abolished the ability to chelate Ni2+. Therefore, Cys (or Sec in the wild type SelM) is
80
85
90
95
100
critical for the metal binding ability of SelM′. Considering the higher nucleophilicity of Sec than Cys, the wild type SelM presumedly binds metal ions more tightly. To further investigate the interactions between Zn2+ and SelM′, ZnSO4 (0.4 mM) were titrated into 33 μM SelM′ and the calorimetric changes were monitored using iTC200. Titration of Zn2+ into apo-SelM′ resulted in large exothermic peaks, which eventually diminished to just the heat of dilution after 10 injections. Analysis of the binding isotherm using one set of sites binding model approximated the dissociation constant to be 5.4±0.1 μM, and the binding stoichiometry to be 0.55±0.02, (Fig. 3C, Table 1), in a good agreement with the UV/Vis titration. The H and S was estimated to -1.2E4±15.5 cal mol-1 and -17.8 cal mol-1 K, respectively. Therefore, Zn2+ binding to SelM′ is an enthalpically driven but entropic penalty process. Cadmium (Cd), a toxic environmental contaminant, induces the production of reactive oxygen species and oxidative stress, leading to neurodegenerative disorders such as Parkinson’s disease21 and Alzheimer’s disease.22 Similar as Zn2+, Cd2+ also prefers the “soft” ligand, such as Cys-S,23 and presumedly binds to the CXXC motif of SelM′. ITC was also used to study the interactions between Cd2+ and SelM′. SelM′ (33 μM) was titrated with 0.4 mM CdCl2 and the data was fitted well with a single binding site model, as shown in Fig. 3D. The stoichiometry value and binding constant were determined to be 0.54±0.02 and 3.4±0.3 μM, respectively (Table 1). Similar as Zn2+, Cd2+ binding to SelM′ is also an enthalpically driven reaction, with the H and S measured to -1.7E4±97.7 cal mol-1 and -30.6 cal mol-1 K, respectively (Table 1). Metal binding induced changes in the secondary structure of SelM′. Contents of secondary structures of apo- or metal boundSelM′ were estimated with CDPro software. Zn2+ and Cd2+ binding increased the helix content, but decreased the sheet content of SelM′. The CXXC or CXXU motif is widely present in selenoproteins, such as SelW, SelH and SelT,18 and often acts as an active center. In our study, we found SelM′ chelated Zn2+/Cd2+ via its CXXC (and presumedly CXXU in wild-type protein) motif. Therefore, in addition to SelM, several other selenoproteins (SelW, SelH and SelT, etc) could also possess the metal binding abilities. Metal binding properties of SelP-H Among the human 25 selenoproteins, SelP is unique that contains multiple Sec residues (10 Sec and 16 Cys) in sequence. SelP has
Metallomics Accepted Manuscript
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
10
20 µl of CCK-8 reagent (Beyotime, Shanghai CHN) was added to each well and the cells were incubated at 37 ºC for further 2 h. The absorbance at 450 nm was measured with a reference wavelength at 650 nm using a SpecTRA MAX 190 mciroplate reader (Molecular Devices, Sunnyvale, CA, USA). Triplicates were performed throughout the procedures.
5
10
15
20
25
30
35
Metallomics
Fig.3 Metal binding properties of SelM′ (A) Spectrophotometric titration of SelM′ (1 μM) with Zn2+. Insert, absorbance changes at 218 nm as a function of the [Zn]/[SelM′] ratio. (B) Circular dichroism spectra of apo-, Zn2+- and Cd2+- bound SelM′ in K2HPO4/KH2PO4 buffer (5 mM, pH 8.0). (C) and (D) Isothermal titration calorimetric analyses of the binding of Zn2+ (C) and Cd2+ (D) to SelM′. Top, raw data. Bottom, plot of integrated heat versus the metal/protein ratio. The solid line represents the best fit with one set of binding sites model.
