Removal of a 67-base-pair sequence in the noncoding region of

Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4987-4991, August 1985

Biochemistry

Removal of a 67-base-pair sequence in the noncoding region of protooncogene fos converts it to a transforming gene (BAL-31 deletions/DNA transfection/oncogenic activation/post-transcriptional regulation)

FRITS MEULINK, TOM CURRAN*, A. DUSTY MILLERt, AND INDER M. VERMA Molecular Biology and Virology Laboratory, The Salk Institute, P.O. Box 85800, San Diego, CA 92138

Communicated by Renato Dulbecco, April 19, 1985

ABSTRACT Transformation of fibroblasts by protooncogene fos (c-fos) requires the linkage of viral long terminal repeat (LTR) sequences and interruption of 3'-noncoding sequences. We have identified an A+T-rich stretch of 67 nucleotides, located 627-693 base pairs downstream from the coding domain and 123-189 base pairs upstream from the putative poly(A) addition site, removal of which confers transforming activity to the c-fos gene. A novel regulation of the expression of the c-fos gene is proposed, which may be functional in vivo to prevent the gene from becoming an oncogene.

3' untranslated part of the c-fos mRNA was identified to be crucial for the 3' interactions. Removal of this A+T-rich DNA stretch or alterations in the COGH-terminal coding domain of the c-fos gene are sufficient to activate its transforming potential.

MATERIALS AND METHODS Nucleic Acid Manipulations. Manipulations of DNA were generally according to standard procedures (24). The deletion mutants displayed in Fig. 1 were made by BAL-31 digestion of BamHI-digested VMM'(A)n (23) DNA at 16'C. The resulting fragments were ligated to BamHI linkers and cut with BamHI and HindIII, and the trimmed fragments were isolated and ligated with the appropriate BamHI-HindIII fragment from the original VMM'(A)n construct. Constructs

Protooncogenes are normal residents of chromosomal DNA of a wide variety of species ranging from yeast to man (1-3). A role of their gene products has been postulated in cell growth, differentiation, and in pre- and postnatal development of birds and mice (4-14). Thus, it is an enigma that the products of the protooncogenes can also induce neoplastic transformation. We have been studying the mechanism of transformation by protooncogene fos and its viral cognate, v-fos. v-fos is the transforming gene of Finkel-Biskis-Jinkins murine osteosarcoma virus (FBJ-MuSV) which induces bone tumors in newborn mice and transforms fibroblasts in vitro (15-17). The c-fos gene is expressed constitutively in extraembryonal tissues and in a variety of hematopoietic cell types (9, 11-13, 18). Additionally, when mouse fibroblasts are stimulated to proliferate by a variety of mitogens, the c-fos gene is rapidly, though transiently, induced (6-8, 19). The c-fos and v-fos gene products differ at their COOH termini as a consequence of an out-of-frame deletion that occurred during the biogenesis of the v-fos gene (20, 21). Despite structural differences, both the c-fos and the v-fos proteins are nuclear (22). However, unlike the v-fos gene, the c-fos gene is unable to transform fibroblasts in vitro (23). At first glance it would appear that the difference in transforming ability is a reflection of the altered COOH termini, but results from our laboratory have demonstrated that both v-fos and c-fos proteins can induce transformation of cultured rat fibroblasts (23). The c-fos gene can transform fibroblasts, provided that two manipulations have been carried out: (i) addition of a long terminal repeat (LTR) and (ii) deletion of 3' interacting sequences involving noncoding regions. These observations led to the proposal that the expression of the c-fos gene is regulated posttranscriptionally (23). Because this would be a novel type of regulation, we wanted to analyze the nature of the 3' interacting sequences. To delineate the nucleotide sequences involved in the 3' interactions, we have generated a series of deletion mutants in the 3' untranslated region and the COOH-terminal coding domain of the c-fos gene. A 67-nucleotide stretch located 123-189 nucleotides from the polyadenylylation signal in the

