Virus Genes 25:2, 207±216, 2002 # 2002 Kluwer Academic Publishers. Manufactured in The Netherlands.
Subcellular Location of the Helper Component-Proteinase of Cowpea Aphid-Borne Mosaic Virus SIZOLWENKOSI MLOTSHWA,1,2,y JAN VERVER,1 IDAH SITHOLE-NIANG,2 KODETHAM GOPINATH,1,z JAN CARETTE,1 AB VAN KAMMEN1 & JOAN WELLINK1,* 1
Laboratory of Molecular Biology, Wageningen University, Dreijenlaan 3, 6703 HA, Wageningen, The Netherlands 2 Department of Biochemistry, University of Zimbabwe, P. O. Box MP 167 Mount Pleasant, Harare, Zimbabwe Received March 8, 2002; Revised May 6, 2002; Accepted May 29, 2002
Abstract. The helper component-proteinase (HC-Pro) of Cowpea aphid-borne mosaic virus (CABMV) was expressed in Escherichia coli and used to obtain HC-Pro antiserum that was used as an analytical tool for HC-Pro studies. The antiserum was used in immunofluorescence assays to study the subcellular location of HC-Pro expressed with other viral proteins in cowpea protoplasts in a natural CABMV infection, or in protoplasts transfected with a transient expression construct expressing HC-Pro separately from other viral proteins under the control of the 35S promoter. In both cases the protein showed a diffuse cytoplasmic location. Similar localisation patterns were shown in live protoplasts when the transient expression system was used to express HC-Pro as a fusion with the green fluorescent protein as a reporter. In an alternative expression system, the HC-Pro coding region was subcloned in-frame between the movement protein and large coat protein genes of RNA2 of Cowpea mosaic virus (CPMV). Upon transfection of protoplasts with this construct, HC-Pro was expressed as part of the RNA2 encoded polyprotein from which it was fully processed. In this case, the protein localised in broad cytoplasmic patches reminiscent of the typical CPMV induced cytopathic structures in which CPMV replication occurs, suggesting an interaction of HC-Pro with CPMV proteins or host factors in these structures. Finally, recombinant CPMV expressing HC-Pro showed a strongly enhanced virulence on cowpea and Nicotiana benthamiana consistent with the role of HC-Pro as a pathogenicity determinant, a phenomenon now known to be linked to its role as a suppressor of host defense responses based on post-transcriptional gene silencing. Key words: Cowpea aphid-borne mosaic virus, cowpea protoplasts, helper component-proteinase, immunofluorescence, localisation, pathogenicity
Introduction Cowpea aphid-borne mosaic virus (CABMV) is a member of the genus Potyvirus of which Potato virus Y is the type member. Potyviruses have a positive strand RNA genome of about 10 kb, which encodes a single large polyprotein that is processed into 10 mature *Author for all correspondence: Laboratory of Molecular Biology, Dreijelaan 3, 6703 HA Wageningen, The Netherlands. E-mail:
[email protected] y Current address: Department of Biological Sciences, University of South Carolina, Columbia, SC 29208, USA. z Current address: Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331, USA.
proteins (see review by Urcuqui-Inchima et al. [1]). The properties and functions of the different gene products have been investigated at length, and from these studies, the nonstructural helper componentproteinase (HC-Pro) is known to be a multifunctional protein that plays a role in different steps of the potyvirus life cycle (see Maia et al. [2] for a review). HC-Pro carries autoproteolytic activity by which it cleaves itself from the polyprotein precursor [3,4], it has a role in viral RNA replication [5] and in spread of the virus through the host plant [5±7]. Besides, it is involved in aphid mediated transmission of the virus [8±12] and is a pathogenicity factor [8,13] that also enhances the pathogenicity of a broad range of
208
Mlotshwa et al.
