Structure and expression of tomato mitochondrial genes coding for

Current Genetics 9 Springer-Verlag 1990

Structure and expression of tomato mitoehondrial genes coding for tRNA cys (GCA), t R N A Ash ( G U U ) and t R N A TM (GUA): A native t R N A cys gene is present in dicot plants but absent in monocot plants Shinichi Izuchi 1, Tohru Terachi 2, Masahiro Sakamoto 3, Tetsuo Mikami 4, and Mamoru Sugita 5 1 2 3 4 5

Department of Botany, Faculty of Science, Hokkaido University, Sapporo 060, Japan Institute for National Land Utilization and Development, Kyoto Sangyo University, Kyoto 603, Japan Plant Biotechnology Department, Life Science Laboratory, Mitsui Toatsu Chemicals, Inc., Mobara 297, Japan Laboratory of Industrial Crops, Faculty of Agriculture, Hokkaido University, Sapporo 060, Japan Center for Gene Research, Nagoya University, Nagoya 464-01, Japan

Received May 30/June 22, 1990

Summary. The nucleotide sequences of tRNA A~" (GUU) and tRNA Tyr (GUA) genes from tomato mitoehondria and their flanking regions have been determined. The tomato mitochondrial tRNA ash gene is located 2.1 kb downstream from the tRNA cys gene reported previously (Izuchi and Sugita 1989) and shows a nearly complete identity with the corresponding chloroplast gene. The tRNA Tyrgene, which shows only 73 % homology with the corresponding chloroplast gene, has to be considered a "native" mitochondrial tRNA gene and is 535 bp from the "chloroplast-like" tRNA a~n gene on the same strand. Northern hybridization analysis revealed that the three tRNA genes are transcribed in tomato mitochondria. Southern hybridization analysis of tomato, sugar beet,, rice and wheat mitochondrial DNAs, with oligonucleotide probes for mitochondrial or chloroplast tRNA. genes, demonstrated that the mitochondrial tRNA cy~ , gene found in tomato is present in dicot plants but not in monocots. On the other hand, a chloroplast-like tRNA cy~ gene exists in monocot plants.

Key words: Mitochondria - tRNA genes - Tomato Transcription

Introduction Plant mitochondria contain a set of tRNAs necessary for their own protein synthesis. The structures of a number ofmitochondrial tRNAs and their genes have been determined in various higher plant species (Weft 1988; Lonsdale 1988). From these studies interesting features of plant mitochondrial tRNAs have been revealed. Plant mitochondrial tRNAs fall into three groups, based on the sequence homology with tRNAs of the different genetic compartments; mitochondrion, chloroplast or nucleus. One group represents tRNAs that have 60-70% sequence homology with the corresponding eubacterial Offprint requests to." M. Sugita

tRNAs (Sprinzl et al. 1989) and are distinct from the chloroplast and cytoplasmic tRNAs. Therefore, they have recently been designated as "native" tRNAs (Joyce and Gray 1989a). The second group includes "chloroplast-like" tRNAs, which share 90-100% sequence 9homology with their corresponding chloroplast counterparts. This homology sometimes extends to the flanking regions of the genes. Eight chloroplast-like tRNA genes have so far been identified (Iams et al. 1985; Marechal etal. 1986, 1987; Wintz et al. 1988; Joyce and Gray 1989 a, b; Schuster and Brennicke 1987; Dron et al. 1985). Some of these genes have been demonstrated to be transcribed in mitochondria. Most interestingly, plant mitochondria contain tRNAs that are imported from the cytoplasm and are encoded by the nuclear genome (Marechal-Drouard et al. 1988; Joyce and Gray 1989a). In order to understand the origin of plant mitochon' drial tRNAs and their genes, it is important to determine the genomic organization and structure of mitochondrial tRNA genes. Recently, we have identified a native tRNA cys gene present in tomato mitochondrial DNA (Izuchi and Sugita 1989) and its sequence displayed only 56% homology with the chloroplast-like gene found in maize and wheat (Wintz et al. 1988; Joyce and Gray 1989 a). Here we present the nucleotide sequences of the chloroplast-like tRNA As" and t R N A TM genes, located downstream from the tRNA cy~gene, and their expression in tomato mitochondria. We further present evidence that a native tRNA cys gene is found in the mitochondrial genomes of dicots but not of monocots.

