S3 Table. Exact test p-values. Raw p -values for exact tests of ... - PLOS

Recommend Documents

Fisher's exact test p-value < 0.0312 - PLOS

Repo. KEGG ALS. Other. Row total. DE. 9. 1585. 1594. Non-DE. 13. 6069. 6082. Column total. 22. 7654. 7676. Fisher's exact test p-value < 0.0312.

mol) raw p- values - PLOS

Protein classification. Protein stoichiometry. △G. (kcal/ mol) raw p- values. (PepSite2). Peptide binding ... B. Chaperone/. Protein binding. Hetero 3-mer - ABC.

p -values for Fisher's exact test for categorical variables and ... - PLOS

SupplementalTable 2: Characteristics of all subjects, by whether or not patients had obstructive sleep apnea (OSA), restricted to the years 2008-2014. non-OSA.

N. Panchy et al. 11 SI Table S1 Fisher's exact test p-values of GO ...

Oct 28, 2014 - Table S1 Fisher's exact test p-values of GO terms with over-represented numbers of C. reinhardtii cycling genes. GO Term adjusted p-value1.

Recursive computation for evaluating the exact $ p $-values of ...

Oct 31, 2015 - â Department of Biostatistics, Nagoya University Graduate School of Medicine, ... For each district i â V , we suppose that the number Xi for event we are focusing on (e.g., ...... The data are taken over 24 months from July 1975 to

Exact p-values for pairwise comparison of Friedman

Keywords: Friedman test, Exact p-value, Rank sum difference, Multiple comparison, ... the Creative Commons license, and indicate if changes were made. ... [27] used symbolic computation for finding the distribu- ... calculating probabilities using an

IBM SPSS Exact Tests

Pearson Chi-Square Test for a 3 x 4 Table 14 ... 3 One-Sample Goodness-of-Fit Inference 39 ...... In order to test this claim, she was given eight cups of tea.

S3 Table. Summary of p values obtained from statistical tests of ... - Plos

Summary of p values obtained from statistical tests of significance carried out for mean QUS, texture, and molecular features estimated from two response ...

Permutation P-values Should Never Be Zero: Calculating Exact P ...

Keywords: permutation test, Monte Carlo test, p-values, multiple testing, ... tion of a test statistic is estimated by randomly permuting the class labels of the ... mon practice to use estimators of p-values in place of genuine probabilities. ....

Supporting Table S3: p-values of neutrality tests in the ... - Plos

28.2. 41.1. 0.20. 0.02. < 0.01. 2.84. 33.02. 6.14 u strong. Model 3. 0.14. 0.07. < 0.01 .... 0.04. 0.12. 0.01. 5.1. 50. 46.6. 0.2. 0.05. < 0.01. 4.9. 27.3. 37.9. 0.14. 0.02.

S6 Table. Fisher's Exact Test Full Model for ...

S6 Table. Fisher's Exact Test Full Model for comparing shedding vs. non-shedding by âage classâ of Rock Pigeon sampled in Atlanta, GA. Two-sided probability ...

Exact conditional tests for cross-classifications ... - Statistics

In this table, we compare the Good and the Gail-Mantel approximations to I sI for Tables 1, 3, and 4 of this paper, and for the largest sample sizes for which.

Computing Exact P-values in Incomplete Multi-way

Jan 16, 2009 - the null distributions of test statistics of interest is questionable or ... In this paper I focus on the very general case of sampling from sets of multi-way tables that .... at least as extreme as the observed table n: ... than the o

S3 Table. Raw data for global gene expression and ... - PLOS

S3 Table. Raw data for global gene expression and expression of genes related to metabolism in the spinosad-resistant 791spin strain compared to the ...

Figure S6 Characterization of p-values of Fisher's exact test (A, C ...

Figure S6 Characterization of p-values of Fisher's exact test. (A, C) Histogram of p-value calculated using Fisher's exact test at generation 22 (A) and 49 (C).

Supplemental Table 1. P-values for permutation test for ... - Nature

P-values for permutation test for homogeneity of multivariate dispersions. Differences in the compositional variance as calculated through the betadisper function ...

IBM SPSS Exact Tests - University of Sussex

Cytel Software Corporation and Harvard School of Public Health. Cambridge ..... Analytic answers to question (3) are usually very difficult, and it is more common ...

IBM SPSS Exact Tests - University of Sussex

These algorithms have now been implemented in Exact Tests. ..... If you want to duplicate your results, you should set the random number seed every time.

Table S3A Exact Mature Grouped on Mature Exact/grouped on ... - PLOS

14796.14. 93.04. 0.35. TTTGGTCCCCTTCAACCAGCTG mir-133a. 5269.27. 206.87. 107335.09. 11328.46. 5.05. 0.66. TGAGATGAAGCACTGTAGCTCA mir-143.

S3 Table. Parameter values for scenarios S15 to S18. - PLOS

0.29. 0.12. 0.10. 0.13. 0.36. 2.14. 2.82. 0.34. 0.30. 1.00. 2.14 seed. F. A2. B. 0.30. 0.13. 0.12. 0.13. 0.32. 2.06. 2.74. 0.37. 0.35. 1.00. 2.06 seed. F. A3. A. 0.33.

New tight approximations for Fisher's exact test

May 6, 2014 - Abstract. Fisher's exact test is often a preferred method to estimate the significance of statistical dependence. However, in large data sets the ...

Table S3. Lipophilic ligand efficiency (LLE) values for all ... - PLOS

1. NEU-961. 6.4. 1.6. -0.63. 0.079. 0.67. 0.73. -0.29. 2. NEU-1021. 2.7. 3.1. 2.8. 2.5. 2.9. > 50. < 1.6. 3. NEU-1022. 2.7. 19. 2.0. 0.62. 3.5. 9.7. 2.3. 4. NEU-1027.