LJ402 and LJ403 were made in the same way except that LJ40 rather than VMM'(A)n DNA was used. Deletion mutants LJ-CD6 and LJ-CD8 were made by digesting Sac I-cut VMM' (23) DNA with BAL-31 and recircularizing and cloning the trimmed DNA. Deletions were characterized by restriction mapping and in a number of cases by direct sequence analysis. Clone LJ40A was constructed by linearizing VMM'(A)n with Mst II and filling in the recessed ends with DNA polymerase I (Klenow fragment). BamHI linkers were added and, after digestion with BamHI, an 800-base-pair (bp) fragment was isolated. This fragment was inserted in the BamHI site of clone LJ40. The orientation was verified by direct sequence analysis. Construction of LJ40L, LJ66L, and LJ50L was as follows. LJ40, LJ66, and LJ50, respectively, were cut with BamHI and ligated to a 2.3-kilobase (kb) Bgl II-BamHI fragment isolated from plasmid pFBJ-2 (containing the proviral FBJ-MuSV DNA; ref. 17). The correct orientation was verified by restriction mapping. These three constructs contain 413 bp of pl5E murine leukemia virus DNA before the LTR (20) and about 800 nucleotides of rat genomic sequences 3' from the LTR. Construction of LJ100 and LJ110 was as follows. The sequences between the Sal I and Bcl I sites (LJ100) or between the Pvu II and Bcl I sites (LJ110) were deleted; after treatment with Klenow fragment of DNA polymerase I, Sal I linkers were added, and the plasmid was recircularized. Assays. Focus assays were performed essentially as described by Miller et al. (23). Briefly, cells were plated at 5 x 105 cells per 5-cm dish 1 day before transfection, and the cells were not trypsinized but only washed with Tris-buffered saline the day after transfection and afterwards were fed every 3 days with Dulbecco-Vogt-modified Eagle's medium Abbreviations: LTR, long terminal repeat; MuSV, murine sarcoma virus; FBJ-MuSV, Finkel-Biskis-Jinkins MuSV; SV40, simian virus 40; bp, base pair(s); kb, kilobase(s). *Present address: Department of Molecular Oncology and Developmental Biology, Roche-Research, Nutley, NJ 07110. tPresent address: The Fred Hutchinson Cancer Research Center, Seattle, WA 98104.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

4987

4988

Biochemistry: Meijlink et alPProc. NatL Acad Sci. USA 82 (1985)

containing 5% fetal calf serum and 0.002 mM dexamethasone. Usually two different concentrations of each plasmid were tested. Foci were visible 10-14 days after transfection. Cells were stained and counted after 20 days.

RESULTS Deletion Analysis in the 3' Noncoding Region. Because activation of the c-fos gene also requires linkage to an LTR (presumably supplying transcriptional enhancer elements), we used a nontransforming recombinant construct, VMM'(A), to make deletions in the 3' noncoding domain. VMM'(A)0 consists of (t0 the 5' LTR of FBJ-MuSV, (ii) sequences encoding the first 316 amino acids of the v-fos protein and 64 amino acids of the COOH terminus ofthe c-fos protein, (Mii) the complete 3' noncoding region of the c-fos gene (816 nucleotides) plus about 700 nucleotides of the 3' flanking sequences, and (iv) a 244-bp stretch of simian virus 40 (SV40) DNA containing a poly(A) addition signal (Fig. LA). The encoded protein is identical to the predicted c-fos protein except for changes in five single residues (20). Fig. 1B shows the structure of a second construct, VM(A)0 (23), in which sequences downstream from the coding domain,

A

VMM'(A)n

°

including the c-fos poly(A) signals, have been removed, but the SV40 poly(A) addition signal sequences have been retained. Unlike VMM'(A)", VM(A), can induce transformation ofrat 208F fibroblasts in vitro, indicating that removal of approximately 1.4 kb of sequences between restriction endonuclease sites Sal I and BamHI (Fig. LA) can restore transforming activity (23). Our strategy to identify nucleotide sequences involved in the 3' interactions was to generate a nested set of deletion mutants from the BamHI site encompassing the 1.4-kb region. VMM'(A)n DNA was linearized by cleavage with BamHI and then digested with exonuclease BAL-31. The truncated DNA was ligated to synthetic BamHI linkers and cleaved with BamHI and HindIII, which has a single site upstream of the 5' LTR (see Fig. LA), to generate a fragment containing the hybridfos gene. The corresponding HindIII-BamHI fragment of the original VMM'(A)n plasmid was then replaced with the truncated fragment. Thus, in the resulting construct, only sequences upstream from the SV40 poly(A) addition sequence are deleted. Appropriate recombinant constructs were recloned and their precise identity was established by restriction analysis and, in many cases, through direct DNA sequence analysis. Fig. 1B also displays the structure of a number of deletion

