A postdoctoral fellow of the Parker B. Francis Foundation. 0 Supported by the Leukemia Society of America. 7% whom all correspondence should be addressed: ...
Vol. 269,No. 20,Issue of May 20, pp. 14631-14635,
THE JOWAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc
1994
Printed in U.S.A.
Structural Featuresof the GTP-binding Defective Rab5 Mutants Required for Their Inhibitory Activity on Endocytosis* (Received for publication, December 30, 1993,and in revised form, February 28, 1994) Guangpu Lis, M. Alejandro Barbieri, Maria I. ColomboO, and PhilipD. Stahln From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
Rab proteins are ubiquitous, some, including Rab3A (71, Rab3D (8), Rabl5 (9), Rabl7 (lo), and Rab25 (ll),are found only in certain tissues, suggesting that theyinvolved are in specialized membrane-traffickingevents.Thefunctional association of Rab proteins with intracellular membrane trafficking was first demonstrated in yeast (12) and more recently in higher eukaryotes (1).Rab5 in particularhas been shown to play a role in the regulation of endocytosis (13, 14). Overexpression of GTP-binding defective RabS mutants in cultured BHK-21 cells blocks both receptor-mediated and fluidphase endocytosis (13,141. In addition, Rab5-specific antiserum and RabS mutants specifically inhibit endosome fusion in vitro (Ref. 15and this report). These data strongly indicate that Rab5 regulates endocytosis at the level of endosome fusion, although the mechanismby which Rab5 exertsits function remains tobe established. Like other GTPases,it is believed that Rab5cycles between GTP-boundand GDP-bound states. Theconversion between these two states is regulatedby factors including GAP,’ GEF, and GDI. GDI was discovered first as a 54-kDa protein that inhibits GDP dissociation from Rab3A (also called smg p25A) (16). Recently, it has been reported that this GDI also acts on other Rab proteins including (17). Rab5GAP and GEF stimulate GTPase activity and GDP release, respectively. These activities have been detected for Rab3A (181,Yptl(19,20),Ypt6 (211, and Sec4 (20). In additiont o these regulatorsof the GTPhydrolysis cycle, it is suggested that an effector molecule interacts with the GTP-bound form of Rab to promote vesicle docking and/or the membrane fusion event. To this end, Shiratakiet al. (22) have identified an 85-kDa protein that specifically interacts with the GTP-bound form of Rab3A and servesas a potential candidate for the effector molecule of Rab3A. The Rab5-specific regulators and effector(s) are largely unknown. To facilitate the understanding of Rab5 function, we have generated a number of Rab5 mutants, some of which show altered biological activity (14). Thetwo GTP-binding defective The Rab family of Ras-related small GTPases regulates inmutants (Rab5S34N andRab5:N1331) are of particular intertracellular membrane trafficking (for a recent review, see Ref. est because they dominantly inhibit endocytosis. This inhibi1). These proteins arespecifically localized to the cytoplasmic tion may resultfrom competition for factors essentialfor Rab5 surface of each intracellular compartment, such as endoplasfunction. Therefore, the mutants are valuable tools for dissec3), cis-Golgi (Rabl and mic reticulum (Rabl and Rab2) (2, tion of protein-protein interactions between Rab5 andits reguRab2) (2, 31, medial-Golgi (Rab6) (4), trans-Golgi (Rab9) ( 5 ) , latory factors. In this report, we have initiated a study of the early endosome (Rab4 and Rab5) (2, 6), late endosome (Rab7 structural features that are requiredfor the inhibitory activiand Rab9) (2,5), and plasma membrane (Rab5) (2). While most ties of these two mutants and shed light on the interactions between RabS and Rab5-specific factors. * This work was supported in part by Grant (311142259-19from the National Institutes of Health (toP. D. S).The costs of publication ofthis EXPERIMENTAL PROCEDURES article were defrayed in part by the payment of page charges. This article must thereforebe hereby marked “aduertisenent”in accordance Mutagenesis-The substitution mutations (I53A, F57S, and R81A) with 18 U.S.C. Section 1734 solely to indicate this fact. were created by oligonucleotide-directed mutagenesis using the Bio$ A postdoctoral fellow of the Parker B. Francis Foundation. 0 Supported by the Leukemia Society of America. 