Material and methods Phage clone. A tomato, Lycopersicon esculentum, genomic library (Sugita et al. 1987) was screened by using 5' end-labelled 4S RNA prepared from tomato leaves, and a phage clone TR4 containing the mitoehondrial DNA was selected from several positive clones. DNA manipulation. Subcloning of DNA fragments of TR4 into M13 mp18/19 and pUCI8/19 was performed according to the general procedure described by Maniatis et al. (1982). DNA sequencing

240

Results and discussion

was carried out using the dideoxy chain termination method (Sanger et al. 1977).

Localization and structure o f t R N A genes present in T R 4 Preparation of organelle DNA and RNA. Mitochondria and chloroplasts were extracted and purified from leaves of tomato, sugar beet (Beta vuIgaris), rice (Oryza sativa cw Nihonbare) and wheat (Triticum macha var. subletschchumicum) as previously described (Mikami et al. 1984; Terachi and Tsunewaki 1986; Ishii et al. 1986). Organellar D N A and R N A were isolated from highly purified organelles by phenol/chloroform extraction followed by ethanol precipitation.

We have screened a tomato genomic library using whole tomato 4S RNA and obtained a clone TR4, which contains a 12,5 kb region of the mitochondrial DNA. This was confirmed by physical mapping of the insert D N A and by hybridization with the purified tomato mitochondrial D N A (data not shown). On complete digestion with EcoRI and HindllI, TR4 yields 10 kb (including a lambda arm), 0.56, 1.4, 1.1, 3.2, 0.4, 4.5 and 21 kb (including a lambda arm) DNA fragments in this order (Fig. 1). The 5' end-labelled 4S RNA hybridized to the 0.56, 1.1 and 3.2 kb fragments (data not shown), The 0.56 kb fragment has already been sequenced and found to contain a tRNA cys (GCA) gene (Izuchi and Sugita, 1989). We then sequenced the 1.1 kb fragment and a part of the 3.2 kb fragment. Fig. 2 shows the nucleotide sequence of 1360 bp. Two tRNA genes were identified by searching for GTTC, the corresponding sequence present in the GUOC loop of tRNAs, and for sequences capable of folding a typical clover leaf structure (Fig. 3).

Northern analysis. Tomato mitochondrial or chloroplast R N A was separated in a 1 2 % agarose gel and transferred onto nylon membranes (Hybond N, Amersham) as described elsewhere (Sugita and Gruissem, 1987). The membranes were incubated with D N A fragments labelled with 3zp using Klenow enzyme and random primers in 5 x SSPE, 5% Denhardt's solution, 0.1% SDS and 100 gg/ml denatured salmon sperm D N A for 16-20 h at 60 ~ and washed once in 6 x SSC for 1 h at 60 ~

Southern analysis. Mitochondrial or chloroplast D N A fragments, produced by restriction enzyme digestion, were separated in a 1% agarose gel, transferred onto nylon membranes and then hybridized with 5' end-labelled oligonucleotides in the same hybridization solution used for Northern analysis at 42~ for 12-14 h. The membranes were washed once m 6 x s s c at room temperature for 15 min and then twice at 42 ~ for 20 rain.

Structure o f a t R N A A~" ( G U U ) gene

DNA probes. Oligonucleoude probe MC5 for the tomato mitochondrial t R N A ey~ geue is 5'ATTTCCATTATGTTACCTAG Y (Izuchi and Sugita 1989); CC3 for the tobacco chloroplast t R N A cy~ gene is 5 ' G A T T T G A A C T G G G G A A A A A A 3' (Wakasugi et al. 1986); N M for the tomato chloroplast-like t R N A *~n gene is 5'TTAACAGCCGACCGCTCTAC 3'. Oligonucleotides were 5' end-labelled using [y3zp] ATP and T4 polynucleotide kinase (Maniotis eta[. 1982). A 1.6 kb EcoRI fragment of the sugar beet mitochondriat cox[ gene (Mikami, in preparation) and a 585 bp XhoISnaB fragment of the tobacco chloroplast petB gene (Tanaka et ai. 1987) were used as probes for Northern analysis,

10

,56

HE TR4

/

II

1.4

1.1

H

I

3.2

H

.4

4.5

21kb

EE

I

I

E

II

I

t,,

/

/

A tRNA As" gene (positions 560-631 in Fig. 2) is 72 bp long and contains the anticodon GTT, but does not encode the 3'-terminal CCA sequence, present in all tRNAs. This gene is located 2.1 kb downstream from the tRNA ey~gene and on the same strand (Fig. 1). The tomato mitochondria[ tRNA a~ gene shows 72.2% sequence homology with the corresponding E. coil gene (Sprinzi et al. 1989) and a nearly complete identity with its tobac-

/ / / /

/

HB

ItDw

E

X

I

H

I

tRNACY L=

.