heterologous viruses [14]. More recently, the HC-Pro and different viral pathogenicity factors have been shown to be suppressors of post-transcriptional gene silencing (PTGS) [15±18], a sequence specific RNA targeting and degradation process. This finding supports the idea that silencing evolved as an antiviral defense pathway and has yielded invaluable tools for studying the PTGS mechanism. In this work the subcellular location of the HC-Pro of CABMV in plant cells was studied using different expression and detection systems. Immunofluorescence assays, using an HC-Pro antiserum prepared from an Escherichia coli expressed protein, were used to determine the localisation of HC-Pro expressed in protoplasts with other viral proteins in a natural CABMV infection, and of HC-Pro expressed separate from other viral proteins under the control of the 35S promoter in a transient expression system. The localisation pattern was further corroborated in live protoplasts using the transient expression system to express HC-Pro fused to the green fluorescent protein (GFP) as a reporter. In an alternative expression system, the HC-Pro was cloned in-frame in RNA2 of Cowpea mosaic virus (CPMV). Materials and Methods Construction of pT77/HCPro and Expression in E. coli The BL21 (DE3) strain of E. coli and pT77 expression plasmid were kindly provided by B. J. M. Verduin (Laboratory of Virology, Wageningen-UR, the Netherlands). Primers were designed for subcloning of HC-Pro for expression in E. coli. The upstream primer (econdehcF) incorporated an ATG translation start codon in the context of an NdeI restriction site, an EcoRI site and 30 nucleotides of the 5 0 coding region of HC-Pro (CCGGAATTCCATATGAGCCATCAGTTGGAGGTTCAATTTTTCCAG). The downstream primer (bamstophcR) incorporated a BamHI site, a TAA translation stop codon and the 27 nucleotides complementary to the 3 0 coding region of HC-pro (CGCGGATCCTTAACCAACCTTGTAGAACTTCATTTCA CTA). The HC-Pro coding region was amplified with primers econdehcF and bamstophcR, digested with EcoRI and BamHI, and cloned downstream of the phageT7 RNA polymerase promoter in the pT77 vector similarly digested with EcoRI
and BamHI. The pT77/HCPro construct was electroporated into the E. coli strain BL21 (DE3) and the HC-Pro expressed and purified as inclusion bodies as described for the movement protein (MP) of Brome mosaic virus by Jansen et al. [19]. Preparation of HC-Pro Specific Antiserum The re-natured HC-Pro solution was resolved using SDS-PAGE and the 52 kDa band excised from SDSpolyacrylamide gel stained with KCl as described by Hager and Burgess [20]. About 250 mg of the gelexcised denatured protein was divided into three equal parts that were separately injected into a rabbit at two-week intervals (Eurogentec, Belgium). The rabbit was bled three times and immunoglobulin fractions isolated and tested for immunoreactivity on western blots. SDS-PAGE and Western Blot Analysis Protein samples were boiled for 5 min in protein loading buffer [0.31 mM Tris-HCl pH 6.8; 50% (v/v) glycerol; 5% (w/v) SDS; 10% (v/v) -mercaptoethanol and 0.1% (w/v) bromophenol blue] and separated by SDS-PAGE on 12% SDS-polyacylamide gel as described in Sambrook et al. [21] and protein bands visualised with Coomassie blue staining. For western immunoblot analysis, proteins were transferred from SDS-polyacrylamide gel to nitrocellulose membranes using a Biorad transblot apparatus at 50 V overnight and the blots stained in Panceau to check the efficiency of transfer. The membranes were blocked with 5% (w/v) skimmed milk and probed with polyclonal antibodies and goat anti rabbit-alkaline phosphatase (GAR-AP) conjugate. Construction of Plant Expression Plasmids pMonHCPro. The construct is based on the transient expression vector pMon999 [22]. The HC-Pro coding region was amplified with primers econdehcF and bamstophcR to incorporate a translational start codon (ATG) in-frame at the 5 0 end and a stop codon (TAA) at the 3 0 end of the HC-Pro gene. The PCR product was cloned as an EcoRI-BamHI fragment between the enhanced 35S promoter (e35S) and the nopaline synthetase (NOS) terminator in EcoRI-BamHI digested pMon999 vector resulting in the construct pMonHCPro (Fig. 1A).