been proved to protect against oxidative injury and to transport selenium from the liver to peripheral tissues. In addition to the high content of selenocysteine, the protein is cysteine- and histidine-rich. SelP encodes two histidine-rich regions; the first consists of nine histidines out of 14 residues, and the second a stretch of 5 consecutive histidines. These regions, in conjunction with the cysteine and selenocysteine content, would be predicted to confer binding to AD related metal ions. Here metal binding properties of the His-rich motif (T179-M263) of SelP (named SelP-H) were investigated. Zn2+/Cd2+ titration to SelP-H led to increases of absorption at 250 and 280 nm (Fig. 4A), which could be assigned to ligand-tometal charge-transfer bands. The secondary structures of apoand Zn2+/Cd2+-bound SelP-H were analyzed via CD. The CD spectrum of apo-SelP-H showed a single maximum at 190 nm and two minimum near 208 nm and 222 nm (Fig. 4B), suggesting the dominance of α-helix. Zn2+/Cd2+ binding increased the ßsheet content of SelP-H. ITC was then used to measure heat flow associated with the interactions of metal ions with SelP-H. The representative thermogram of Zn2+ titration into SelP-H at 25 ºC in 20 mM Tris buffer is shown in Fig. 4C. The data were fitted both with one set of sites model and sequential binding model, and the former was found to give a smaller χ2 value. The best-fit thermodynamic parameters, including stoichiometry (n), dissociation constant (Kd), changes in enthalpy (H) as well as in entropy (S), were summerized in Table 1. The results clearly demonstrate that the binding of Zn2+ to SleP-H is an enthalpy- (H=(-22.1±3.8) kcal
40
45
50
55
60
View Article Online
Fig.4 Metal binding properties of SelP-H. (A) UV/Vis spectra of 50 μM apo-SelP-H and Zn2+/ Cd2+ bound SelP-H. (B) Circular dichroism spectra of 50 μM apo-SelP-H, Zn2+-bound SelP-H and Cd2+-bound SelP-H in K2HPO4/KH2PO4 buffer (10 mM, pH 8.0). (C) and (D) Isothermal titration calorimetric analyses of the binding of Zn 2+ (C) and Cd2+ (D) to SelP-H. Top, raw data. Bottom, plot of integrated heat versus the metal/protein ratio. The solid line represents the best fit with one set of binding sites model.
mol-1) but not entropy (S=-54 cal mol-1 K) driven reaction and two Zn2+ bind to SelP-H with the affinity of (Kd=45.3±20.2 μM). The binding modes of Cd2+ to the protein was also examined for comparison and was found to be similar to that of Zn 2+, that is, one binding site model, with enthalpy (H=(-29.2±1.1) kcal mol1 ) , entropy (S=-78.7cal mol-1 K) and affinity of (Kd=144.9±52.5 μM). Therefore, similar as zinc, Cd2+ binding to SelP-H is an enthaply driven process. Previously, by using the intrinsic fluorescence of Aß42 and zinc-specific dye Zincon, the binding constant (Kd) between Aß42 and Zn2+ was determined to be 91±16 μM,24 which is much weaker than those of Zn2+ binding to SelM′ (5.4±0.1 μM) and SelP-H 23.4±10.5 μM). Presumedly, SelM′ and SelP-H may inhibit Zn2+ binding to Aß42 and prevent Zn2+-induced Aß42 aggregation and neurotoxicity. Effect of SelP-H and SelM′ on Aß42 fibrillization
65
70
ThT fluorescence has been widely used to detect the ß-sheet conformers and their aggregates of Aß42.25 To maximise the aggregate-free character of the amyloidogenic peptide at the zero time point, Aß42 was treated with HFIP which denatured amyloid aggregates and dissociated cross ß-sheet structures. The fibrillization process of Aß42 was continuously monitored by an increase in detection of fluorescence of the dye ThT present in the incubation mixture. A fast increase in ThT fluorescence was observed in accordance with a typical two-phase growth curve (Fig.5A). The kinetic curves of fibrillization were fitted well to the sigmoidal function Boltzmann equations and the rate
Metallomics Accepted Manuscript
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
Page 5 of 10
Metallomics
View Article Online
Page 6 of 10
Table 1 Average best-fit thermodynamic values for Zn2+ and Cd2+ binding to SelM′ and SelP-H in 20 mM Tris buffer (pH 7.4) at 25 ºC.