_a

so N

LTR

H

N S

ATG

TGA

PBcM

C-f(fos poly{(A)

SV40

poly(A)

B

TRANSFORMATION

VMM'(A)nU VM (A)n

I

LJ61 LJ46

+

.............................

=

ZE

. .

.. . . LJ56 LJ54 a..................... ........... LJ73 ......-..-.--.LJ50 a........... LJ6 6 LJ71 a........... LJ40 ........ ........ LJ402 LJ4 03 LJ40A

+1-

.................

+/-

........................

.................

.........................

LJ50L LJ66L LJ40L LJ100 ............. LJ110=

.........

..........-...........

o

w

+1-

a

FIG. 1. Properties of deletion mutants. (A) Structure of the VMM'(A), construct; most of the vector portion [the pBR322 sequence between the Pvu II and HindIII sites in which the EcoRI site is replaced by a Sal I site (23)] is omitted. Wavy lines represent cellular rat sequences adjacent to FBJ-MuSV proviral DNA (17); hatched boxes, FBJ-MuSV LTRs; closed boxes, protein-coding regions of the c-fos gene; open box, v-fos protein-coding region; cross-hatched box, SV40 sequence containing the polyadenylylation signal. (B) Features of deletion mutants, aligned with VMM'(A)"; deletions are indicated as dotted lines. Only restriction sites used in the construction of the mutants are shown. The names of the deletion mutants (LJ = La Jolla) appear at the left, the result of the transformation assay at the right of the maps. Negative transformation (-) is defined as similar to the VMM'(A)" construct, which induces 5-30 foci per gg of DNA. Positive transformation (+) is 100-700 foci per ,ug of DNA and intermediate transformation (+ / -) is between 45% and 80% of the positive control. In Table 1 the number of times each construct was tested is indicated.

Proc. NatL Acad Sci USA 82 (1985)

Biochemistry: Meijlink et aL mutants along with their transforming potential as assayed by focus formation. In all focus assays involving the constructs shown in Fig. 1B VMM'(A)" was included as a negative control, while VM(A)" served as the positive control. As described previously, the nontransforming construct VMM'(A), does induce some foci (-5-25/,g of DNA), possibly due to rearrangement ofthe transfected DNA. Thus, negative for transformation is defined as the number of foci per ,ug equal or below that obtained with VMM'(A),. In the positive transformation, numbers of foci were at least 10 times higher than the negative control and were essentially equal to the number of foci induced by VM(A)". The number of foci obtained per ,g of transfected DNA varied from 100 to 700. Two nearly identical mutants LJ66 and LJ71 were classified as "intermediate" because transformation by these constructs yielded 40-85% of the numbers observed in the positive control. The precise nature of some of the deletion mutants and the extent of deletion are shown in Fig. 2 and Table 1. Comparison of the transforming ability of the deletion 2 H

LTR

10

O

C4

4

(n C-) M

N S

PBcM

-

N

B

(PBR322_) ~M (PBR322) ATG

TGA

c-fos

poly(A)

SV40

poly(A)