7 % whom all correspondence should be addressed: Dept. of Cell The abbreviations used are: GAP, GTPase-activatingprotein; Biology & Physiology, Washington University School of Medicine, 660 a-MEM, Eagle’s minimal essential medium containing Earle’s salts; South Euclid, St. Louis, MO 63110. Tel.: 314-362-6950; Fax: 314-362- PBS, phosphate-buffered saline; GEF, guanine nucleotideexchange fac7463. tor; GDI, guanine nucleotide dissociation inhibitor. Rab5 is a Ras-like small GTPase that regulates early events of endocytosis. Previous work indicates that two GTP-binding defective Rab5 mutants (Rab5:S34N and RabS:N1331) are dominant inhibitors of endocytosis. In this report, we have initiated experiments to address the structural featuresnecessary for the inhibitory activity of these two Rab5mutants. Second-site mutations were introduced into Rab5:S34N and Rab5:N1331, respectively, and the resulting double mutants were expressed in culturedBHK-21 cells viaa Sindbis virus expression vector.Endocytic activity of the cellswas monitored by following the uptake of a fluid-phase endocytic marker (horseradish peroxidase). The effects of the Rab5 mutants on endosome fusion in vitro were also examined. Truncation of the C-terminal isoprenylation motif CCSN abolished the inhibitory activity of both Rab5:S34N and Rab5:N1331. The same held true when the secondary mutation was a substitution mutation (F57S) in theeffector domain. Another substitution mutation in this region (I53A) had no effect onthe inhibitory activity of either Rab5:S34N or Rab5:NlSBI. The final mutation (R81A) was created immediately downstream of the second GTP binding motif (WDTAGQER), i.e. in theloop 4 region based on the structuralmodel of Ras. This mutation greatly decreased the isoprenylation of RabZN133I and itsinhibitory activity on endocytosis. It is believed that Rab5 function requires protein-protein interactions with Rab5-specific regulators and effectors. Someof these interactions are disrupted by Rab5:S34N and Rab5:N1331.By analogy to Ras, both Rab5:S34N and Rab5:N133I are likely to sequester a Rab5-specific guanine nucleotide exchange factor. This interaction requires the effector domain Phe“ residue and C-terminal isoprenylation of Rab5.
14631
14632
Inhibition of Endocytosis by Rab5 Mutants
Rad phagemidmutagenesis system that was basedon Kunkel's method (23). The cDNA sequences of Rab5:S34N and Rab5:N133I were subcloned into the unique XbaI restriction site of the pGC2 plasmid (24) as previously described (14). Because of the presence of a bacteriophage M13 replication origin, pGC2 could be used to produce single-stranded DNA in the presence of the helper phage M13K07. Single-stranded DNAs were prepared frompGC2-Rab5:S34N and pGC2-Rab5:N1331 and used as templates for mutagenesis. Three mutagenic oligonucleotides were chemically synthesized including 5'-CAAGAGAGTACCgTGGGGCTGCT-3', 5'-GGGGCTGCTTcTCTAACCCAAAC-3',and 5'GCTGGTCAAGAAgATACCATAGC-3'. They were responsible for the substitution mutations I53A (alanine forisoleucine at residue 53), F57S, and R81A, respectively. Deletion of the C-terminal tetrapeptide isoprenylation motif (AC4 mutant) was generated using a polymerase chain reaction-based strategy. The DNA template was either pGC2-Rab5S34N or pGC2RabkN133I. The 5' primer was 5"GCTCTAGAATGGCTAGTCGAGGC3', which contained an XbaI linker followed by a sequence corresponding to the 5' cDNA sequence of Rab5. The 3' primer was 5'-GCTCTAGATCACTGATTCCTGG'I"l'GGTl'G-3',which contained an XbaI linker followedby a sequence complementary to the cDNA sequence upstream of the four 3"terminal codons of Rab5. The AC4 mutant cDNAs were amplifiedby 25 cyclesof polymerase chain reaction in the presence of the DNA template and oligonucleotide primers described above. The entire cDNA sequence of the Rab5 mutants was determined by DNA sequencing (25), and all of the mutations were verified. Preparation of Recombinant Sindbis Viruses Capable of Expressing the Rab5 Mutants-The cDNAs of the Rab5 mutants were isolated after XbaI (Life Technologies, Inc.) digestion of either the pGC2-Rab5 plasmids (for the I53A, F57S, and R81A mutants) or the polymerase chain reaction-amplified AC4 mutant cDNAs. These RabB mutant cDNAs were then inserted into the unique XbaI restriction site of the Sindbis virus expression vector pToto1000:3'25 (14, 261, which was previously linearized by XbaI