Localisation of the HC-Pro of CABMV
pMonGFPHCPro. The construct contains a GFPHC-Pro fusion under the control of the e35S promoter and NOS terminator. It was engineered by excising the 60K gene of CPMV from the pMonGFP60K construct as an EcoRI-BamHI fragment and replacing it with HC-Pro excised as an EcoRI-BamHI fragment from plasmid pMonHCPro (Fig. 1B). pM19HCPro7 and pM19HCPro2A. The constructs are based on CPMV RNA2 vectors pM19-7 and pM192A described by Gopinath et al. [23]. The HC-Pro coding region was amplified with primers econdehcF and the primer xbabamhcR (TGCTCTAGAGGATCCACCAACCTTGTAGAACTTCATTTCACTA) designed from the 27 nucleotides of the 3 0 coding region of HC-Pro and incorporating BamHI and XbaI sites. The amplified fragment was cloned in-frame as an EcoRI-XbaI fragment in EcoRI-XbaI-digested pM19-7 or pM19-2A vector. This resulted in plasmids pM19HCPro7 and pM19HCPro2A in which the HCPro is inserted in-frame between the MP and large coat protein (L) genes of CPMV RNA2 (Fig. 1C and D). Protoplast Isolation, Transfection and Immunostaining Cowpea protoplasts were isolated from 10-day-old plants as described by Rezelman et al. [24] and
Fig. 1. Constructs used in HC-Pro localisation studies in cowpea protoplasts. HC-Pro sequences cloned between e35S promoter and NOS terminator in pMon999 transient expression vector comprise; (A) full-length HC-Pro coding region, and (B) GFP-HCPro (GFP fused at the 5 0 end of the full-length HC-Pro coding region). HC-Pro cloned in-frame between the MP and the L coat protein in CPMV RNA2-based vectors M19-7 (C), and M19-2A (D); the open bars represent the ORF and the solid vertical lines indicate proteolytic cleavage sites. 19L, 19 N-terminal amino acids of the L protein; 7MP, 7 C-terminal amino acids of the MP; 2A, 2A protease of Foot and mouth disease virus (FMDV).
209
aliquots of 150 ml each containing 106 protoplasts were transfected either with 10 mg plasmid DNA, 1±2 mg in vitro transcripts or 50 ml of homogenate prepared from virus-infected leaves as previously described by van Bokhoven et al. [22]. In vitro transcripts of cDNA clones were prepared using T7 RNA polymerase as described by Vos et al. [25]. Samples were incubated in sterile 24-well tissue culture plates under continuous illumination at 25 C for 24±48 h. The protoplasts were fixed and immunostained with 500 times dilute HC-Pro antiserum and 60 times dilute goat anti-rabbit antibodies conjugated to fluorescein isothiocynate (GAR-FITC) as described by Carette et al. [26]. Immunofluorescence and Confocal Microscopy Fixed or live protoplasts were observed with a fluorescence microscope equipped with FITC/UV filters (Nikon Optiphot 2), and with a Zeiss LSM confocal microscope using the standard filters to detect FITC (pseudo-colored green) in fixed protoplasts or GFP in living protoplasts; and/or rhodamine filter settings to detect autofluorescence of chlorophyll (pseudo-colored red) in living protoplasts. The excitation wavelength used was 488 nm and the emission band pass filter was 505±550 nm. Inoculation of Plants and Analysis of Infected Plants To release the virus particles, a pellet of 106 protoplasts was suspended in 100 ml of PBS (100 mM sodium phosphate; 1.5 M NaCl, pH 7.2) and disrupted by repeated uptake through a fine needle attached to a syringe as described by Verver et al. [27]. The protoplast extracts or homogenate prepared from infected leaf material were inoculated onto primary leaves of 10-day-old cowpea or 20-day-old N. benthamiana plants pre-dusted with carborundum. Virus was purified from infected leaves using the polyethylene glycol method described by van Kammen [28]. RNA was isolated from virus particles by phenol/ chloroform extraction and ethanol precipitation, analysed by agarose gel electrophoresis and cDNAs amplified by RT-PCR as described by Sijen et al. [29]. The P30 fraction was enriched for membranes, and the S30 supernatant fraction containing soluble proteins were prepared from virus-infected leaves as described by Gopinath et al. [23]. Virus particles,
210
Mlotshwa et al.
P30 and S30 fractions were analysed on polyacrylamide-SDS gels and immunoblots as described earlier [23].
of the HC-Pro preparation to be used for raising antiserum, the 52 kDa band of the soluble fraction of the purified protein was excised from the gel and used to raise an antiserum in rabbits.