K ooo

2800

GTCGACCTAGGGAGGACCTTACCTGTTCGTGAAACACACCAGGCTGTGGGCCTCAAGGAC

2859

2860 TTGCAAGCATCCACATCTGGCCTCCAGTCCTCACCTCTTCCAGAGATGTAGCAAAMCAA

2919

2920 AACAAAACAAAACAAAAAACCGCATGGAGTGTGTTGTTCCTAGTGACACCTGAGAGCTCG

2979

2980 TAGTTAGTAGAGCATGTGAGTCAAGGCCTGGTCTGTGTCTCTTTTCTCTTTCTCCTTAGT

3039

3040 TTTCTCATAGCACTMCTAATCTGTTGGGTTCATTATTGGAATTAACCTGGTGCTGGATT

3099

SalI

LJl1O 3100 GTATCTAGTGCAGCTGATTAACAATACCTACTGTGTTTCCTGGCMTAGCGTGTTCCA Pvu I1

3159

3160 ATTAGAAACGACCAATATTAAACTAAGAMAGATAGGACTTTATTTTCCAGTAGATAGAA LJ100 LJ110 3220 ATCAATAGCTATATCCATGTACTGTAGTCCTTCAGCGTCAATGTTCATTGTCATGTTACT LJ40, LJ40A -c1

3219

3280

GATCATGCATTGTCGAGGTGGTCTGAATGTTCTGACATTAACAGTTTC LJ71 LJ66 rI re,

TGAAAACGT LJ5O

3340 TTTTATTGTC-TTTTCAATTTATTTATTAAGATGGATTCTCAGATATTTATATTTTT TT LJ40A 3400 TATTTTTTTCTACCCTGAGGTCTTTCGACATGTGGAAAGTGAATTTGTCAAAAATTTT Mst

3279 3339 3399 3459

U

AAGCATTGTTTGCTTATTGTTCCAGGACATTGTCAATMAAAGCATTTAAGTTGAATGCGA

3519

3520 CCACCTTCTTGCTCTCTTTATTCTCAGTTTTGTATGGTTTCAGGAAGGCCTCTGAGGAGA

3579

3580 CCAGTTTGTCAAGATGGGTGGGTCCTGGAGGGGCACACGCCCTCTGTCCCCTTGTCACTC

3639

3460

3640

LJ46 AGAGGACACGTAGTTCAGGGTATTT1ACAGATGTG 3674

FIG. 2. Deletions in the noncoding region of the c-fos gene. (A) DNA sequence of the 3' noncoding region of the c-fos gene. The structure of the VMM'(A)5 construct is displayed (see the legend to Fig. 1) above the sequence, which is shown from the Sal I site downstream as far as has been determined. Numbering is the same as used by Van Beveren et al. (20) for the c-fos gene. The sequence displayed here extends 126 nucleotides farther downstream than in ref. 20; these additional data are based on sequencing of LJ46. Arrows indicate the location of deletions. The 67-nucleotide region (defined by the 5' borders of constructs LJ40 and LJ50) is boxed. The canonical poly(A) signal A-A-T-A-A-A is underlined, and the site of polyadenylylation is marked with a vertical arrow. The location of the poly(A) site is based on sequence analysis of two c-fos cDNA clones isolated in our laboratory (by J. Deschamps) from a library prepared from human placenta RNA.

4989

Table 1. Mutants with deletions in 3' noncoding region of the c-fos gene Deletion Deletion -size, Transmutant Position bp formation VMM'(A) - (12) Sal I (2800)-BamHI (-4210) 1410 + (12) VM(A), LJ61 -3700-BamHI 510 (4) LJ46 3674-BamHI 536 (5) LJ56 -3460-BamHI 750 (6) LJ54 -3460-BamHI 750 (6) LJ73 -3400-BamHI 810 (5) LJ50 3397-BamHI 813 - (10) LJ66 3355-BamHI 855 +1- (7) LJ71 3352-BamHI 858 +/- (9) 880 LJ40 3330-BamHI + (10) LJ402 -3000-BamHI 1210 + (4) LJ403 '3000-BamHI 1210 + (3) 3330-Mst II (3412) 83 LJ40A + (5) LJ50L 3397-BamHI 1513 (3) LJ66L 3355-BamHI 1555 +/- (3) + 1580 LJ40L 3330-BamHI (3) LJ100 Sal I-Bcl I (3278) 479 (4) LJ110 Pvu II (3112)-Bcl I 167 (4) Data for the mutants with deletions in the 3' noncoding region of the c-fos gene and their transforming capability as assayed by transfection on 208F cells. Negative transformation (-) is defined as giving an equal number of foci as does VMM'(A)". Positive (+) transformation implies at least 10-times higher numbers of foci. Two constructs were classified "intermediate" (+/-). The number of times each construct was tested in a focus assay is indicated in parentheses.

