DDT dichlorodiphenyltrichloroethane. PCR Polymerase chain reaction. MS Murashige and Skoog. Introduction. Phytoremediation of organic pollutants involves ...
Phytoremediation of trichloroethylene using transgenic Sesbania grandiflora and Arabidopsis thaliana plants harboring rabbit cytochrome p450 2e1 Ragad Mouhamad. Iyad Ghanem. Malik AlOrfi and Antonious Al-Daoude Abstract Environmental pollution is a global concern that is threatening the well-being of all life forms including humans. Phytoremediation offers an attractive option for cleaning up contaminated sites due to its low cost and safety implementation. Trichloroethylene (TCE) is an important environmental pollutant, a well established rodent carcinogen and a probable human carcinogen. TCE metabolism occurs primarily via cytochrome p450 2e1 (p450)dependent oxidation, a key enzyme in the metabolism of a variety of halogenated compounds. In this work, Sesbania grandiflora and Arabidopsis thaliana plants were genetically engineered to constitutively express the rabbit cytochrome p450 with increased activity toward TCE removal. Gas chromatography (GC) analysis revealed that Sesbania transgenic plants exposed to TCE in small hydroponics’ vessels, had higher removal rate of TCE compared to plants transformed with the control empty vector and were more efficient in breaking down TCE since the presence of TCE metabolite products was much higher in the cytochrome p450 transformed plants. Keywords Agrobacterium-mediated transformation. Sesbania grandiflora. Phytoremediation. Trichloroethylene. Cytochrome p450 2e1. Abbreviations TCE trichloroethylene DDT dichlorodiphenyltrichloroethane PCR
Polymerase chain reaction
MS
Murashige and Skoog
Introduction Phytoremediation of organic pollutants involves the biochemical decomposition of foreign chemicals (xenobiotics) in plant tissues. Metabolism of xenobiotics in plants usually takes place in three phases. In Phase I xenobiotics may undergo hydrolysis, reduction, or oxidation transformations. Phase I enzymes are also involved in a number of reductive reactions, generally under oxygen-deficiency condition. Typically, these reactions result in the introduction of functional groups in the molecule or the exposure of preexisting functional groups and lead to the formation of more polar, more water-soluble, and chemically more reactive and sometimes biologically more active derivatives. Therefore, Phase I is often called the bioactivation phase of metabolism. In Phase II the actual detoxification happens: the product of the Phase I transformation is bound to an endogenous sugar of peptide molecule. Phase III represents the final removal and decomposition of these conjugates via exporting them into the cell vacuole, and/or incorporating them into biopolymers, such as lignin.
In this study the importance of Phase I type biotransformation are reviewed. Phase I reactions are most important in the phytoremediation of hydrophobic, chemically stable pollutants, such as aromatic carbohydrates and (poly)chlorinated aliphatic and aromatic hydrocarbons. Although Phase I reactions involve a wide range of chemical transformations from hydrolysis to reduction, the most common Phase I reactions are oxidative processes that involve cytochrome P450 enzymes. These enzymes support the oxidative, peroxidative and reductive metabolism of both endogenous and xenobiotic substrates. They comprise a superfamily of heme-thiolate proteins present in every class of organism. Cytochrome P450 enzymes are characterized by the high diversity of reactions that they catalyze and the high range of their chemically divergent substrates. Increasing emphasis on functional genomic approaches to P450 research recently has greatly advanced our understanding of cytochrome P450-mediated reactions in plants (Nelson et al. 2004). Transgenic plants with tailored Phase I enzymatic activities may play major roles in the removal of environmentally stable organic pollutants from contaminated fields. Hybrid poplars (Populus trichocarpa × Populusdeltoides) take up and degrade TCE, producing the same TCE metabolites as mammals (Newman et al., 1997; Gordon et al., 1998). In a controlled study hybrid poplar removed over 99% of the added TCE (Newman et al., 1999). Less than 90% of the TCE taken up was transpired, as detected by leaf bag experiments. In order to determine if poplar cells have an inherent ability to degrade TCE, or if microorganisms are responsible for the degradation, studies were conducted with suspensions of pure poplar culture cells. When these poplar culture cells were dosed with TCE, the same metabolites were seen as those in the whole plant (Newman et al., 1997; Shang et al., 2001; Shang & Gordon, 2002). Experiments with both poplar culture cells and whole plants demonstrated that the primary