Zn2+-SelM′ Cd2+-SelM′ Zn2+-SelP-H Cd2+-SelP-H
Downloaded by University of Pennsylvania Libraries on 08/05/2013 05:44:30. Published on 17 April 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20282H
5
10
15
20
25
30
35
40
45
50
0.5±0.0 0.5±0.0 1.8±0.2 2.3±0.3
Kd [μM] 5.4±0.1 3.4±0.3 45.3±20.2 144.9±52.5
H [kcal mol-1] -12.0±0.0 -17.0±0.1 -22.1±3.8 -29.2±1.1
S [cal mol-1 K] -17.8 -30.6 -54.0 -78.7
constants for the fibrillization process (k=0.021±0.005 per min) was determined. SelM′ exhibited little effect on Aß42 fibrillization (Fig. 5A). When Aß42 was incubated with 0.5 molar equivalent of SelM′, the rate constants of fibrillization was determined to k=0.026±0.004 per minute, which is slightly higher than that of control (Aß42 fibrillization in absence of any additive). However, in the presence of SelM′, the maximal level of ThT fluorescence was reduced by 5.9%. Interestingly, SelP-H significantly inhibited Aß42 fibrillization (Fig. 5B). When Aß42 was incubated with 0.5 molar equivalent of SelP-H, the maximal level of ThT fluorescence was decreased more than three fold. The rate constants of Aß42 fibrillization was determined to k=0.041±0.013 per minute, in the presence of SelP-H. Therefore, SelP-H accelerated the fibrillization rate, but decreased the amount of fibrils formed. SelP-H is a proline-rich protein, and a very recent work reported that the proline-rich whey peptides surpressed Aß42 fibrillization, which is in a good agreement with our work.26 Furthermore, it was found that proline rich peptides possessed neuroprotective effects and prevented the neurodegeneration in hippocampus induced by Aß25-35.27 Co-localization of SelP with Aβ plaques in the postmortem tissue from individuals with the hallmark lesions of AD was observed previously.13 These studies suggest that SelP may interact with Aβ directly and play neuroprotective roles in the brain.
55
60
Effect of SelP-H and SelM′ on metal ions induced Aß42 aggregation Addition of one molar equivalent of Zn 2+ to Aß42/ThT mixture almost completely surpressed the formation of ThT-reactive fibrils (Fig. 5-A). Tougu et al reported that Zn2+ and Cu2+ inhibited Aß42 fibrillization and initiated formation of nonfibrillar Aß42 aggregates,28 which is ThT inactive. Metal chelators, such as metallothionein, were found to prevent the metal-induced Aß42 non-fibrillar aggregation via removal of metal ions from Aß42.9 In our study, we found SelP-H and SelM′ exhibited a similar effect. As shown in Fig. 5-B, with the addition of one molar equivalent of SelP-H or SelM′, the inhibitory effect of Zn2+ on Aß42 fibrillization was almost completely abolished. The rate constants of Aß42 fibrillization in the presence of both Zn2+ and SelP-H was fitted to be k=0.022±0.004 per minute, which is quite closed to the value of control. While SelM′ increased the rate constants of Aß42 fibrillization in the presence of Zn2+ to k=0.027±0.008 per minute, around 22.7% higher than the control. A more quantitative analysis of the Aß42 aggregation study is provided by transmission electron microscopy (TME) techniques. The aggregation of Aß42 for 24 h at 37 ºC leads to well-defined Aß fibrils, as confirmed by TEM (Fig. 6-A). However, in the presence of one molar equivalent of Zn2+, almost no fibrils was
65
70
75
80
85
Fig. 5 (A) Effects of SelM′ (10 μM) and SelP-H (10 μM) on fibrillization of Aß42 (20 μM) as followed by ThT fluorescence. (B) Effects of SelM′ (10 μM) and SelP-H (10 μM) on fibrillation of Aß42 (20 μM) in the presence of Zn2+ (10 μM). All experiments were carried out with 20 μM Aß42 in 20 mM PBS, 100 mM NaCl, containing 20 μM ThT at pH 7.4, 37 ºC. Solid lines represent the fits of the data to Boltzmann equation.