I

558bp Fig. 1. Restriction map of the insert of tomato mitochondvia~ DN A clone TR4. The IRNA genes are boxed. Horizontal arrows indicate the transcription direction of each gene. Restriction sites are indicated as B (BamHl), H (HindIII), E (EcoRI), S (Smal) and X

X

_

""--'B

B

tl]

:

iJ

]l

t R N A Ash t R N N yr I L

I

708bp 730bp (XhoI). Numbers above TR4 indicate the sizes (kbp) of D N A fragments produced by digestion with EcoRI and Hind]]l. Hooked-lines indicate D N A fragments and their sizes (bp) used as probes for Northern analysis as shown in Fig. 4

241 Hindlll . . . . . . . . . ^^~cTT~AcT^~^~acG^~^^aTT6~TTT~A~^A^~^AA^g6G~c~cccTA~cT~a^Tc~hA~A~cA~c~cT^~ca~c~A~AA~cc~T~Ac 9

.

,

,

,

.

1

0

0

.

TAT~G~T~GGG~TTAG~GCTTT~CT~TAA~AAACAT~TAT~GGGCTTA~TTTTTTCAGCTTGATCGG~TCG~TTcT~TGATTT~TAGC~G~AGT~C 200 9

.

.

.

.

,

.

,

TA~TT~GT~GTAG~AA~T~G~AG~GAC~GAC~GAGGG~A~TCTTTCAT~CTG~T~T~CT~GG~TG~GA~UT~G~TC~CTTUTTTTUG~G~U~300

GTTCCAGCCTTTGTTGCCCCTCGGTAGAGTGAGTCTACTTAGCGAACTGGCAGOACGCG~AOATCTATTGAT 9 Xho! . ~ . . . . . . . CAATATGAATCTCGAGAGTG~AIuUIIU 400 ATCG~GCGTCCTTGTC~TGGGGGCTCTCCGGCC~GGGAGGGGCTT~CT~CGTAACCC~TTCTCC~GGTGTATGTG~AAAAG~GT~CGAA~TCAT~TT SO0 tRNA

Ash _

~CTT~GGTC~T~GGTTGGTCCAA~GAA~GAG~GT~GGCTTCCA~`C~TTAAGT~CCTTC~[----C~TCAGTAGCTCAGTG~TACAGCGGTCGGCTGTTAACCGA

600

TTGGTCGT~GGTTcG~TCCT~CTTGGGG~G~TTTTTTA~TT~TCGCcTTTCT~cCTAGCcG~TTGc~TC~GGT~T~T~CTTcTc~TTTCTTTCT^AA 700 cT~G~Ag~Tc~TGGG~C~Tc~A~CGGT~A~TT~TTGTT~GTTTTT~TT~cT~CTCTCGTAT~TT~CTTc~TT~TTcCATTCTTA~G~A~

800

BamH[

~T~TGGA~A~TGG~T~GTAT~TT~TT~C~A.A~oAATT~TCT~C~cT~GT~TT~AA~AACGAAc~A~A~AG~TT~CT~TTTA~Ggo0 ATAGATGGATGTGGcCcAATGGCTAAAGcTCTGCcAGCTTcTT~T^~ACTGAACTCTCTTcTcTTTAGGCTCc~A~TTcTTTTTG~GGGG~ATGGTCTAA IOOO iio0

.Sm.J

tRNATY'

"

=-

~TT~ATTCAGGGCGCCG-c~c~TT~TTAG~TTAGAACCcATTGAGGGGGG~G~CC~G~GAA~/3~GTGGCCGAGTGGT~AAAiG~GG~AGACT 12oo

CT^^^~cTC~a^aaTTT~}c~^ccTAda}~ca^~*ccwGccTcTccc~TTcTTTaTTGT^~AcTTc^Gaa^AcAG~^~oa~acaTT~Tc^c.cara~ 13oo

OAAGGOC^ACCGAGCGAAGr'TT[C ' IT ' TTT)'TTGOCCGTOCCGTGAAGTO~TTOTATC; Fig. 2. Nucleotide sequence of the tomato tRNA A~" gene and tRNA Tyr gene. The coding regions for tRNA genes are boxed. Nucleotide numbers are relative to the first A of the HindIII recognition sequence. Purine-rich motifs, including the "AAGAANRR" G T -A C-G C -O T -G C -G A-I G,T

-G "

/ t

A

(;GTCCT A ^.