digestion and treated with calf intestinal alkaline phosphatase. Generation of Sindbis virus stock from the vector plasmid pToto1000:3'2J was previously described (14, 26). Briefly, the plasmid was linearized by XhoI (Life Technologies,Inc.) digestion and used as a template to producethe genome-lengthrecombinant Sindbis virus RNA by in vitro transcription using SP6 RNA polymerase (Life Technologies, Inc.). This viral RNA was infectious and could initiate a complete cycle of virus replication upon transfection of appropriate host cells. In our case, the in vitro transcripts were used to transfect confluent BHK-21 cell monolayers by the Lipofectin-mediated transfection method (27). The cells weremaintained in a-MEM containing 3% fetal calf serum (3 mV35-mm dish) in a 37 "C cell culture incubator. At 40 h post-transfection, the medium containing the released viruses was harvested and titered on fresh BHK-21 cell monolayers. The virus titer was usually between lo8 and lo9 plaque-forming unitdml. The virus stocks were frozen at -70 "C before use. Examination of Protein Expression (Rab5 and Rab5 Mutants) in BHK-21 Cells-BHK-21cell monolayers in 35-mm dishes (-5 x lo5 cells/dish) were infected with either the vector virus as a negative control or the recombinant viruses capable of expressing Rab5 and its mutant derivatives. High multiplicity of infection (50 plaque-forming unitdcell) was employed to ensure that all of the cells were infected. Virus adsorption was carried out a t 4 "C for 1 h in 200 pl of PBS containing 1%fetal calf serum. The infection mixture was then replaced by 3 ml of a-MEM containing 3% fetal calf serum, and the infected cells were incubated a t 37 "C for2 h. To examine protein synthesis, cells were metabolically labeledwith [36S]methioninefor 3 h(from 2 to 5 hpostinfection) in 1 mlof methionine-free a-MEM containing 3% fetal calf serum and 50 pCi/ml [35S]methionine(ICN Trar~~~S-label). After labeling, cells in each dish were rinsed once with 1 ml of PBS and lysed in 200 pl of 1%SDS. 50 p1of each cell lysate were used for immunoprecipitation (28) with Rab5-specificrabbit antiserum. The proteins in the immunocomplexes were analyzed by SDS-polyacrylamide gel electrophoresis, followed by fluorography and autoradiography. Horseradish PeroxidaseUptake in BHK-21 Cells-BHK-21 cell monolayers in 35-mm dishes were infectedwith either the vector virus or the recombinant viruses as described above.At 5 hpostinfection, cell monolayerswerewashed three times with serum-free a-MEM, and horseradish peroxidase uptake was initiated by adding 1ml of a-MEM containing 5 mg/ml horseradish peroxidase (Sigma) and 1%bovine serum albumin. The uptake was carried out at 37 "C for 1 h. After the uptake, cells were washed three times with PBS containing 1%bovine serum albumin and then scraped into 1 ml of PBS using a rubber
policeman. The dishes were rinsed once with 1ml of PBS, and the cell suspensions were pooled. Cells werecentrifuged at 800 x g for 3 min in a Beckman GPR centrifuge. Cell pellets were washed onceby resuspension in 2ml of PBS and recentrifugation. The cell pellet was lysed in 500 1.1 of PBS containing 0.1% Triton X-100. The cell lysate was assayed for horseradish peroxidase activity as previously described (14). Expression of Recombinant Rab5 Proteins in Escherichia coli-The polymerase chain reaction-amplifiedcDNAs of Rab5 and Rab5 mutants were subcloned into the bacteria expression vectorpGEX-3X (Pharmacia LKBBiotechnology Inc.). RecombinantRab5 proteins wereexpressed in large quantity as glutathione S-transferase fusion proteins in the E. coli strain JM101. The fusion proteins were affinity purified by glutathione-Sepharose resin (29) and used in the following in vitro endosome fusionand isoprenylation assays. In Vitro Endosome Fusion Assay-Early endosomes loaded with either dinitrophenol-derivatized P-glucuronidase or mannosylated antidinitrophenol IgG wereprepared from the 5774-E clone (a murine macrophagecell line) as previouslydescribed (30). The two sets of endosomes were mixedin the presence of an ATP regeneration system, Sephadex G-25 filtered cytosol, and recombinant Rab5 proteins wherever indicated. Endosome fusionwas evidenced by the P-glucuronidase activity in the immunocomplexes(30). In Vitro Isoprenylation Assay-Cytosols could be used as a source of Rab prenyltransferase to prenylate Rab proteins in vitro (5). 