metabolite, trichloroethanol, is glycosylated, as happens in mammalian systems (Shang et al., 2001). The common pollutants TCE, carbon tetrachloride, chloroform, benzene, and vinyl chloride are all substrates of the mammalian isoform P450 IIE1, which is encoded by the CYP2E1 gene. When the hCYP2E1 gene was overexpressed in tobacco plants, the transgenics produced hundreds of times more TCE metabolite than did the nontransgenics, and removed 98% of the ethylene dibromide, another substrate of the P450 2E1 enzyme, compared with 63% removal by the null vector control plants (Doty et al., 2000). The P450 2E1 enzyme from rabbit was successfully expressed in hairy root cultures of Atropa belladonna (Banerjee et al., 2002). These mammalian enzymes functioned well in plants without any need to modify the gene or to include the other enzymes, oxidoreductase and cytochrome b5, known to be required for full function of mammalian P450s. Apparently the plant versions these common enzymes are sufficiently similar to the mammalian versions that the P450s can function with either type. In another study, the CYP2E1 gene was also overexpressed in hybrid poplar (Populus tremula × Populus alba). TCE metabolism in the transgenic poplar cuttings in 40-ml vials was enhanced > 100fold compared with vector control plants (Doty et al., 2007). The transgenic poplar clone with the highest expression of the CYP2E1 transgene removed TCE faster than other transgenic plant lines. In order to estimate how high the expression of the transgene was relative to that of a native poplar gene, quantitative reverse transcriptase–polymerase chain reaction (RT-PCR) was used (Singleton, 2007).
The expression level of the CYP2E1 transgene was nearly 30 000 higher than the expression of the native P450 gene. This transgenic line also exhibited increased removal rates of other substrates of P450 2E1. In 1 weak, the transgenic plants removed 92–94% of the carbon tetrachloride while the control plants removed only 10–20%. Chloroform too, a serious environmental pollutant, was removed 9-fold more rapidly, and the highly toxic vinyl chloride 3-fold more rapidly. The CYP2E1 transgenic poplar also removed volatile TCE and benzene from air at greater rates than did the control plants. While the nontransgenic poplar did not remove a significant amount of TCE from air, the CYP2E1 transgenic plants removed nearly 80% of the TCE in 1 weak.
In vivo and in vitro experimentation has largely demonstrated the involvement of cytochrome P450s monooxygenases, the largest family of enzymatic proteins in higher plants in the metabolism of TCE and pesticides (Werck-Reichhart et al. 2000). Another common pollutant is the insecticide DDT which was first synthesized in 1874, commercially made available since 1945 and banned latter in the early seventies in several countries due to its long persistence in all environmental media, its acute toxicity and its accumulation in organisms, soils, surface water and ground water and thus its incalculable long-term effects (Doty,2000). Sesbania grandiflora (L.) pers Febaceae, commonly known as Sesbania and Agatha is an important legume tree and dietary nutrition source in many Southeast Asian countries. Moreover, it can tolerate high concentrations of organic compounds and take up dioxin through its roots and volatilize it through the leaves such as TCE. Thus, it can be efficiently utilized to clean up contaminated sites (Newman, et al 1997a). Consequently, the aims of the current study were to enhance Sesbania capability of removing organic contaminants through the generation of transgenic plants of Sesbania grandiflora containing rabbit cytochrome p450 2e1 using Agrobacterium mediated transformation, to test the effect of cytochrome p450 2e1ectopic constitutive expression on TCE and dichlorodiphenyltrichloroethane (DDT) removal and metabolisms. Materials and Methods Plasmid Constructions. A 1.7-kb EcoRI fragment containing the P450 2E1 cDNA (Umeno,et al 1988) kindly provided by Frank Gonzales (National Institutes of Health, Bethesda, MD) was subcloned between the Mac promoter (Comai, et al, 1990) and the mas terminator (McBride & Summerfelt, 1990) in the vector pKH200, which was kindly provided by Luca Comai (University of Washington). The 3.8-kb BglII fragment containing Mac-CYP2E1-mas 39 was subcloned into the BamHI site of the binary vector pCGN1578 (McBride & Summerfelt, 1990), which was provided by Luca Comai. The resulting plasmid, pSLD50-6, was introduced into Agrobacterium by electroporation (Cangelosi, et al 1991). Bacterial strains Agrobacterium tumefaciens strain C58C1 was used to transform Sesbania and Arabidopsis plants respectively. Strains were maintained on LB medium supplementated with the appropriate antibiotics, kanamycin sulfate (50 mg/l) and carbinicilline (100 mg/l) at 28°C.