S3 Table: p-values and R2 from Linear Regression of

Chl a. 0.5. 0.0035. 0.009. 0.0434. S3 Table: Summary of p- and R2 values for temperature and nutrient parameters vs. NMDS1 and NMDS 2. Significant p-values ...

Chi-squared test and Fisher's exact test

The chi-squared test performs an independency test under following null and alternative hypotheses, H0 and H1, respectively. H0: Independent (no association).

S3 Table. Exact test p-values. Raw p -values for exact tests of ... - PLOS

Download PDF

2 downloads 0 Views 567KB Size Report

Comment

Ancient Spokane. 0.09 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.21 0.03 0.00 0.01 0.00 0.48 0.08 0.00 0.00 0.01 0.00 0.00. Ancient. 0.09. 0.00 0.00 0.00 0.00 0.00 ...

S3 Table. Exact test p -values. Raw p -values for exact tests of population differentiation. Priest Rapids Hatchery is not included in the "Contemporary" group for the Columbia River as it is not a Grand Coulee Fish Maintenance (GCFMP) redirection sub-population.

*Data from Martin et al. [42]

0.00 0.00 0.09 0.14 0.03 0.01 0.15 0.03 0.00 0.00 0.00 0.61 0.01 0.03 0.28 0.00 0.13 0.24 0.13 0.05

0.00 0.00 0.37 1.00 0.04 0.04 0.47 0.00 0.70 0.60 0.80 0.36

0.21 0.32 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.19 0.00 0.03 0.01 1.00 0.26 0.00 0.00 0.04 0.00 0.00

0.03 0.05 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.19 0.00 0.12 0.11 0.61 0.66 0.00 0.05 0.20 0.00 0.02

0.00 0.00 0.00 0.00 0.08 0.00 0.08 0.00 0.37 0.00 0.00 0.79 0.50 0.32 0.90 0.00 0.83 0.93 0.56 0.61

0.01 0.04 1.00 0.81 1.00 0.32 1.00 0.61 1.00 0.03 0.12 0.79 0.68 0.04 0.44 0.00 1.00 1.00 0.00 1.00

0.09 1.00 0.00 0.61 1.00 0.05 0.80

0.57 0.03 0.04 0.14 0.00 0.04

0.08 0.19 0.10 0.28 0.30 0.16 0.35 0.28 0.47 0.26 0.66 0.90 0.44 1.00 0.57 0.00 1.00 1.00 0.28 0.65

0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.03 0.00

0.01 0.03 0.15 0.38 0.34 0.11 0.48 0.24 0.60 0.04 0.20 0.93 1.00 1.00 0.14 1.00 0.00 1.00

0.00 0.00 0.71 0.67 0.69 0.06 1.00 0.13 0.80 0.00 0.00 0.56 0.00 0.05 0.00 0.28 0.00 0.44 0.36

0.00 0.00 1.00 0.00 0.44 0.36 0.00 1.00 1.00 0.23

Upper Salmon

0.00 0.00 0.15 0.45 0.28 0.06 0.60 0.13 0.70 0.00 0.05 0.83 1.00 0.61 0.04 1.00 0.00

Tucannon

0.48 0.88 0.01 0.08 0.01 0.07 0.01 0.03 0.04 1.00 0.61 0.32 0.04 0.09

Lyons Ferry H.*

0.00 0.00 0.00 0.01 0.01 0.00 0.03 0.01 0.04 0.01 0.11 0.50 0.68

Lemhi

Chamberlain

Contemporary

Ancient

Priest Rapids H.* (non-GCFMP)

Wenatchee 0.00 0.00 0.16 0.29 0.40 0.02 0.76 0.03

SF Salmon R.

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.52 0.92 0.16 0.83 0.90 0.56 0.75 0.90 0.14 0.77 0.56 0.14 0.02 0.75 0.77 0.02 0.14 0.03 0.01 0.15 0.29 0.40 0.02 0.76 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.08 0.00 0.08 0.81 1.00 0.32 1.00 0.01 0.01 0.00 0.03 0.08 0.01 0.07 0.01 0.28 0.30 0.16 0.35 0.00 0.00 0.00 0.00 0.45 0.28 0.06 0.60 0.38 0.34 0.11 0.48 0.67 0.69 0.06 1.00 0.11 0.13 0.01 0.36

Methow

Icicle

Entiat

Carson and Leavenworth H.

Contemporary & Priest Rapids H.*

Contemporary

Ancient

0.09 0.00 0.00 0.00 0.00 0.52 0.00 0.92 0.00 0.16 0.00 0.83 0.00 0.09 0.00 0.16 0.32 0.00 0.05 0.00 0.00 0.00 0.04 1.00 0.00 0.00 0.88 0.01 0.19 0.10 0.01 0.00 0.00 0.15 0.03 0.15 0.00 0.71 0.00 0.03

Imnaha River

0.09 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.21 0.03 0.00 0.01 0.00 0.48 0.08 0.00 0.00 0.01 0.00 0.00

Grande Ronde

Ancient Spokane Ancient Contemporary Contemp. & Priest Rapids H.* Carson and Leavenworth H. Entiat Icicle Methow Wenatchee Priest Rapids H.* (non-GCFMP) Ancient Contemporary Chamberlain Grande Ronde Imnaha River Lemhi Lyons Ferry H.* MF Salmon R. SF Salmon R. Tucannon Upper Salmon

Snake

MF Salmon R.

Snake

Columbia

Ancient Spokane

Columbia

0.00 0.00 0.03 0.11 0.13 0.01 0.36 0.05 0.36 0.00 0.02 0.61 1.00 0.80 0.04 0.65 0.00 1.00 1.00 0.23