3 pg of recombinant Rab5 proteins were prenylated in a 10-plreaction mixture containing 5774-E cytosol(3.2 mg/ml), 0.5 p~ [l-3Hlgeranylgeranylpyrophosphate (33,000 dpdpmol, American Radiolabeled Chemicals,St. Louis, MO),an ATP regeneration system (1mM ATP, 8 mM phosphocreatine, 31 unitdml creatine phosphokinase), and the reaction buffer (20 r m HEPESXOH, pH 7.2,0.5 mM EGTA, 50 mM KCl, 5 m~ MgCl,, 1mM dithiothreitol, 250 mM sucrose, 0.2 mM GDP). The reaction was conducted at 37 "C for either 1or 4 h. The reaction was stopped by dilution (1:2) with the reaction buffer followed by affinity purification of the prenylated recombinant Rab proteins using the glutathione-Sepharose resin as described above. RESULTSANDDISCUSSION
The Ras superfamily of small GTPases contains five subfamilies including Ras,Rho, Ran, A r f , and Rab(reviewed in Refs. 31 and 32). Among this group of more than 50 proteins, Rasis the best characterized in terms of its structure-function relationship. A large number of defined mutations in Ras have been extensively studied, and theirbiochemical properties andfunctional consequences are known. For example, the mutations in the four GTP/GDP binding motifs result in altered guanine nucleotidebinding, GTP hydrolysis, and biological function. Because the GTP/GDP binding motifs are highlyconserved among all the Ras-related small GTPases, the corresponding expected tohave similar mutations in other small GTPases are effects. This contention has proven true in many cases. Rab5 is no exception. Like the corresponding mutations in Ras, the S34N and N133I mutations completelyabolished theGTP binding ability of Rab5 (14, 15). Furthermore, these two RabB mutants showed dominant inhibitory effect on both receptormediated and fluid-phase endocytosis when expressed in cultured BHK-21 cells (13, 14).This inhibition was demonstrated to be at the level of endosome fusion (Ref. 15 and this report). Of the two Rab5 mutants, it was consistently observed that the Rab5:S34N mutant was a more potent inhibitor both in vivo (14) and in vitro (see below). The dominant inhibitory effect shown by the two Rab5 mutants may be explained if the mutants sequester certain factors requiredfor endogenous RabB function. In order to investigate these putative protein-protein interactions, we introduced second-site mutationsinthe Rab5:S34N and Rab5:N133I mutants and examined whether these secondary mutations could reverse their inhibitory effects on endocytosis and endosome fusion. Four secondary mutations were generated including I53A, F57S, R81A, and AC4. These four mutations werechosen based on previous mutational analyses of Rab5 (14) and other Rab proteins (19, 33). The AC4 mutant had the C-terminalisoprenylation motif (CCSN) deleted.As a result, this mutant was not
14633
Inhibition of Endocytosis by Rub5 Mutants
27.5
-
18.5
-
=D~="~---1
2
3
4
5
6
7
8
9
1
0
1
1
1
2
FIG.1. Expression of Rab5 and Rab5 mutants inBHK-21 cells. Shown is an autoradiogram of a 12% gel containing Rab5 and Rab5 mutant proteins metabolically labeled with["Slmethionine in BHK-21 cells. Lane I , a sample from vector virus-infected cells a s a negative control; lane 2, wild-type ( W T ) Rab5; lane 3, the Rab5:S34N mutant; lane 4,the double mutant containing S34N,I53A mutations; lane 5,the double mutant containing S34N,F57S mutations; lane 6, the double mutant containing S34N,R81A mutations; lane 7,the double mutant containing S34N,hC4 mutations;lane 8,the Rab5:N133I mutant; lane 9,the double mutant containing N133IJ53A mutations; lane 10, the double mutant containing N133I,F57S mutations; lane 11, the double mutant containing N133I,R81A mutations; lane 12,the double mutant containing N1331,6C4 mutations. Molecular mass standards (in kilodaltons) are indicated on the left. The results were reproducible in independent experiments.
0
S(X1
IIXX)
1500
HRP uptake (OD490/mg protein)
FIG.2. Horseradishperoxidaseuptakein BHK-21 cells expressing the Rab5 mutants. Shown is a bar graph indicating a 1-h horseradish peroxidase ( H R P ) accumulation in BHK-21 cells infected with either the vector virus a s a control or the recombinant viruses expressing the Rab5 mutants (indicated). Each infection was done in triplicate, and the calculated standard deviation is shown. These results were reproducible in independent experiments.