Results
HC-Pro Antiserum Raised against the E. coli Expressed Protein
Purification of HC-Pro Expressed in E. Coli To obtain large quantities of the CABMV HC-Pro protein for the production of polyclonal antiserum, E. coli BL21 (DE3) cells transformed with plasmid pT77/HCPro were used to overproduce the HC-Pro protein. The induction of T7 RNA polymerase expression resulted in high level synthesis and accumulation of the HC-Pro protein, which had the expected size of 52 kDa as shown by SDS-PAGE analysis and Coomassie brilliant blue (R-250) staining of cell lysates (Fig. 2A, lanes 4±7). The expressed protein accumulated in inclusions that were readily separated from E. coli proteins by centrifugation of cell lysates followed by further removal of bacterial proteins by washing the pellets in 1 M NaCl. Solubility of purified inclusions in 6 M urea yielded about 10% soluble protein (Fig. 2B, lanes 4±5), while most of the protein remained in the insoluble fraction (Fig. 2B, lanes 2±3). In addition to the major 52 kDa band, the soluble fraction had minor bands possibly resulting from degradation or contamination with E. coli proteins. To ensure the complete homogeneity A
B
The HC-Pro antiserum was tested for immunoreactivity and specificity to the HC-Pro protein on western blots. With dilutions up to 1 : 5000, the antiserum was highly reactive against HC-Pro in homogenate prepared from leaves infected with CABMV (Fig. 2C, lane 2) or with HC-Pro expressed in E. coli (Fig. 2C, lane 3), and not with uninfected leaves (Fig. 2C, lane 1). Thus, the antiserum had a high titer of immunoreactive antibodies specific for the HC-Pro protein and was suitable for immunodetection and localisation of the protein in protoplasts and plants. Expression and Subcellular Location of HC-Pro in Plant Cells Following its evaluation, the HC-Pro antiserum was used in immunofluorescence assays to determine the subcellular location of HC-Pro in cowpea protoplasts infected with CABMV in which HC-Pro is expressed with other viral proteins, or using a transient expression system in which HC-Pro was expressed under the C
Fig. 2. SDS-PAGE analysis of CABMV HC-Pro expressed in E. coli BL21 (A and B), and western blot evaluation of HC-Pro antiserum (C). (A) Lane 1, protein molecular weight markers. Lane 2, cell lysate of non-transformed BL21. Lane 3, cell lysate of BL21 transformed with the pT77 vector. Lane 4±7, cell lysates of different cell cultures of pT77/HCPro-transformed BL21 after induction of expression. (B) Lane 1, protein molecular weight markers. Lane 2±3, insoluble pellet remaining after solubilisation of protein aggregates. Lanes 4±5, purified HC-Pro protein obtained by solubilisation of protein aggregates. (C) Lane 1, protein extract prepared from uninfected leaves. Lanes 2, protein extract prepared from CABMV-infected leaves. Lane 3, crude lysate of HC-Pro expressed in BL21 cells.
Localisation of the HC-Pro of CABMV
control of the enhanced 35S promoter separate from other viral proteins (Fig. 1A). The transient expression system was also used to express a GFP-HC-Pro fusion protein to study the subcellular location of HC-Pro in living protoplasts (Fig. 1B). In addition, an alternative viral based expression system was used in which the HC-Pro coding region was subcloned in-frame between the MP and L genes of RNA2 of CPMV (Fig. 1C and D) [23]. After transfection of protoplasts with this construct together with CPMV RNA1, in which viral replication functions reside, the HC-Pro is expressed with the CPMV proteins. For immunofluorescence assays, the transfected protoplasts were either fixed with ethanol or paraformaldehyde as an alternative fixative in which the integrity of protoplasts is better preserved. The fixed protoplasts were immunostained with the HC-Pro antiserum combined with GAR-FITC secondary antibody and the expression and subcellular location of HC-Pro traced by immunofluorescence using confocal microscopy.