observed and Aß42 grown into amorphous aggregates (Fig. 6-B). Both SelP-H or SelM′ inhibited Zn2+-induced Aß42 aggregation and induced the formation of some amount of fibrils. Interestingly, SelM′ revealed a higher inhibitory effect compared with SelP-H, probably due to the higher affinity of Zn2+ towards SelM′. The TEM data agreed well with the ThT assay. These studies clearly show SelP-H and SelM′ have an inhibitory effect on Zn2+-induced Aß42 aggregation, suggesting that these selenoprotein fragments can modulate the neurotoxicity of the formed Aß42 species (vide infra). SelM′ and SelP-H protect neuronal cells against Aß42-Zn2+ toxicity Cell viability experiments with mouse Neuro-2A (N2A) neuroblastoma cells were performed by CCK-8 assay to examine the protective effects of SelP-H and SelM′ against Aß42 and metal ions. In our study, Aß42 was incubated at 37ºC for 24 h in the presence or absence of metal ions and/or selenoproteins, that is, Aß42 has grown to fibrils or metal-induced nonfibrillar aggregates, before added to the cells. As shown in Fig. 7 Lane 4, Aß42 fibrils revealed a limited neurotoxicity (91.4±6.1% cell viability) to N2A cells, supporting the previously reported diminished toxicity of Aß42 fibrils.6b, 29 SelP-H and SelM′ exhibited some nutritional effect on N2A cells, with 115.1±4.5% and 122.8±3.4% cell survival, respectively, when use in 10 μM concentrations (Fig. 7 Lanes 2 and 3). SelP-H, but not SelM′, protected the cells from the limited toxicity of Aß42 fibrils (105.7±6.0% and 94.3±9.2% cell viability, respectively, Fig.7, Lanes 5 and 6).
Metallomics Accepted Manuscript
n
Page 7 of 10
Metallomics
View Article Online
several works previously.32 Studies demonstrated that Aß42 mediated ROS production and oxidative damage to cerebral
45
50
5
Fig.6 Transmission electron microscopy images of Aß42 (A), Aß42 with equivalent of Zn2+ (B), Aß42 with equivalents of Zn2+ as well as SelP-H (C), and Aß42 with equivalents of Zn2+ as well as SelM′ (D), after incubation at 37 ºC for 24 h. The final concentrations of SelP-H, SelM′, Aß42 and Zn2+ are 25 μM. Scale bar = 200 nm. 55
10
15
20
25
Metal-associated Aß species are suggested to be neurotoxic.1b, 30 In our work, we tested the neurotoxicity of Zn2+-induced Aß42 aggregates, which shows a 42.3±4.5% cell survival rate (Fig. 7, Lane 7). Therefore, Zn2+ significantly enhanced the toxicity of Aß42 towards N2A cells. To investigate the effect of SelP-H and SelM′ on the neurotoxicity of Zn2+-induced Aß42 aggregates, either SelP-H or SelM′ was added to the Zn2+-Aß42 mixture which has been incubated at 37ºC for 1 h, and co-incubated for additional 24 h, before added to the cells. Noticeably, 24 h treatment of either SelP-H or SelM′ (10 μM) with the cells including Aß42 (10 μM) and Zn2+ (10 μM) presented much better cell survival (Fig.7, Lanes 8 and 9). SelPH and SelM′ increased the survival rate of N2A cells treated with Zn2+- Aß42 by 1.9 and 1.8 fold, respectively (with viabilities of 79.9±2.8% and 76.4±4.0%, respectively; Fig.7, Lanes 8 and 9). The abilities of SelP-H/SelM′ to reduce the neurotoxicity of Zn2+Aß42 complex suggest that the two selenoproteins removed Zn2+ from Zn2+- Aß42 complex and the free Aß42 grown to fibrils which is much less toxic than the Zn2+ -induced Aß42 aggregates. SelM′ and SelP-H reduced ROS production induced by Aß42Zn2+ in N2A cells
30
35