mutants were expressedin culturedBHK-21 cells via a Sindbis virus vector. Endocytic activity of the cells was examined by prenylated, unable to bind to membranes, and biologically in- following the uptake of a fluid-phase endocytic marker (horseactive. The Ar$' residue is immediately downstream of the radish peroxidase). In comparison with the control cells insecond GTP/GDP binding motif (WDTAGQER) and is in the fected with the vector virus, cells that were infected with the loop 4 region according t o the structuralmodel of Ras (34). The recombinant viruses expressing either Rab5:S34N or R81A substitution mutation hadno effect on GTP binding, but Rab5:N133I showed decreased horseradish peroxidase uptake it reduced Rab5 activity, suggesting a weakened interaction (Fig. 2).This inhibitory activity of Rab5:S34N and Rab5:N133I with certain Rab5-specific factor(s). The I53A and F57S muta- was reversed either by deletion of the C-terminal isoprenylations were both in the putative effector domain, i.e. the L242 tion motif (AC4) or by a substitution mutation in the effector region based on the structuralmodel of Ras. Mutations at the domain (F57S) (Fig. 2). Another effector domain mutation corresponding positions in Rab3A greatly decreased its inter- (I53A) had no effect (Fig. 2). For the R81A mutation, while it action with Rab3A-specific GAP or GEF (33). only slightly reduced the inhibitory activity of Rab5:S34N, it The aforementioned mutations wereintroduced intothe essentially abolished that of RabkN1331 (Fig. 2). These results indicated that C-terminal isoprenylation is esRab5:S34N and Rab5:N133I mutants.The double mutants were expressed in cultured BHK-21 cells via a Sindbis virus sential for Rab5:S34N and Rab5:N133I to inhibit horseradish vector, and the protein expression was analyzed by SDS-poly- peroxidase uptake in BHK-21 cells. We further demonstrated acrylamide gel electrophoresis. As shown in Fig. 1, the Rab5 the importanceof C-terminal isoprenylation for the inhibitory mutants were expressed to the same levels. At 5 h postinfec- effect of Rab5:S34N and Rab5:N133I on endosome fusion in tion, thelevel of Rab5 expression was about 10-fold over endo- vitro. Recombinant Rab5 and Rab5 mutants were produced as genous Rab5 as quantified by Western blot (data not shown). glutathione S-transferasefusion proteins in E. coli and affinity Because of post-translational isoprenylation and possibly other purified using glutathione-Sepharose resin. The recombinant unidentified modifications, Rab5 was resolved as a doublet by proteins were isoprenylatedby incubation with thecytosol preSDS-polyacrylamide gel electrophoresis (Fig. 1).It was previ- pared from the macrophage cell line 5774-E. Under these conously shown that the faster mobility form was the isoprenyl- ditions, recombinant Rab5and Rab5:S34N were efficiently preated mature form associated with membranes (35). Therefore, nylated, while the prenylation of Rab5:N133I was much less the relative abundanceof this form was indicative of how well efficient (Fig. 3) (36). No prenylation was observed for the the protein was post-translationallyprocessed. By this criteria, Rab5AC4 mutantthat lacked the C-terminal tetrapeptide it was apparent that the N133I but not the S34N mutation CCSN (Fig. 3). Upon addition to the in vitro endosome fusion resultedin decreased post-translational processing(Fig. 1, assay, the prenylated Rab5:S34N and Rab5:N133I effectively while their nonprenylated lanes 3 and 8),consistent with the finding that the RabkN1331 blocked endosome fusion (Fig. a), mutant wasa poor substrate for i n vitro isoprenylation (36).As counterparts were poor inhibitors (Fig. 4B), demonstrating expected, the AC4 mutation completely abolished the post- that C-terminalisoprenylation is necessary for Rab5:S34N and translational processing of the two mutants that were seen as Rab5:N133I to inhibitendosome fusion. Since Rab5:N133I was a poor substrate for isoprenylation both i n vivo (Fig. 1)and in asingle cytosolic form (Fig. 1, lanes 7 and 12). The faster mobility of the AC4 mutants was due to deletion of the C- vitro (36) (Fig. 