Plant material: Sesbania grandiflora seeds was procured and used for transformation experiments. The seeds were sterilized by washing in Teepol (commercial bleach solution, 0.6% sodium hypochlorite, for 15 min., rinsed with distilled water three times, followed by soaking in it for 8hr. The soaked seeds were treated with 70% ethyl alcohol for 30sec, then rinsed with sterile water for three times and surface sterilized in 0.1% (w/v) mercuric chloride solution for 3 min. Then the seeds were rinsed with sterile water three times to remove the surface sterility. Pre-culture of explants: The sterilized seeds were kept in sterile moist cotton for 24hr. Then their seed coats were separated and aseptically removed without disturbing the cotyledons. The cotyledons were carefully dissected from the embryonic axis. The distal end of the cotyledon explants (0.5 cm in length) was cut or injured slightly in such a way that the distal end touched the medium. MS medium containing IAA ( Indole-3-Acetic Acid ) (1.0 mg L¯1) and L-Glutamine (20 mg L¯1) was used for shoot regeneration . The cultures were kept at 25 ± 2 ºC with a 16h photoperiod with the light intensity of 30 µmol m-2 s-1 under cool white fluorescent lamps. Agrobacterium infection and co-cultivation: The proximal end of the cotyledon was gently pricked for ten times to make wounds using sterile needle (Dispovan India Ltd., 0.63 X 25 mm). Then the cotyledon explants were immersed in the bacterial culture for 10 min. After that the explants were removed, blotted dry using sterile Whatman no.1 filter paper and inoculated (one explants/culture tube) on MS medium containing IAA (1.0 mg L¯1) and Kn (1.5 mg L¯1). The co-cultivation was performed for 0, 1, 2, 3, 4 and 5 days under a 16h photoperiod with a light intensity of 30 µmol m-2 s-1 and kept at 25 ± 2 ºC. Selection of transformants: In Vitro Transformation of Cotyledon Explants Sesbania seeds were surface sterilized and then sown in 9 cm Petri dishes containing 30 ml of Murashige & Skoog (MS) medium supplemented with 0.8% (w/v) agar and 3% sucrose (w/v), pH 5.7. Seeds were germinated at 25 °C with a 16 h photoperiod, under white fluorescent light (3000 lux). Seven days after germination, cotyledons were excised and inoculated with Agrobacterium strains. Overnight bacterial cultures were grown in 25 ml LB medium at 28 °C in an orbital shaker (150 rpm). For disarmed strains, LB medium was supplemented with 50 μg/l kanamycin and 100 μg/l Carbinicilline antibiotics. Cotyledon explants were immersed in overnight bacterial cultures diluted 1:100 (v/v) in 25 ml liquid MS medium containing 3% sucrose for 10 minutes then transferred to co-cultivation medium (semi-solid MS medium without antibiotics) for 2 days. After cocultivation, cotyledon explants were transferred to MS medium supplemented with 0.8% (w/v) agar, 3% sucrose (w/v) 50 mg/l kanamycin as a selective agent and 400 mg/l Carbinicilline to kill the bacteria. This medium also included 1.50 mg/l Kn (Kinetin) and 0.10 mg/l IAA. Control explants were dipped into liquid MS medium without bacteria. Inoculations were carried out in a laminar flow hood. A minimum of 100 explants per strain were used. They were subcultured every 2 to 3 weeks. The rooted plants were transferred to pots containing sterilized peat, soil (1:1v/v) mixture and 50 mg/l kanamycin were acclimatized in green-house for 30 days.