mutants with their physical structure revealed that deletion of the last 123 nucleotides upstream from the poly(A) site of the c-fos gene does not alter the phenotype. Mutant LJ50, in which sequences between this site (nucleotide 3395) and the BamHI site (nucleotide -4210) have been deleted, induced the same number of foci as did construct VMM'(A)0. In contrast, LJ40, where an additional upstream 67 nucleotides are deleted, induced foci with a frequency and phenotype indistinguishable from those induced by VM(A)0. LJ66 and LJ71 map within these 67 nucleotides and have an intermediate phenotype (see Fig. 2 and Table 1). Two further deletion mutants, LJ402 and LJ403 have more extensive deletions in the noncoding domain and have the same phenotype as observed with LJ40. To demonstrate that mere removal of a stretch of DNA containing the 67 nucleotides will induce transformation, we generated a deletion mutant LJ40A that is identical to the nontransforming VMM'(A)0 except that it has a deletion of 83 nucleotides encompassing the 67-nucleotide region. LJ40A has a similarly high transforming activity as that observed with LJ40 or VM(A)0, thus implicating the 67-nucleotide stretch as being directly involved in abolishing the transforming potential of VMM'(A)0. To rule out the possibility that the results obtained with deletion mutants are influenced by the precise nature of the poly(A) site, we generated constructs where the SV40 poly(A) site was replaced by a FBJ-MuSV LTR, which also contains a poly(A) addition signal (see Fig. 1C). Construct LJ5OL, like its parent LJ50, remained nontransforming, while the transforming abilities of LJ40 and LJ40L were indistinguishable. Similarily, the intermediate phenotype of LJ66 was not affected by substitution of the poly(A) site with the FBJ-MuSV LTR. Results obtained with these constructs containing LTR sequences confirmed the notion that 3' interacting sequences are independent of the nature of the

poly(A) signals.