3), thiscould partly explain the observation that terminal tetrapeptide rather than post-translational isoprenyl- Rab5:N133I was a less potent inhibitor than Rab5:S34N. Along ation. Interestingly, the R81A mutation also significantly de- this line, theR81A mutation reversed the inhibitory activity of creased the post-translationalprocessing of the mutants,espe- Rab5:N133I (Fig. 2) because this mutationnearly abolished its cially the RabkN1331 mutant (Fig. 1, lanes 6 and 11). The I53A post-translational isoprenylation (Fig. 1).It should be pointed and F57S mutations affected these events toa smaller degree. out, however, that the C terminus-truncated Rab5:S34N and inhibitory activity(Fig. 2), In addition, i t was noted that the F57S mutation resulted in Rab5:N133I mutants retain residual mobility shift of the proteins (Fig. 1, lanes 5 and 10).This indicating that thenonprenylated mutants can still sequester the putative factor (but very inefficiently). phenomenon was probably due to alterations in charges and Rab5:S34N and RabkN1331may block endocytosis and enSDS binding. We next examined the functional significance of these sec- dosome fusion by competing for a Rab5-specific GEF. While this ondary mutations on Rab5:S34N and Rab5:N133I. The Rab5 factor is yet tobe identified, several lines of evidence support
14634
Inhibition of Endocytosis by Rub5 Mutants 1 hour 4 hours
Although some guanine nucleotide exchange factorshave been found in cytosol, the efficiency of interaction with respective WT -.I small GTPases can be greatly improved upon activation and AC4 localization to the target membranes (43), presumably by increasing the local concentration. S34N Two possibilities may account for the observation that the N133I 0 Phes7residue in the effector domain is crucial for the inhibitory FIG.3. In vitro isoprenylation of recombinant Rab5 and RabS activity of Rab5:S34N and RabkN133I. ThePhes7residue may mutants. 3 pg of affinity-purified recombinant Rab5 proteins were prenylated by incubation with 5774-E cytosol (3.2 mg/ml) as described be directly involved in the interaction with a Rab5-specific GEF. Alternatively, the F57S mutation might causechanges in under “Experimental Procedures.” The incubation was conducted at 37 “C for either 1 or 4 h (indicated) in the presence of [3H]geranylgera- other regions of the molecule that in turn contribute to the nyl pyrophosphate. The 3H-labeled(prenylated) proteins were analyzed disruption of protein-protein interactions between the RabS by SDS-polyacrylamide gelelectrophoresis and visualized by fluorogra- mutants and the GEF. While this latter possibility cannot be phy and autoradiography. The results were reproduciblein independent ruled out, it seems less likely for the following reasons. Based experiments. WT, wild type. on the structuralmodel of Ras, single substitution mutations in this region cause only limited local changes rather than alter A the overall conformation of the molecule (34). Furthermore, the F57S mutation has littleeffect on GTP binding, and thecorresponding Rab3A mutant responds to Rab3A-GAP normally (331, indicating no dramatic changes inprotein conformation. An unexpected findingof our study is that I53A the mutation S34N in theeffector domain has littleeffect on the inhibitory activity of Rab5:S34N and Rab5:N133I. Taken together with our preN133I vious observation that thebiological activity of RabS is not sig100 0 20 40 60 80 nificantly altered by the double mutation T52I,A53L (141, these Fusion (Fluoreseenee Units) data indicate that Ile53is not a critical residue for Rab5 function. These results are intriguing since the isoleucine residue is B highly conserved among Ras-related smallGTPases and is essential for the biological function of Ras andsome Rab proteins. In the caseof Ras, this isoleucine residue is so restricted that even isoleucine analogs cannot functionally replaceit (44). This AC4 residue is essential for Ras torespond to Ras-GAP (44,451 and for its biological function (46,47). In thecase of some Rab proS34N teins (e.g. Yptl andRab3A), the corresponding amino acid resiN133I due is also