A~ ACTCG

O t/~6G

%T,', & ; 6 C,,

Tcr

G,I GG T-A C-G G-C G-C

. Tc

A O-C 0 -C 0 -C A -T G-C A-T

AA

G T T

Asn(OT T)

O

TTC

TOAo TG-C(~GTCcTAA O" CCGo O lk6(3 o

GTCAAAAG% ', rCar~

r

rC

O , f G. "'T C-G ~A "T A-I G-C GTTT A-[

C

A

T A GTA

Tyr(GTA)

Fig. 3. Potential secondary structures deduced from DNA sequences of tRNA genes. A nucleotide which is different from the tobacco chloroplast tRNA A~ gene is indicated by an arrow

co chloroplast counterpart, except for a single nucleotide in the G T O C stem. (Kato et al. 1981 and Fig. 3). A similar chloroplast-like t R N A A~n gene has been found in the mitochondria of wheat and bean (Phaseolus vulgaris) showing respectively, three and four nucleotides different from the t o m a t o gene (Joyce and G r a y 1989 b; Bird et al. 1989). It has been suggested that the t o m a t o t R N A g~" gene is a promiscuous chloroplast D N A sequence inserted into the mitochondrial genome (see review of Levings III and

136o

consensus sequence indentified by Joyce and Gray (1988), are underlined. Pyrimidine-rich sequences present upstream of the genes are dashed-lined

Brown 1989). However, there are no significant homologies (less than 50%) in the flanking regions of the tomato gene with the corresponding chloroplast sequences (Kato et al. 198]) and chloroplast p r o m o t e r elements, " - 1 0 " and " - 3 5 " sequences, present in the upstream region of the gene, arc not found in the t o m a t o mitochondrial sequence (Fig. 2). Since no h o m o l o g y extends to the flanking regions, it is difficult to believe that a chloroplast-like t R N A ASh gene was transferred f r o m a chloroplast genome into a mitochondrial genome during evolution. A b o u t 400 bp, upstream and downstream from the t R N A AS~ gene, are highly conserved (75% homology) in both t o m a t o and wheat mitochondrial D N A (Joyce and G r a y 1989b).

Structure o f a t R N A ry" ( G U A ) gene

A t R N A ryr gene (positions 1167-1249) is 83 bp long and contains the anticodon GTA. The 3'-CCA sequence is not encoded in the gene. The tomato gene shows only one nucleotide difference from that of bean (Bird et al. ]989) and three nucleotides different from wheat (Joyce et al. 1988) and maize (Sangare et al. 1989). The tomato mitochondrial gene shows 67.4% and 73.2% sequence homology with the corresponding E. coli (Sprinzl et al. 1989) and t o m a t o chloroplast genes (Izuchi and Sugita, accession no. X53396 in E M B L D a t a Library), respectively. The tomato t R N A Tyr gene, therefore, has to be considered as a '"native" mitochondrial gene. The t R N A Tyr gene

242 is separated by 535 bp from the chloroplast-like t R N A A~" gene on the same strand. A similar gene organization has been shown in bean mitochondria (Bird et al. 1989). In contrast, the wheat and maize t R N A Tyr genes are not linked to the t R N A A~n gene (Joyce et al. 1988; Sangare et al. 1989), suggesting that rearrangement of the mito-

chondrial genomc during evolution occurred in the spacer between the t R N A ash gene and t R N A Tyr gene.