Metal ions including Zn, Cu and Fe have been shown to promote Aß aggregation, as well as lead to formation of reactive oxygen species (ROS) and oxidative stress.6a, 31 In our work, the ROS levels in N2A cells upon treatment with Aß42 fibrils or Zn2+- Aß42 non-fibrillar aggregates in the presence or absence of either SelPH or SelM′ were detected with the fluorescent probe DCFH and quantified with flow cytometry. As shown in Fig.8, Lane 2, treatment with Aß42 fibrils for 24 h promoted the ROS production in N2A cells by a factor of 1.29±0.05 fold. The ability of Aß42 to induce the production of ROS in cells has been addressed by
60
65
70
75
80
85
Fig. 7 CCK-8 cell viability assay of N2A cells upon treatment with: Lane 1 the control experiment with PBS, lane 2 SelP-H, lane 3 SelM′, lane 4 Aß42 fibrils, lane 5 Aß42 fibrils plus SelP-H, lane 6 Aß42 fibrils plus SelM′, lane 7 Zn2+- Aß42 non-fibrillar aggregates, lane 8 Zn2+- Aß42 non-fibrillar aggregates plus SelP-H, and lane 9 Zn2+- Aß42 non-fibrillar aggregates plus SelM′. The final concentrations of SelP-H, SelM′, Aß42 and Zn2+ are 10 μM. The results were obtained from the average of three experiments.
endothelial cells (CECs) and astrocytes mainly through the activation of the superoxide-producing enzyme, NADPH oxidase.32a, b, 33 As a non redox-active metal ion, Zn2+ did not increase the level of ROS in N2A cells (Fig.8, Lane 6). Unexpectedly, the Zn2+-Aß42 non-fibrillar aggregates dramatically promoted the generation of ROS, with a 2.21±0.02 fold increase relative to control (PBS treated cells), Fig.8, Lane 3. Cu2+-Aß42 aggregate has been suggested to induce ROS production mainly via the redox cycling of copper ion by Fentontype and Haber-Weiss-type reactions,6a, b, 9b, 34 however, the case in Zn2+-Aß42 aggregates should be different. To our knowledge, there have been no reports of the ROS generation induced by Zn2+-Aß42 aggregates previously and the underlying mechanism is unclear. We speculated that the Zn2+-Aß42 aggregates might also trigger some ROS-generating enzyme systems just like Aß42 fibrils. However, future studies are needed to elucidate the exact mechanism. As expected, both SelP-H and SelM′ surpressed the ROS production mediated by Zn2+-Aß42 aggregates. As shown in Fig.8, lane 4 and 5, SelP-H and SelM′ were capable of reducing Zn2+-Aß42 aggregates induced ROS by 50.4% and 57.3%, respectively. Among the 25 human selenoproteins, SelP and SelM are expressed in high level in the brain and involved in the onset and progression of AD, however, the underlying mechanisms of which are far away from clear. Here, we found the His-rich domain of SelP and the Sec-to-Cys mutant SelM blocked Zn2+induced Aß42 aggregation, ROS production and toxicity towards N2A cells, most probably via their capacities of chelating Zn 2+ ions. Sec incorporation in protein at UGA codons requires cisacting mRNA secondary structures and several specialized transacting factors, which makes it very difficult to produce selenoproteins in heterologous expression system. Selenium and sulfur are in the same group of elements in the periodic table and share some properties (e.g., size, electronegativity, major oxidation states), therefore, a Cys homolog was commonly used to investigate the functional and structural properties of the native selenoprotein form. However, Cys and Sec are distinguished by different electrode potentials, nucleophilicity (Cys