Arabidopsis transformation procedure Fifteen-day-old seedlings were transplanted in plastic disposable pots (10x10x10cm) at a density of ~8-12 plants per pot and grown at 23°C in a controlled growth chamber under short days (10h photoperiod) to ensure rosette formation. Light was supplied by an equal mixture of Osram White L100/23 and Warm White L100/30 (2400mm) fluorescent tubes with a rating of 8600 lumen. After four weeks plants were removed to a glass house (16h photoperiod) to induce flowering. Primary bolts were clipped to encourage secondary inflorescence growth and plants were used for infiltration 7-10 days later when approximately 30% of the flower buds were open. Agrobacterium tumefaciens strain C58C1(p) bearing the binary vector was grown in 500ml LB supplemented with the appropriate antibiotics at 28°C for 48h in an orbital shaker (200-250rpm). Cells were harvested by centrifugation at 4000g for 10min and pelleted cells were resuspended in 5% sucrose solution supplemented with Silwet-L77 (0.02%). Each plant pot was inverted into the A. tumefaciens suspension in a plastic container that was big enough to allow the pot to be gently moved in half-circles for 30 seconds. Excess medium was blotted from the dipped plants, which were then covered in a contained propagator for a few days and left to set seeds. Plant DNA isolation Isolation of Genomic DNA: Genomic DNA was isolated from young leaves of control and transformed plants using previous method[22]. * PCR confirmation: For PCR analysis, DNA samples from putative transformants were amplified by bar specific primers. The bar gene fragment (0.46 kb) was amplified by using the forward primer - 5’-ATC GTC AAC TAC ATC GAG AC – 3’ and reverse primer 5’-CCA GCT GCC AGA AAC CCA CGT C-3.’All PCR reactions were performed using a Peltier effect thermal cycler (MJ Research Co., USA). Samples containing 50 ng genomic DNA were first heated at 94 C for 5 min followed by 30 cycles at 94 ºC for 30s, 55 C and 72 ºC for 30 s followed by 7 min final extension at 72 ºC. Fifty ng of plasmid DNA was used as positive control. The PCR reactions contained 10 pM of each primer, 10 mM dNTPs mix, 15 mM MgCl2, 50 mM KCl, 10 mM Tris HCl (pH 9.0), 0.1% (v/v) Triton X- 100, 2 U of Taq DNA polymerase and 50 ng of template DNA in 2X reaction buffer. The amplified DNA were analysed by using 1.5% agarose gel electrophoresis. Polymerase chain reaction Transformed tissues that were able to regenerate and grow in medium supplemented with kanamycin and carbinicilline were used for genomic extraction and amplification by PCR with specific CYP 2E1 primers (THE 35S promoter with the sequence 59 CATCGGGAATCTTCTCCAGTTGG 39, and the reverse with the sequence 59 TGAAGGGTGTGCAGCCGACAA 39) using the standard protocols (Sambrook and Russell 2001) to determine the presence of the transgene in the plant genome. PCR was performed using a Mastercycler Gradient (BioRad, USA) machine. All the amplifications were carried out in 25 µl reaction volume containing template DNA (300 ng genomic DNA or 50 ng plasmid DNA), 1 X PCR buffer, dNTP mix, 1 mM MgCl2, 20 pmole primer each, and 1.5 U taq DNA polymerase. PCR conditions were set for an initial denaturation step of 5 min at 95°C and subsequently 30 cycles