Expression of the tomato mitochondrial t R N A genes

Fig. 4. Northern hybridization of the 32p-labelled DNA fragment probe for the respective tRNA genes to tomato mitochondrial (lanes M) and chloroplast (lanes C) RNAs. DNA fragments of the tRNA cysgene (eys), tRNA As"gene (ash) and tRNA Tyrgene (tyr) are as shown in Fig. 1; coxI and petB are gene-specific probes of mitochondria and chloroplast, respectively. Numbers indicate the positions of the ribosomal RNAs of mitochondrial (18S and 26S) and chloroplasts (16S and 23S) and those of the tRNAs (45)

To examine whether the three tomato t R N A genes are functional in the mitochondrion, Northern blot hybridization was carried out using 32p_labelled D N A fragments containing the respective t R N A genes (Fig. 4). A 558 bp D N A fragment containing the t R N A cys gene hybridized strongly to tRNA-sized transcript of the mitochondrial R N A but not to the chloroplast R N A . A 730 bp BamHI-SmaI fragment containing the t R N A Tyr gene hybridized storngly to the mitochondrial t R N A and also gave a faint signal with the chloroplast t R N A . This cross-hybridization of chloroplast R N A m a y be due to moderate homology (73.2%) between the tomato mitochondrial and chloroplast genes. Cross-hybridization experiments, using a petB probe encoding chloroplast cytochrome b 6 and a coxI probe encoding mitochondrial cytochrome oxidase subunit I, confirmed that, as shown in Fig. 4, the R N A preparations from purified mitochondria or chloroplasts are not contaminated with each other. When a 708 bp HindIII-XhoI fragment containing the chloroplast-like t R N A Ash gene was used as a probe, a strong hybridization signal was detected in both the mitochondrial and chloroplast RNAs, as expected from their nearly identical sequence homologies. These results clearly demonstrate that the three t R N A genes are expressed in t o m a t o mitochondria and are, therefore, functional genes. Weak bands of higher molecular mass were also

Fig. 5. Detection of a native and a chloroplast-like tRNA cr~ gene by hybridization of gene-specific oligonucleotides with the mitochondrial DNAs from various plants. DNAs, digested with EcoRI (E) or HindIII (H), were hybridized with the oligonucleotide probe MC5 (native) and CC3 (cp-like) of a mitochondriat gene and a

chloroplast gene, respectively. Panel A: Tomato nuclear (N), chloroplast (C) and mitochondrial (M) DNAs. Panels B and C: Mitochondrial DNAs of sugar beet (Sug), wheat (WHO, rice (Rc) or tomato (Tom). Numbers refer to the sizes (kbp) of hybridized DNA fragments

243 detected (Fig. 4). These may be t R N A precursors since no long open reading frames were found in the flanking regions of the t R N A genes (Fig. 2) and in the region between the t R N A cys gene and the t R N A h~n gene (Izuchi and Sugita, accession no. X53397 of E M B L Data Library). Putative promoter sequences, A A G A A N R R , have been found in the upstream regions of t R N A genes in higher plant mitochondria (Joyce et al. 1988). Such purine-rich motifs are present 3 7 - 3 0 bp ( A A G A A C G A ) and 79 72 bp ( A A G A G T G A ) upstream of the t R N A h~n gene (Fig. 2). Similar motifs have been found in the upstream region of the t R N A cy~ gene (Izuchi and Sugita 1989). On the other hand, this motif was not found upstream of the t R N A Tyr gene. In addition to the purinerich motif, two pyrimidine-rich sequences (8-11 bp) are present approximately 50 bp and 100 bp upstream of the t R N A A~n gene and t R N A Tyr gene (Fig. 2).

Presence o f a native or chloroplast-like t R N A c.w gene among various plant species

The tomato mitochondrial t R N A cys gene reported previously (Izuchi and Sugita 1989) is distinct from the chloroplast-like t R N A cys gene found in wheat and maize (Wintz et al. 1988; Joyce and Gray 1989 a). This raises the question of whether a mitochondrial genome contains either of the genes or has two different genes for tRNACyL To solve this question we carried out Southern hybridization of the mitochondrial DNAs from tomato, sugar beet, rice and wheat with 5'end-labelled oligonucleotides specific for either the mitochondrial or the chloroplast-like gene. Probe MC5, for the mitochondrial gene, hybridized to tomato mitochondrial DNA, but not to tomato chloroplast and nuclear DNAs (Fig. 5, panel A), confirming that the tomato t R N A cy~ gene exists only in the mitochondrial genome. This probe hybridized to sugar beet mitochondrial D N A but not to wheat and rice DNAs (Fig. 5, panel B). In contrast, probe CC3, for the chloroplast-like gene, hybridized to wheat and rice mitochondrial DNAs but not to the DNAs frorn tomato and sugar beet (Fig. 5, panel C). This CC3 probe gave hybridization signals to the chloroplast DNAs of all four plants (data not shown). A 27-mer oligonucleotide complementary to the 3' end o f the tomato t R N A cys gene failed to hybridize with a complete set of cosmids covering the whole wheat and maize mitochondrial genomes but did hybridize with a cosmid bank from petunia (Grienenberger, personal communication). Taken together the data indicate that a plant mitochondrial genome contains either of the two different t R N A cy~ genes; i.e., a chloroplast-like t R N A cyS gene, present in the mitochondrial genome of monocot plants, or a native gene, present in the genome of dicot plants. It is interesting to note that a t R N A Phe (GAA) gene has been shown to be a native type in bean mitochondria (Marechal et al. 1985) and a chloroplast type in wheat mitochondria (Joyce and Gray 1989 a).