211
Typically, 10±30% of the protoplasts showed immunofluorescence or GFP fluorescence 2 days post-transfection with 10 mg of either pMon/HCPro, pMon/GFPHCPro, 1 mg of in vitro transcripts of pM19HCPro2A or pM19HCPro7. HC-Pro produced with other viral proteins during a natural CABMV infection was diffusely distributed throughout the cytoplasm (Fig. 3A). Similar results were obtained when HC-Pro was expressed separate from other viral proteins using the transient expression system in which HC-Pro was produced either as a free protein or with GFP fused at its N-terminus (Fig. 3B and C). The diffuse cytoplasmic location of HC-Pro was corroborated in planta both in early and late infection of N. benthamiana using the Tobacco rattle virus vector described by Ratcliff et al. [30] (not shown). GFP alone, expressed in the transient expression system, was mainly localised in the nucleus (not shown). On the other hand, HC-Pro expressed in CPMV vectors (pM19HCPro7 and pM19HCPr02A) was localised in confined cytoplasmic patches close to
Fig. 3. Confocal fluorescence micrographs showing the intracellular distribution of CABMV HC-Pro in cowpea protoplasts; images were collected with focal depth of 1 mm. Protoplasts transfected with (A) CABMV, (B) pMonHCPro, (C) pMonGFPHCPro, and (D) pM19HCPro7.
212
Mlotshwa et al.
Western blot analysis of the fractions using HC-Pro antiserum revealed that HC-Pro co-purified with the membrane fraction (Fig. 4A, lane 3) and no protein was detectable in the S30 fraction (Fig. 4A, lane 2), thus indicating an association between HC-Pro and cytoplasmic membranous components. The HC-Pro protein was detected as a single band of molecular weight of 52 kDa thus showing that it was fully processed from the RNA2 encoded polyprotein (Fig. 4A, lane 3). The blots were further probed with antiserum raised against the L protein of CPMV. In the P30 fraction of homogenate prepared from leaves infected with M19HCPro7, a single band of the fully processed L protein with molecular weight of 37 kDa was detected (Fig. 4B, lane 2). However, in a homogenate prepared from leaves infected with M19HCPro2A and in virus particles purified from this homogenate, two forms of the L protein were detected (Fig. 4B, lanes 3±4): the fully processed 37 kDa L protein released from the polyprotein by the proteolytic activity of the FMDV 2A protease at the G/P cleavage site at the N-terminus of the L protein and of the CPMV protease at the Q-G cleavage site at the C-terminus, and a larger 2A±L fusion protein released from the
the nucleus as shown for pM19HCPro7 (Fig. 3D). In pM19HCPro7 infected protoplasts the RNA2encoded 58K protein was localised in the nucleus, the RNA1-encoded 110K in confined cytoplasmic patches close to the nucleus, and the L protein was distributed throughout the cytoplasm as tested by immunofluorescence with antibodies directed against these proteins, which is similar to the situation in wild type CPMV infected cells (not shown). HC-Pro Expressed in CPMV is Fully Proteolytically Processed and Enhances the Virulence of CPMV Subsequently, cowpea and N. benthamiana plants were inoculated with homogenate of either pM19HCPro7- or pM19HCPro2A-transfected protoplasts (NB: in these CPMV constructs the prefix `p' included when referring to the plasmid constructs will be omitted when referring to the progeny virus). Seven days after infection, a homogenate was prepared from the infected leaves and resolved into a S30 fraction containing soluble proteins, and a P30 fraction enriched for membrane bound proteins. A
B
Fig. 4. Western blot analysis of proteins from homogenate of cowpea leaves infected with either M19HCPro7 or M19HCPro2A and of the purified virus particles. (A) Protein extracts of M19HCPro7-infected plants probed with HC-Pro antiserum (1 : 5000). Lane 1, protein extract of uninfected plant. Lane 2, S30 fraction of infected plant. Lane 3, P30 fraction of infected plant. Lane 4, virus particles purified from M19HCPro7 infected plants. (B) Protein extracts of M19HCPro7- and M19HCPro2A-infected plants probed with CPMV CP antiserum (1 : 10000). Lane 1, protein extract of healthy plant. Lane 2, P30 fraction of M19HCPro7-infected plant. Lane 3, P30 fraction of M19HCPro2A-infected plant. Lane 4, virus particles purified from M19HCPro2A infected plants.