of denaturation (95°C, 1 min), annealing (55°C, 45 s) and elongation (72°C, 1 min) followed by a final extension step of 10 min at 72°C. Gus assay Explants were assayed for the expression of gus A into gene following the histochemical procedure[19]. Cotyledon explants 8hr after cocultivation and 3-week old young leaves from transformants were washed in distilled water three times and followed by incubation for 10 min in phosphate buffer (0.5 mM NaH2PO4 and 0.5 mM Na2HPO4), pH 7.0 containing 0.5 mM potassium ferri and ferro cyanide and 10 mM Na2EDTA. The buffer was removed and fresh phosphate buffer containing 1% (v/v) Triton X-100 was added to the leaf tissues and incubated for 1h at 37 ºC after draining the solution, again fresh phosphate buffer containing 1.0 mM Xgluc(5-bromo-4-chloro-3-indolyl â-D glucuronide) and 20% of 95% methanol was added. The reaction was placed under a mild vacuum for 5 minutes and incubated overnight at 37 ºC and then the tissues were examined visually. Following the incubation the chlorophyll was removed and fixed in 95% (v/v) ethanol:1% (v/v) glacial acetic acid. Western blot analysis Total root protein was extracted by mixing powdered roots with 1.53 SDS loading buffer (2 mlygm of fresh weight), boiling for 5 min, and centrifuging at 12,000 3 g for 5 min. SDSyPAGE gels were run with a Bio-Rad miniProtean II, and the proteins were transferred to poly(vinylidene difluoride) membranes with the Amersham Pharmacia Mighty-Small Transfer Unit at 400 mA for 1 h. After blocking for 1 h with 5%nonfat milk in Tris-buffered saline (TBS), blots were incubated with diluted rabbit anti-human P450 2E1 that was kindly provided by K. E. Thummel (University of Washington) or goat anti-rat 2E1 (Gentest, Woburn, MA) for 1 h. Blots were washed three times with TBSyTween 20 (0.1%) before incubation with the appropriate peroxidase-conjugated secondary antibody. Blots were washed four times with wash buffer (20 mM Tris, pH7.4y0.5 M NaCly0.5% Tween 20). Blots were developed by using Amersham Pharmacia’s Enhanced Chemiluminescence or Enhanced Chemiluminescence Plus according to the manufacturer’s instructions.For quantization, the blots were dried and analyzed with the Storm PhosphorImager from Molecular Dynamics. A standard curve was made with 2–20 ng of purified human P450 2E1 protein (Chen,1996), generously provided by S. D. Nelson (University of Washington). TCE and DDT Exposure The Arabidopsis seeds progeny F2 and Sesbania stems of cuttings were surface-sterilized with 10% bleach for 12 min and then rinsed three times with sterile water. Seeds and Cuttings were grown hydroponically for 4–6 weeks. The hydroponic solution was dosed with 50 ml of DDTsaturated half-strength Hoagland’s solution to a level of 20µg/ml DDT. After 10 days, whole plants were drying and prepare to extraction e.TCE Exposure was used the Arabidopsis seeds progeny F2 and Sesbania stems in 50 gram soil: peat (1:1 v:v) . The hydroponic solution was dosed with 50 gram of TCE-saturated half-strength Hoagland’s solution to a level of 2% TCE After 12 days whole plant were frozen in liquid nitrogen and stored at 280°C and extraction.