Probe NM, for the t R N A A~n gene, hybridized to the mitochondrial DNAs from all four plants (data not shown), suggesting that a chloroplast-like t R N A A~" gene is likely to be present in all higher plant mitochondrial DNAs. To our knowledge, no native t R N A A~ngenes have been found in plants. Acknowledgements. We thank Dr. M. Sugiura, for the supply of oligonucleotides and the critical reading of this manuscript. We also thank Drs. M. Grienenberger and J. Weil for valuable suggestions. This work was supported by a Grant-in-Aid from Ministry of Education, Science and Culture, Japan.

References

Bird S, Duncker B, Garber P, Bonen L (1989) Nucleic Acids Res 17:4379 Dron M, Hartmann C, Rode A, Sevignac M (1985) Nucleic Acids Res 13:8603-8610 Iams KP, Heckman JE, Sinclair JH (1985) Plant Mol Biol 4: 225232 Ishii T, Terachi T, Tsunewaki K 0986) Jpn J Genet 61:537 541 Izuchi S, Sugita M (1989) Nucleic Acids Res 17:I248 Joyce PB, Gray MW (1989a) Nucleic Acids Res 17:5461-5476 Joyce PB, Gray MW (1989b) Nucleic Acids Res 17:7865-7878 Joyce PB, Spencer DF, Bonen L, Gray MW (1988) Plant Mol Biol 10:251-262 Kato A, Shimada H, Kusuda M, Sugiura M (1981) Nucleic Acids Res 9:5601-5607 Levings CS III, Brown GG (1989) Cell 56:171-179 Lonsdale DM (1988) Plant Mol Biol Rep 6:266 273 Maniatis T, Fritsch E, Sambrook J (1982) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Marechal L, Guillemaut P, Grienenberger JM, Jeannin G, Weil JH (1985) FEBS Lett 184:289-293 Marechal L, Guillemaut P, Grienenberger JM, Jeannin G, Weil JH (1986) Plant Mol Biol 7:245-253 Marechal L, Runeberg-Roots P, Grienenberger JM, Colin J, Weil JH, Lejeune B, Quetier F, Lonsdale DM (1987) Curr Genet 12:91-98 Marechal-Drouard L, Welt JH, Guillemaut P (1988) Nucleic Acids Res 16:4777-4788 Mikami T, Sugiura M, Kinoshita T (1984) Curr Genet 8:319-322 Sangare A, Lonsdale D, Weil J, Grienenberger J (1989) Curr Genet 16:195-201 Sanger E Nicklen S, Coulson AR (1977) Proc Natl Acad Sci USA 74: 5463- 5467 Schuster W, Brennicke A (1987) EMBO J 6:2857-2863 Sprinzl M, Hartmann T, Weber J, Blank J, Zeidler R (1989) Nucleic Acids Res 17 (supplement):rl-r172 Sugita M, Gruissem W (1987) Proc Natl Acad Sci USA 84: 7104794 Sugita M, Manzara T, Pichersky E, Cashmore A, Gruissem W (1987) Mol Gen Genet 209:247-256 Tanaka M, Obokata J, Chunwongse J, Shinozaki K, Sugiura M (1987) Mol Gen Genet 209:427-431 Terachi T, Tsunewaki K (1986) Theor Appl Genet 73:175-181 Well JH (1988) Plant Mol Biol Rep 6:30-31 Wintz H, Grienenberger JM, Weil JH, Lonsdale DM (1988) Curr Genet 13:247-254 Wakasugi T, Ohme M, Shinozaki K, Sugiura M (1986) Plant Mol Biol 7:385-392 Communicated by H. K6ssel