important for interaction with their specific GAPS 0 2 0 4 4 6 0 8 0 and for their biological function (19, 33).A conservative mutaFusion (Fluorescence Units) tion from isoleucine t o methionine at this position ofYptl results FIG.4. Effects of Rab5 mutants on endosome fusion in vitro. in a lethal phenotype in yeast and abolishes its sensitivity to The in oitro endosome fusion assay was conducted as described under GAP (19). In addition, this position is essential for almost every “Experimental Procedures” in the presence of either prenylated (panel interaction between Rab3A and its regulators and a putative A) or nonprenylated (panel B ) recombinant Rab5 proteins (9ndpl in a effector, including Rab3A-GEF (331, Rab3A-GAP (33), Rab3A10-pl reaction mixture). For in vitro prenylation, the reactions were conducted for either 1 h (wild-type(WT),AC4, S34N) or 4 h (N133I) to GDI (42), and Rab3A-rabphilin (48). Theseresults suggestcerobtain comparable levels of prenylation (see Fig. 31, followed by affinity tain functional diversity in this conserved isoleucine residue purification of the recombinant proteins. Shown are the data from a typical in vitro endosome fusion experiment. This experiment was re- among Ras-related small GTPases. It is of interest to compare Rab5 and other small GTPases peated at least three times and the results were reproducible. with the heterotrimeric GTPases involved in signal transducthis contention. First, both Rab5mutantsrequire common tion, especially given the recent crystallography data on the (Y there is structural features (ie. the effector domain Phes7 residue and subunit of a heterotrimeric GTPase (Gta) (49). Although C-terminal isoprenylation) t o inhibit endocytosis, suggesting little homology in primary sequence, the GTPIGDP binding that they sequester the same factor. Second, it has been re- motifs are highly conserved, and the three-dimensional strucported that the Ras equivalents of Rab5:S34N and Rab5:N133I ture of the nucleotide-binding domain is remarkably similar. region is essential for interaction (Ras:Sl7N andRas:N1161) inhibit endogenous Ras function by Furthermore, the C-terminal sequestering a Ras-specific GEF (37-391, and the inhibitionby with a guanine nucleotide exchange factor. Ras:S17N requires C-terminal isoprenylation (37). Third, neiAcknowledgments-We thank Crislyn Schorey and Walter Beron for ther RabS mutant contains detectable GDP or GTP in cells helpful suggestions on the manuscript. (data not shown). It is known that nucleotide-free forms are favored by some nucleotide exchange factors (33, 40, 41). FiREFERENCES nally, Burstein et al. (33) have shown that theeffector domain 1. Zerial, M., and Stenmark, H. (1993) Curr. Opin. Cell Biol. 6, 613420 phenylalanine residueof Rab3A is importantfor its interaction 2. Chavrier, P., Parton, R. G., Hauri, H. P., Simons, K., and Zerial, M. (1990) Cell 62,317-329 with a GEF. C-terminal processing is also important for this 3. Tisdale, E. J., Bourne, J. R., Khosravi-Far, R., Der, C. J., and Balch, W. E. interaction (42), although their initial experiments suggested (1992) J. Cell Biol. 119,749-761 4. Goud, B., Zahraoui, A., Tavitian, A., and Saraste, J. (1990)Nature 346, 553the opposite (33).While it is possible that C-terminal isopre556 nylation is directly involved in the interaction between Rab5 5. Lombardi, D., Soldati, T., Riederer, M. A,, Goda, Y., Zerial, M., and F‘feffer, S. and its GEF, it cannot be ruled out that isoprenylation may R. (1993) EMBO J. 12,677482 6. van der Sluijs, P., Hull, M., Zahraoui, A,, Tavitian, A,, Goud, B., and Mellman, play a n indirect role in such an interaction. In other words, I. (1991)Proc. Natl. Acad. Sci. U. S. A . 88,63134317 isoprenylation may serve to attach the Rab protein t o the mem7. Fiacher von Mollard, G., Mignery,G.A., Baumert, M., Perin, M. S., Hanson, T. J., Burger, P. M., Kahn, R., and Siidhof, T. C. (1990) Proc. Nutl. Acud. Sci. brane where the protein-protein interaction actually occurs.
-
InhibitionMutants ofRub5 Endocytosis by u. s. A. 87,1988-1992
14635