Extractions of TCE-Exposed Plant Tissues Tissues were ground with mortar and pestle in liquid nitrogen. Samples (1 g) were weighed out and transferred to chilled glass centrifuge tubes. Samples (2 ml) of 1 M H2SO4y10% NaCl were added to each tube and the tubes were shaken vigorously for 1 min. Samples (10 ml) of tertbutyl methyl ether were added, and the tubes were again shaken for 1 min. Centrifugation at 4°C was done for 10 min at 8,000 3 g, and 7 ml of the supernatant was transferred to vials containing 2 g of Na2SO4. After 1 h, 1-ml samples of the extract were placed in GC autosampler vials. Extractions of DDT-Exposed Plant Tissues DDT was extracted by hydro distillation for three hours using a cellulose thimble and insulted into Sohxlet flask 120 ml of Hexane: acetone (1:1,v:v) were added to the sample. Sohxlet extraction was carried out for 3.5 hour on 60oC. Extract was transferred into a conical, round bottom tube, Sohxlet and flask was washed three times with extraction solution (2ml) and washing solvent was added to the original extract. Extract was reduced in volume flask using stream of nitrogen khaldal (Turbo Vap LV) volume was adjusted to 1 microleter of extract, then the DDT separate and stored under -10C0 for injected into GC. GC Analysis The GC system used consisted of a Perkin–Elmer Autosystem gas chromatograph equipped with an electron capture detector (ECD). An XTI-5 (Restek, Bellefonte, PA) 30-m, 0.25-mm internal diameter column with a stationary phase thickness of 1.0 mm was used. The oven temperature was ramped from 40°C to 200°C. Analysis was done with the TURBOCHROM NAVIGATOR (Perkin–Elmer) Version 6.1.0.2. Calibration curves were made for trichloroethanol by using commercially obtained trichloroethanol (Sigma). Results and discussion Sesbania grandiflora and Arabidopsis thaliana transgenic plants containing the rabbit Cytochrome p450 2e1 were obtained using Agrobacterium-mediated transformation. Selection of Sesbania grandiflora transformants was carried out at 100 mg/l kanamycin sulfate and 200 mg/l carbinicilline. Twelve replicates and two replicates each with 40 candidates were transformed with plasmid pSLD50-6 harboring the rabbit CYP2E1 cDNA and with the empty plasmid pSLD50-6 as a control respectively. Increased Metabolism of TCE in Arabdopsis and Sesbania. By using Agrobacterium tumefaciens-mediated plant transformation, we developed Arabdopsis and Sesbania plants that strongly express an enzyme capable of TCE metabolism. An early metabolite of TCE after oxidation is Chloral, Trichloroethanol, a compound that is found in both plants. We exposed small cuttings taken from the apical stem of Sesbania and transgenic Arabidopsis seed containing either the transgene, CYP2E1, or a null vector to TCE in 50-gm vials. Was then monitored the appearance of the early metabolite Chloral, and Trichloroethanol in plant tissues. The CYP2E1-containing transgenic cuttings Sesbania and Arabdopsis plants had an
average increased TCE metabolism that was nearly 75- 90 fold respectively greater than in the control cuttings (Fig. 1& 2).while, The transgenic cuttings grew normally and did not display any adverse reaction of the TCE or its metabolites.
Figure (2): Concentration percentage of TCE and its metabolism to Chloral, and Trichloroethanol in transgenic Arabidopsis and Sesbania plants and Wild type (control) Arabidopsis and Sesbania plants.
Figure shown the behavior corresponding between the plant species in metabolism TCE in cell tissue. The Arabidopsis transgenic line shown absorbance of TCE could be translocated to Chloral more than TCEOH, the same thing happing in Wild type Arabidopsis plant. while, in Sesbania transgenic plants and Wild type shown absorbance plants TCE could be translocation to TCEOH more than Chloral, thus, maybe discus about ability of plants in absorbance and translocation the metabolism of TCE in plant cells. Corresponding results with, recent study in mouse liver microsomes, found that pretreatment of mice with pyrazole, which induces CYP2E1, enhanced lipid peroxidation due to CH, whereas addition of a general P450 inhibitor reduced CH-induced lipid peroxidation. This suggested that metabolism of CH to TCOH and TCA is catalyzed primarily by CYP2E1(1). Another study also found hybrid cottonwood trees are commonly used for phytoremediation applications because of their water uptake potential and the ability to degrade TCE. The cottonwood and sycamore trees exhibit the ability to degrade TCE into TCEOH, as well as high TCAA. Also, Sweetgum and willow trees produce trichloroacetic acid in the presence of TCE even though no detectable levels of TCEOH are observed. The volatility of TCEOH may account for this decrease. Although tobacco study appears to transport and transpire TCE, the levels of metabolites observed are insignificant compared to the trees observed. Plant’s ability to degrade TCE, different with plants species, its have shown that native southeastern plants are capable of degrading TCE and may be used for phytoremediation
In this study results were more than poplar hybrids removed trichloroethylene (TCE) from artificially contaminated (260 mg L-1) water and soil evaporated