4990

Proc. NatL Acad Sci. USA 82

Biochemistry: Meijlink et al

Two additional constructs were made to determine the position effect of the 3' interacting stretch of 67 nucleotides. Deletion mutants LJ100 and LJ110 were constructed from nontransforming plasmid VMM', which differs from VMM'(A)I, only in lacking the SV40 poly(A) signal sequences but retains the normal c-fos poly(A) signal (23). It has been shown that VMM' DNA is efficiently transcribed but is not translated (23). LJ100 had undergone a deletion between the Sal I site and the Bcl I site that brought the 67-nucleotide region 478 bp closer to the coding region. In construct LJ110, the 168 nucleotides between the Pvu II site and the Bcl I site had been deleted (Fig. 1). Both of these mutants showed the same low level of transformation as observed with the parental VMM' DNA. Thus, altering the position of the 67 nucleotides in this region is not sufficient to activate the transforming potential of the VMM' construct. We conclude from the results presented in Figs. 1 and 2 and Table 1 that the 67-nucleotide stretch contains the crucial region involved in the 3' interactions. Altering the COOH-Terminal Domain. The transforming potential of recombinant VMM' can be restored either by interrupting the 3' interacting sequences or by replacement of the COOH-terminal coding domain with that of the v-fos gene. Thus, a construct VVM, encoding the v-fos gene product but containing the 67-nucleotide stretch, is able to transform fibroblasts (23). We wished to identify the sequences in the COOH-terminal coding domain of the c-fos gene that may be involved in the 3' interaction. Fig. 3 shows the nucleotide sequence of the Nco I-Sal I region of the c-fos gene containing the 104 bp that had been deleted from the v-fos gene. Because of this deletion, the v-fos and c-fos proteins had different COOH termini. Deletion mutants LJ-CD6 and LJ-CD8 were generated by linearizing VMM' DNA with restriction endonuclease Sac I followed by limited BAL-31 nuclease digestion. The truncated plasmid DNAs were circularized by DNA ligase and cloned in Escherichia coli. Sequence analysis showed that LJ-CD6 mutant had undergone a deletion of 69 bp, while LJ-CD8 was shortened by 130 bp, resulting in predicted amino acid sequences that are different in the COOH termini as compared to VMM'. LJ-CD6 and LJ-CD8 synthesized proteins that were 20 and 26 amino acids, respectively, longer than the mouse c-fos protein. Both ofthese mutant proteins differed at their COOH termini from those of the c-fos and v-fos proteins. The predicted amino acid sequence of the LJ-CD6- and LJ-CD8encoded proteins differed from the c-fos protein starting from residue 362 and 358, respectively. It should be pointed out that both the v-fos protein encoded by FBJ-MuSV and afos protein encoded by a second fos-containing viral isolate, FBR-MuSV (25) [lacking the 98 COOH-terminal amino acids of the c-fos protein (26)], were capable of transformation of rat 208F fibroblasts, indicating that the COOH-terminus of the fos protein is dispensable for transforming activity. Whereas the difference between LJ-CD6 and LJ-CD8 in the coding domain is only 15 nucleotides, only LJ-CD8 induced transformation at a frequency significantly higher than the negative control (construct VMM'). Construct VVM, which is similar in its transforming efficiency to VM(A),, (23), was used as the positive control. The number of foci induced by LJ-CD8 was about 75% of the number obtained with VVM. The transforming potential of LJ-CD6 remained similar to that of VMM'. Thus, alteration in the c-fos gene affecting the COOH-terminal coding domain of the c-fos protein can influence its transforming ability. Lack of Intramolecular Complementarity. Since removal of either the 67-nucleotide region in the 3' noncoding domain or altering the COOH-terminal coding domain in some cases (for instance LJ-CD8) can activate the transforming potential of the c-fos gene, we scanned these sequences for homologies and complementarities. No significant homology or comple-

A

S0 0

(1985)

N

-

ProletValThrGluLeuGluProLeuCysThrProVaEvalThrCysTbrPro lyCys CCCATGGTCACAGAGCTGGAGCCCCTGTGTACTCCCGTGGTCACCTGTACTC GGCTGC T Men I NeCO L 2562

ThrThrTyrThrSerSerPheValPheThrTyrProGluAlasApserPheProSerCys

ACTACTTACACGTCTTCCTTTGTCTTCACCTACCC CTGGACTCCTTCCCAGCTGT LJ-CD8

2622

2621

LJ-CD6

AI&A 1^11aisArgLynGlySerrSerSerAsnGlu oSerSe rAspSerLeuSerSer

GCCGCTGCCCACCGAMGGGCAGCAGCAGCACGAG CTCCTCCGACTCCCTGAGCTCA

2681

Sac I

2682

2561

LJ-CD6

ProThrLeuLeuAlaLeu *

CCCACGCTGCTGGCCCTGTGAGCAGTCAGAGMGGCAGGCAGCCGGCATCCAGACGTGC

2741

LJ-CD8

2742

CACTGCCCGAGCTGGTGCATTACAGAGAGGAGACACGTCTTCCCTCGAAGGTTCCCG

SailI

2800

B Construct

Location of deletion Transformation

LJ-CD6

2645-2713 2627-2756

LJ-CDB

c

C

G~__ _

_ _

C A A

G

-

(4)

+ or +/- (4)