Localisation of the HC-Pro of CABMV
polyprotein by the proteolytic activity of HC-Pro at the N-terminus of the 2A protein and of the CPMV protease at the C-terminus of the L protein. To study the effect of HC-Pro on the virulence of CPMV, cowpea plants were inoculated with
213
M19HCPro7 or M19HCPro2A and examined for symptoms over a 20-day period. For controls, plants were either inoculated with wild type CPMV, CABMV, CABMV CPMV, CPMV expressing GFP (M19GFP7, Gopinath et al. [23]) or mock
Fig. 5. Effect of HC-Pro on the virulence of CPMV; in all cases the symptoms are shown 14 dpi. (A) CPMV wild type symptoms on cowpea. (B) Enhanced symptoms on cowpea plants inoculated with homogenate of pM19HCPro7-transfected protoplasts. (C) CABMV wild type symptoms on cowpea. (D) Enhanced symptoms on cowpea plants doubly infected with CABMV and CPMV. (E) Healthy cowpea plant.
214
Mlotshwa et al.
inoculated with water. In plants inoculated with wild type CPMV, a yellow mosaic appeared on systemic leaves 5 dpi (symptoms 14 dpi are shown in Fig. 5(A)) but plant growth was not significantly affected throughout the 20-day period. In plants infected with M19GFP7, systemic green fluorescence was visible using a hand-held UV lamp 6 dpi, followed by a mild yellow mosaic without any significant effect on plant growth (not shown). However, CPMV expressing HC-Pro (M19HCPro7 or M19HCPro2A) showed enhanced virulence (Fig. 5B) compared to wild type CPMV (Fig. 5A), CPMV expressing GFP (M19GFP7) (not shown) or CABMV (Fig. 5C). The enhanced virulence resulted in death of cowpea plants 10 dpi as shown 14 dpi in Fig. 5B. The presence of the HC-Pro insert in virions isolated from infected plants was confirmed by RTPCR (not shown). This pattern of severe symptoms was also observed in plants doubly infected with wild type CPMV and CABMV (Fig. 5D). A healthy (mock inoculated) cowpea plant is shown in Fig. 5E. CPMV expressing HC-Pro also showed enhanced virulence on N. benthamiana (not shown). Discussion This study investigates the subcellular location of the HC-Pro of CABMV in plant cells. For this, the HCPro was expressed in cowpea protoplasts either with other viral proteins in a natural CABMV infection (Fig. 3A), or separate from other viral proteins using a transient expression system in which HC-Pro was expressed either as a free protein (Fig. 3B) or with GFP fused at its N-terminus (Fig. 3C). In all cases the protein was diffusely distributed throughout the cytoplasm suggesting that the localisation of HC-Pro is not influenced by other CABMV proteins. Ultrastructural studies previously revealed HC-Pro-containing cytoplasmic amorphous inclusions in cells infected with Plum pox virus [31], Papaya ringspot virus and Pepper mottle virus [32,33], representing deposits of excess protein. Whilst the cytoplasmic accumulation of HC-Pro could be essential for some of its functions such as virus acquisition and transmission by aphids, targeting to specific subcellular structures might be masked due to accumulation of excess protein. For instance, it is conceivable that due to its role in cell-to-cell spread [7], HC-Pro should be targeted to the cell periphery at an early stage of
infection. However this could not be demonstrated even at early times post infection of protoplasts, may be because of the transient nature of the event. More recently, HC-Pro has been shown to be one of the virus-encoded suppressors of PTGS (reviewed by Li and Ding [34]), and to eliminate PTGS-associated small RNAs [35]. Its cytoplasmic accumulation could thus be functionally important for suppression of PTGS, more so since the RNA degradation step of the PTGS mechanism is cytoplasmically localised and limits virus replication and accumulation. It is very well possible that HC-Pro is also associated with potyviral replication sites, which are dispersed in the cytoplasm as small clusters of membranous vesicles [31,36]. HC-Pro suppression of PTGS has been shown to be cell autonomous [37] and could thus require high levels of HC-Pro at a critical stage of virus replication and spread. In contrast to HC-Pro, the PTGS suppressor encoded by Cucumber mosaic virus, the 2b protein, is largely localised in the nucleus, and this was shown to be functionally important for its activity as a PTGS suppressor [38]. In an alternative expression system, the HC-Pro coding region was subcloned in-frame between the MP and L genes of RNA2 of CPMV (M19HCPro7). Upon transfection of protoplasts with M19HCPro7, the HC-Pro was produced as part of the RNA2 encoded polyprotein prior to proteolytic processing. In this case, the protein localised in broad cytoplasmic patches. The localisation was remarkable in that it is reminiscent of the typical CPMV induced cytopathic structures described by De Zoeten et al. [39], thus suggesting co-localisation of HC-Pro with CPMV proteins associated with these structures. It is unlikely that the additional CPMV derived amino acid residues at the termini of HC-Pro (19 from L and 7 from MP) had any significant influence on its localisation since the same residues had no effect on the localisation of GFP expressed using the same system [23]. Furthermore, the HC-Pro antiserum did not cross react with host cowpea or CPMV proteins thus excluding the possibility of nonspecific staining. In addition, complete processing of HC-Pro from the M19HCPro7 encoded polyprotein, as shown on western blots of protein extracts prepared from cowpea leaves infected with M19HCPro7 (Fig. 4A, lane 3), further excluded the possibility that the co-localisation with CPMV proteins could be due to incomplete processing of HC-Pro from the polyprotein. On the other hand, localisation patterns of CPMV proteins (MP, CP and
Localisation of the HC-Pro of CABMV
110K) were found to be unaffected by the expression of HC-Pro in CPMV. Overall, these results suggest a putative interaction between HC-Pro and CPMV proteins or specific host factors/membranes localised in the cytopathic structures in which CPMV replication occurs. Given that suppression of PTGS by CPMV is limited [18], it is not unlikely that CPMV could benefit from the presence of HC-Pro at the CPMV replication sites, due to its role as a potent suppressor of PTGS, more so since CPMV is a frequent synergistic partner of CABMV in natural infections of cowpea. Moreover, both CPMV recombinants expressing HC-Pro of CABMV (M19HCPro7 or M19HCPro2A), showed a strongly enhanced virulence on cowpea and N. benthamiana. This resembles the effect of HC-Pro encoded by Tobacco etch virus on the pathogenicity of heterologous viruses [14,40], a phenomenon now known to be associated with its role in suppression of PTGS as an antiviral host defense mechanism. The silencing suppression activity of HC-Pro has recently been shown to correlate with virus long-distance movement and replication maintenance functions [41], indicating that several functions associated with HC-Pro are manifestations of its ability to interdict a PTGS-based host defense response. Viral suppressors of silencing provide essential tools to study PTGS. An understanding of their subcellular behaviour, studied for HC-Pro in this work, would reinforce ongoing research efforts to unravel the molecular mechanism of PTGS. Acknowledgements We are grateful to Dr. B.J.M. Verduin for kindly providing the biological material indicated in Materials and Methods. This work was supported by a grant of the Netherlands Foundation for the Advancement of Tropical Research (WOTRO). References 1. Urcuqui-Inchima S., Haenni A.-L., and Bernardi F., Virus Res 74, 157±175, 2001. 2. Maia I., Haenni A.-L., and Bernardi F., J Gen Virol 77, 1335±1341, 1996. 3. Carrington J.C., Freed D.D., and Sanders T.C., J Virol 63, 4459±4463, 1989. 4. Carrington J.C., Fred D.D., and Oh C.H., EMBO J 9, 1347±1353, 1990.