29. Ausubel, F. M., Brent, R., Kingston, R. E., D., Moore, D. Seidman, J. G., Smith, J. A,, and Struhl,K. (1991) Current Protocols in Molecular Biology,Greene U. S. A . 89, 5049-5052 Publishing Associates, Inc., and Wiley-Interscience 9. Elferink, L. A., Anzai, K , and Scheller, R. H. (1992) J. Biol. Chem. 267, 30. Diaz, R., Mayorga, L., and Stahl, P. (1988) J. B i d . Chem. 263, 5768-5775 6093-6100 10. Lutcke. A., Jansson, s., Parton, R. G., Chavrier, p., Valencia, A., Hubec A., 31. Kahn, R.A,,Der,D. J., and Bokoch, G . M. (1992) FMEB J . 6, 2512-2513 Lehtonen, E., and Zerial, M. (1993) J. Cell Biol. 121, 553-56432. Takai, Y., Kaibuchi, K , Kikuchi, A,, and Kawata, M. (1992)Int. Rev. Cytol. 133, 11. Goldenring, J. R., Shen, K R., Vaughan, H. D., and Modlin, I. M. (1993)J . Biol. 187-230 Chem. 268, 18419-18422 33. Burstein, E. S., Brondyk, W. H., and Macara, I. G. (1992) J. Biol. Chem. 267, 12. Salminen, A,, and Novick, P. J. (1987) Cell 49, 527-538 22715-22718 13. Bucci, c., R. Mather, 1.H., Stunnenberg, H., Simons, K.,HoflaCk,34. %engel, u., Schlichting, L., Scherer, A,, Schumam, R., Frech, M., John, J., B., and Zerial, M. (1992) Cell 70,716728 Kabsch, W., Pai, E. F., and Wittinghofer, A. (1990) Cell 62,539-548 14. Li, G., and Stahl, P.D. (1993) J. Biol. Chem. 268,24475-24480 35. Li, G., and Stahl, P. D. (1993) Arch. Biochem. Biophys. 304,471-478 36, Sanford, J. c,, pan, y,,and Wessling-&snick, M, (1993) J , ~ i ~Chem, l , 268, 15. Gomel, J& Chavrier, P., Zerial, M., and Gmenherg, J. (1991) Cell 64,915925 23773-23776 16. Sasaki, T., Kikuchi, A., h a k , S., Hata, Y., Isomura, M., Kuroda, S., and Takai, 37, Feig, L, A,, and Cooper, G, M. (1988) Mol, cell,Bioi. 8, 3235-3243 Y. (1990) J. Biol. Chem. 265, 2333-2337 Poullet, P., and Parmeggiani A. (1993) J . B i d . 38. Hwang, Y.-W., Zhong, J."., 17, mlrich, o,,Stenmark, H., Alexandrov, K., Huber, L, A,, Kaihuchi, K, Sasaki, Chem. 268,24692-24698 T., Takai, Y., and Zerial, M. (1993) J. Biol. Chem. 268,18143-18150 39. Schweighoffer,F., Cai, H., Chevallier-Multon, M. C., Fath, I., Cooper, G., and Burstein, E, s,,and Macara, I, G , (1992) pmc, Natl. Acad. sei, u,s,A, 89, lbcque, B. (1993) Mol. Cell. B i d . 13,39-43 1154-1158 40. Bischoff, R.2F. and Ponsting, H. (19g1) hoc. u. S . A . 88, 19, Becker, J., T ~ T, ~J,, ,nepte, H,-H,, and Gallwitz, D, (1991) EMBO J , 10, 10830-10834 785-792 41. Gilman, A. G . (1987)Annu. Reu. Biochem. 66,615-649 20. Moya, M., Roberts, D., and Novick, P. (1993) Nature 361,460-463 21. Strom, M., vollmer, p., T ~ T. ~J., , and Gallwitz, D. (1993) Nature 361, 42. Burstein,E. s.,Brondyk, w. H..Mac=, 1. G., Kaibuchi, K , and Taka4 y. 736-739 Chem. (1993) 22247-22250 J. Biol. 268, 22. Shirataki, H., Kaibuchi, K., Sakoda, T., Kishida, S., Yamaguchi,T.,Wada,K., 43. Buday, L., and Downward, J. (lg93) 73, 6l1-620 44. Chung, H.-H., Benson, D. R., Cornish, V.W., and Schultz, P. G . (1993) Proc. Miyazaki, M., and Takai, Y. (1993) Mol. Cell. B i d . 13, 2061-2068 Natl. Acad. Sci. U.S. A . 90, 10145-10149 23. Kunkel, T.A. (1985) Proc. Natl. Acad. Sci. U. S. A . 82, 488-492 45. Adari, H., LOWY, D. R., Willumsen, B. M., Der, C.J., and McCormick, F. (1988) 24. Myers, R. M., Lerman, L. S., and Maniatis, T. (1985) Science 229, 242-247 Science 240,518-521 25. Sanger, F., Nicklen, S., and Coulson, A. R. (1977)Proc. Natl. Acad.Sei. U. S. A. 74,5463-5467 46. Sigal, I. S., Gihhs,DAlonzo, J.B., J. S., and Scolnick, E. M. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,4725-4729 26. Hahn, C. S., Hahn, Y. S., Braciale, T.J., and Rice, C. M. (1992) Proc. Natl. 47. Stone, J. C., Vass, W. C., Willumsen,M., B. and Lowy, R.D. (1988) Mol. Cell. Acad. Sci. U. S. A . 89, 2679-2683 Biol. 8, 3565-3569 27. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H.W.,Wenz,M., Northrop, J. P., Ringold, G. M., and Danielsen, M. (1987) Proc. Natl. Acad. 48. McKiernan, C. J.,Brondyk, W. H., and Macara, I. G . (1993)J. Biol. Chem. 268, Sci. U. 5. A . 84, 7413-7417 24449-24452 28. Anderson, D. J., and Blobel, G. (1983) Methods Enzymol. 96, 111-120 49. Noel, J. P., Hamm, H. E., and Sigler, P. B. (1993)Nature 366, 654-663 8. Baldini, G., Hohl, T., Lin, H. Y., and Lodish, H. F. (1992)Proc. Natl. Acad.Sci.