_

_

_ _

_ _

__ _

_ _ _

_ _

A A A

CG CG CG GC LJ-CD8 LT A C G G C1LJ-CD6 C A CG GC TA 2615 -AAGCTG GCWA- 2655

FIG. 3. Mutations in the COOH terminus of the c-fos protein. (A) The structure of the VMM'(A),, construct is displayed (see the legend to Fig. 1) as well as the DNA sequence between the Nco I site and the Sal I site, encoding the COOH terminus of the protein, as previously published and numbered (20). The location of the deletions of two deletion mutants is indicated by arrows. The deletion that occurs in the v-fos gene present in FBJ-MuSV is indicated by brackets. (B) Characteristics of the mutants as explained in the legend to Fig. 2. (C) Potential hairpin structure occuring between nucleotides 2621 and 2649. Negative transformation is here defined as giving equal numbers of foci obtained by VMM'. The positive control in these transfections was VVM. mentarity between these two sequences or with other sequences in the c-fos gene was uncovered using the appropriate computer programs (27). Sequence scanning of mutants LJ-CD6 and LJ-CD8 in the 3'-coding domain did reveal the possible destabilization of a hairpin structure in the transforming LJ-CD8 construct, whereas this hypothetical loop structure was not appreciably affected in the nontransforming LJ-CD6 (Fig. 3C). Such secondary structures have often been implicated in RNA-protein interactions.

DISCUSSION Protooncogene c-fos is unable to induce transformation of fibroblasts, but its viral cognate, v-fos, the resident oncogene of FBJ-MuSV, can transform fibroblasts efficiently in vitro and cause bone tumors in vivo. Products of the c-fos and v-fos genes differ at their COOH termini, but the altered forms of the proteins do not appear to account for the discrepancy in their transforming ability (23). Previous work from our laboratory had shown that recombinant constructs capable of

Biochemistry: Meijlink et aL synthesizing the c-fos protein were able to transform fibroblasts quite efficiently when an LTR was linked and the 3' interacting sequences in the 3' part of the gene were disrupted. Now we have defined the nucleotide sequences involved in this interaction. Removal of an A+T-rich 67-nucleotide stretch located 627-693 bp downstream from the coding domain is sufficient to convert the nontransforming c-fos gene to a transforming gene (Fig. 1B). It is possible that sequences involved in the interaction are fewer than 67 nucleotides, but we have not yet tested a mutant containing a subset of the 67-nucleotide stretch other than two deletion mutants (LJ66 and LJ71) with an intermediate phenotype. The c-fos gene also can be endowed with transforming potential if alterations are introduced in the COOH-terminal coding domain. Deletion mutant LJ-CD8, which has an altered COOH terminus from residue 358, transforms cells at a significantly higher frequency than does LJ-CD6, which contains a smaller deletion in the same region. In the case of the v-fos gene, two events transpired to convert it to a transforming gene: the COOH-terminal sequences were altered because of a 104-bp deletion, and the 67-nucleotide stretch of DNA in the noncoding domain was not acquired during the biogenesis of FBJ-MuSV. What is the mechanism by which the 3'-interactions exert their influence? As mentioned before, nucleotide sequence analysis did not reveal any structural homologies or complementarities to account for these observations. A clue for posttranscriptional regulation emerged from experiments performed with constructs VMM' and VMM'(A)n. Cells transfected by these DNAs transcribed RNA of the expected sizes, but no c-fos protein could be detected (23). Recently it has been observed that the expression of the c-fos gene at both the RNA and the protein level is rapidly induced upon stimulation of fibroblasts by several mitogens (6-8). Induction, however, is transient, and by 90-120 min, no c-fos protein can be detectable (7, 8). Similarly, when monocytic or myelomonocytic cell lines are treated with phorbol ester, the c-fos gene is rapidly expressed, with the highest levels accumulating in 30 min', followed by a decrease to 1/3 to 1/5, after which the level remains essentially unchanged for the next 105 hr (11). On the other hand, c-fos protein is only transiently expressed, and by 120 min, little or no c-fos protein is detectable even though c-fos mRNA is present (11). Neither platelet-derived growth factor-stimulated fibroblasts nor differentiating monocytic cells are transformed, yet they both synthesize c-fos protein, which has the potential to transform, at least fibroblasts. Explanation of this enigma might lie in the transient synthesis of the c-fos protein. It appears that induction of transformation requires sustained synthesis of the c-fos protein. Thus, the possibility exists that c-fos regulates its own synthesis, perhaps by interaction with the 67-nucleotide region. Regulation of expression of the protooncogenes is fundamental to the normal metabolic processes of the cell. Inadvertent expression of proto-oncogenes can cause transformation. Thus, it is not surprising that a cell would develop, in the course of evolution, mechanisms to regulate synthesis of potentially oncogenic proteins. In the case of proto-