215
5. Kasschau K.D., Cronin S., and Carrington J.C., Virology 228, 251±262, 1997. 6. Cronin S., Verchot J., Haldeman-Cahill R., Schaad M.C., and Carrington J.C., Plant Cell 7, 549±559, 1995. 7. Rojas M.R., Zerbini F.M., Allison R.F., Gilbertson R.L., and Lucas W.J., Virology 237, 283±295, 1997. 8. Atreya C.D., Atreya P.L., Thornbury D.W., and Pirone T.P., Virology 191, 106±111, 1992. 9. Huet H., Gal-On A., Meir E., Lecoq H., and Raccah B., J Gen Virol 75, 1407±1414, 1994. 10. Wang R.Y., Ammuar E.D., Thornbury D.W., Lopez-Moya J.J., and Pirone T.P., J Gen Virol 77, 861±867, 1996. 11. Blanc S., Ammuar E.D., Garcia-Lampasona S., Dolja V.V., Llave C., Baker J., and Pirone T.P., J Gen Virol 79, 3119±3122, 1998. 12. Andrejeva J., Puurand U., Merits A., Rabenstein F., Jarvekug L., and Valkonen J.P., J Gen Virol 80, 1133±1139, 1999. 13. Atreya C.D. and Pirone T.P., Proc Natl Acad Sci USA 90, 11919±11923, 1993. 14. Pruss G., Ge X., Shi X.M., Carrington J.C., and Vance V.B. Plant Cell 9, 859±868, 1997. 15. Anandalakshmi R., Pruss G.J., Ge X., Marathe R., Mallory A.C., Smith T.H., and Vance V.B., Proc Natl Acad Sci USA 95, 13079±13084, 1998. 16. Brigneti G., Voinnet O., Li W.X., Ding S.W., and Baulcombe D.C., EMBO J 17, 6739±6746, 1998. 17. Kasschau K. and Carrington J.C., Cell 95, 461±470, 1998. 18. Voinnet O., Pinto Y.M., and Baulcombe D.C., Proc Natl Acad Sci USA 96, 14147±14152, 1999. 19. Jansen K.A., Wolfs C.J., Lohuis H., Goldbach R.W., and Verduin B.J., Virology 42, 387±394, 1998. 20. Hager D.A. and Burgess R.R., Anal Biochem 109, 76±86, 1980. 21. Sambrook J., Fritsch E.F., and Maniatis T., Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Laboratory Cold Spring Harbour, NY, 1989. 22. Van Bokhoven H., Verver J., Wellink J., and van Kammen A., J Gen Virol 74, 2233±2241, 1993. 23. Gopinath K., Wellink J., Porta C., Taylor K.M., Lomonossoff G.P., and van Kammen A., Virology 267, 159±173, 2000. 24. Rezelman G., Van Kammen A., and Wellink J., J Gen Virol 70, 3043±3050, 1989. 25. Vos P., Verver J., Jaegle M., Wellink J., Van Kammen A. and Goldbach R., Nucleic Acid Res 16, 1967±1985, 1988. 26. Carette J.E., Stuiver M., Van Lent J., Wellink J., and Van Kammen A., J Virol 74, 6556±6563, 2000. 27. Verver J., Wellink J., Van Lent J., Gopinath K., and Van Kammen A., Virology 242, 22±27, 1998. 28. Van Kammen A., Virology 31, 633±642, 1967. 29. Sijen T., Wellink J., Hendriks J., Verver J., and Van Kammen A., Mol Plant±Microbe Interact 8, 340±347, 1995. 30. Ratcliff F.G., MacFarlane A., and Baulcombe D.C., Plant Cell 11, 1207±1215, 1999. 31. Riedel D., Lesemann D.E., and Maiss E., Arch Virol 143, 2133±2158, 1998. 32. De Meija M.V.G., Hiebert E., and Purcifull D.E., Virology 142, 24±33, 1985. 33. De Meija M.V.G., Hiebert E., Purcifull D.E., Thombury D.W., and Pirone T.P., Virology 142, 34±43, 1985.
216
Mlotshwa et al.
34. Li W.X. and Ding S.W., Curr Opin Biotechnol 12, 150±154, 2001. 35. Mallory A.C., Ely L., Smith T.H., Marathe R., Anandalakshmi R., Fagard M., Vaucheret H., Pruss G., Bowman L., and Vance V.B., Plant Cell 13, 571±583, 2001. 36. Schaad M.C., Jensen P.E., and Carrington J.C., EMBO J 16, 4049±4059, 1997. 37. Llave C., Kasschau K.D., and Carrington J.C., Proc Natl Acad Sci USA 97, 13401±13406, 2001.
38. Lucy A.P., Guo H.S., Li W.X., and Ding S.W., EMBO J 19, 1672±1680, 2000. 39. De Zoeten G.A., Assink A.M., and Van Kammen A., Virology 59, 341±355, 1974. 40. Shi X.M., Miller H., Verchot J., Carrington J.C., and Vance V.B., Virology 231, 35±42, 1997. 41. Kasschau K.D. and Carrington J.C., Virology 285, 71±81, 2001.