Proc. NatL. Acad. Sci. USA 82 (1985)

4991

oncogene c-fos, a novel strategy involving posttranscriptional regulation appears to have been devised. We thank Dr. Chuck Van Beveren for his sustained interest and Liza Zokas for technical assistance. We are grateful to Drs. Tony Hunter and Bart Sefton for reading the manuscript. F.M. was the recipient of fellowships from the Netherlands Organization for Pure Scientific Research (ZWO) and the European Molecular Biology Organization (EMBO). This work was supported by grants from the National Institutes of Health and the American Cancer Society. 1. Bishop, J. M. (1983) Annu. Rev. Biochem. 52, 301-354. 2. Hunter, T. (1984) Sci. Am. 251 (2), 70-79. 3. Shilo, B. Z. & Weinberg, R. Z. (1981) Proc. Natl. Acad. Sci. USA 78, 6789-6792. 4. Kelly, K., Cochran, B. H., Stiles, C. D. & Leder, P. (1983) Cell 35, 603-610. 5. Armelin, H. A., Armelin, M. C. S., Kelly, K., Stewart, T., Leder, P., Cochran, B. H. & Stiles, D. (1984) Nature (London) 310, 655-660. 6. Greenberg, M. E. & Ziff, E. B. (1984) Nature (London) 311, 433-437. 7. Kruijer, W., Cooper, J. A., Hunter, T. & Verma, I. M. (1984) Nature (London) 312, 711-716. 8. Muller, R., Bravo, R., Burckhardt, J. & Curran, T. (1984) Nature (London) 312, 716-720. 9. Gonda, T. J. & Metcalf, D. (1984) Nature (London) 310, 249-251. 10. Muller, R, & Wagner, E. F. (1984) Nature (London) 31i, 438-442. 11. Mitchell, R., Zokas, L., Schreiber, R. D. & Verma, I. M.

(1985) Cell 40, 209-217. 12. Muller, R., Slamon, D. J., Tremblay, J. M., Cline, M. J. & Verma, I. M. (1982) Nature (London) 299, 640-644. 13. Muller, R. & Verma, I. M. (1984) in Current Topics in Microbiology and Immunology, eds. Vogt, P. K. & Koprowski, H. (Springer, New York), Vol. 112, pp. 73-116. 14. Slamon, D. J. & Cline, M. J. (1984) Proc. Natl. Acad. Sci. USA 81, 7141-7151. 15. Finkel, M. P., Biskis, B. 0. & Jinkins, P. B. (1966) Science 151, 698-701. 16. Curran, T. & Teich, N. M. (1982) Virology 116, 221-235. 17. Curran, T., Peters, G., Van Beveren, C., Teich, N. & Verma, I. M. (1982) J. Virol. 44, 674-682. 18. Muller, R., Verma, I. M. & Adamson, E. D. (1983) EMBO J. 2, 679-684. 19. Cochran, B. H., Zullo, J., Verma, I. M. & Stiles, C. D. (1984) Science 226, 1080-1082. 20. Van Beveren, C., Van Straaten, F., Curran, T., Muller, R. & Verma, I. M. (1983) Cell 32, 1241-1255. 21. Van Straaten, F., Muller, R., Curran, T., Van Beveren, C. & Verma, I. M. (1983) Proc. Natl. Acad. Sci. USA 80, 3183-3187. 22. Curran, T., Miller, A. D., Zokas, L. M. & Verma, I. M. (1984)

Cell 36, 259-268. 23. Miller, A. D., Curran, T. & Verma, I. M. (1984) Cell 36, 51-60. 24. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1983) Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). 25. Curran, T. & Verma, I. M. (1984) Virology 135, 218-228. 26. Van Beveren, C., Enami, S., Curran, T. & Verma, I. M. (1984) Virology 135, 229-243. 27. Devereux, J., Haeberli, P. & Smithies, 0. (1984) Nucleic Acids Res. 12, 387-395.