www.sciencemag.org/cgi/content/full/332/6036/1433/DC1
Supporting Online Material for AMPK Is a Direct Adenylate Charge-Regulated Protein Kinase Jonathan S. Oakhill,* Rohan Steel, Zhi-Ping Chen, John W. Scott, Naomi Ling, Shanna Tam, Bruce E. Kemp *To whom correspondence should be addressed. E-mail:
[email protected]
Published 17 June 2011, Science 332, 1433 (2011) DOI: 10.1126/science.1200094 This PDF file includes: Materials and Methods Figs. S1 to S6 References
Supporting Online Material Methods and Materials Protein production. Heterotrimeric AMPK (GST-α1β1γ1 WT and indicated mutants) was expressed in COS7 cells and purified as described previously (S1). Briefly, AMPK was isolated from lysates of transiently transfected COS7 cells using glutathione Sepharose 4B (GE Life Sciences), and either dephosphorylated with PP2c or phosphorylated with CaMKKβ. Beads were washed extensively before elution. PP2c and CaMKKβ were expressed in Sf21-insect cells and purified as described previously (S1). The AMPK α1(1-392) construct (5’: aatagaattcaccatggcccctatactaggttat, 3’: ggatgaattcaaccttggtgtttggatttctgtgg) was cloned into pET23a and expressed as an Nterminal GST fusion protein. This plasmid was used to generate AMPK α1(1-315) kinase domain construct by introducing a stop codon at position 316 (5’: gctgtctttacaactgaaatcaccaggatcc, 3’: ggatcctggtgatttcagttctaaagacagc). Both truncations were expressed in E.coli Rosetta (DE3) strain (induction: 0.25 mM IPTG, 4 hrs, 32°C) and purified using glutathione Sepharose. To generate Thr172 phosphorylated enzyme for SAMS activity assays (α1(1-315); kinase domain without autoinhibitory domain) or phosphatase experiments (α1(1-392); antibody used to immunoblot for total α-subunit was raised using a peptide encompassing α residues 338-358), truncated enzyme was attached to glutathione Sepharose and incubated with 8 ng CaMKKβ, 2 mM MgCl2, 200 μM ATP for 10 min, RT on a rotating wheel. Beads were washed extensively prior to elution and overnight TEV protease treatment to remove GST tags. Truncation products were further purified by anion exchange and size exclusion chromatography. ADP preparation and analysis. Chromatography was performed on an HP1100 (Agilent) HPLC system. ADP (Sigma, cat. #A2754) was dissolved in 10% buffer A (20 mM ammonium formate): 90% buffer B (80% acetonitrile, 20 mM ammonium formate) and purified on a 2.1 mm x 100 mm Luna HILIC column (Phenomenex, 30˚C). AMP and ADP were resolved by gradient elution (90-75% buffer B) at a flow rate of 0.6 ml/min and fractions containing pure ADP were collected. Purified ADP was dried under vacuum and resuspended in 50 mM Tris.HCl, pH 7.5. For analysis, nucleotides (3 nmol) were diluted in 5 volumes buffer A (100 mM KHPO4, pH 5.5, 5 mM tetrabutylammonium sulphate), injected onto a 2.1 mm x 50 mm Kinetex C18 column (Phenomenex) and resolved by gradient elution (0-100% buffer B (60 mM KHPO4, pH 5.5, 40% MeOH) at a flow rate of 0.6 ml/min and a column temperature of 65˚C. In both methods nucleotides were measured by absorbance at 260 nm using the HP1100 flow cell. Concentrations of all adenine nucleotide solutions were calculated using an extinction coefficient of 15.4 x 103 M-1 cm-1 at 260 nm, pH 7.0. Purified ADP was used for all experiments described and regularly checked for degradation during storage. Enzyme assays. AMPK phosphorylation assays were conducted as previously described (S1). Briefly, 100 ng dephosphorylated AMPK was incubated with 2 mM MgCl2, 200 μM ATP, 1.6 ng CaMKKβ ± ADP, AMP or IMP (200 μM unless stated) for 10 min at 32°C. 5 mM MgCl2 and stated ATP, ADP and AMP concentrations were used (29) to assess regulation by adenylate energy charge. Assays were either terminated by the addition of SDS sample buffer prior to immunoblotting for pThr172 and total amount of α-
1
subunit, or the reaction mixture was passed through a 5 kDa molecular weight cut-off centrifugal filter (Millipore) to remove protein prior to nucleotide analysis by HPLC. AMPK activity was determined by phosphorylation of the SAMS peptide by either basally phosphorylated COS7 cell-expressed AMPK or phosphorylated AMPK α1(1-315) kinase domain using 100 μM SAMS, 200 μM [γ-32P] ATP, 5 mM MgCl2 ± 200 μM AMP or ADP in a 25 μl reaction volume at 30 °C. For the linked CaMKKβmediated phosphorylation/AMPK activity assay, 400 ng dephosphorylated AMPK was phosphorylated by CaMKKβ ± 200 μM ADP for 10 min, after which 50 ng AMPK was removed, diluted 1:20 and immediately assayed for activity as described above, with final ADP concentration equalized to 10 μM in all SAMS peptide assays. CaMKKβ activity was determined by phosphorylation of the synthetic peptide substrate LKBtide (Millipore, LSNLYHQGKFLQTFCGSPLYRRR, residues 196-215 of human NUAK2 plus 3 additional Arg residues) using 50 μM peptide, 200 μM [γ-32P] ATP, 5 mM MgCl2 ± 0 to 500 μM ADP in a standard 20 μl volume assay at 30°C. For the dephosphorylation assay, 200 ng phosphorylated AMPK or 100 ng phosphorylated AMPK α1(1-392) fragment was incubated with 2 mM Mg2+ and 100 ng PP2c ± 200 μM ADP, AMP or IMP for 10 min at 32°C. Assays were terminated by the addition of SDS sample buffer prior to immunoblotting for pThr172 and total α-subunit. Statistical analysis. Data are presented as mean values ± SEM of at least three independent experiments. The unpaired two-tailed Student’s t-test was used for all comparisons.
2
Fig. S1
A
C
AMPK pThr172 α
α1β1γ1 α1 (1-392) CaMKKβ AMP ADP
pThr172 α -
+ -
+ + -
3
pThr172 fold increase (+/- nucleotide)
B
2
+AMP +ADP
1 0 0
+ +
100 200 300 400 500
pThr172 α ADP CaMKKβ - + + + + + + + +
Figure S1. ADP stimulation of Thr172 phosphorylation. (A) Nucleotide analysis. HPLC elution profiles of (black spectra) ADP pre- and post-purification by HILIC HPLC (arrow indicates contaminating AMP (6%) detected in commercially available ADP) and (grey spectra) nucleotide content of kinase reactions after incubation without (-protein) or with (+protein) AMPK (α1β1γ1) and CaMKKβ. Input for each nucleotide = 3 nmol. Shown are single representative spectra of three replicates. Nucleotide standards (3 nmol) - AMP, blue; ADP, green; ATP, red. Dotted lines signify elution peaks of respective nucleotides. (B) Immunoblots of single representative α1β1γ1 (upper) and α1(1-392) (lower) phosphorylation assays. (C) ADP dose response curve (solid line) for the activation of CaMKKβ-mediated phosphorylation of Thr172 at 120 mM NaCl. Error bars denote mean ± SEM of three independent experiments. Dashed line represents AMP dose response curve (S1). Immunoblot shown is a single representative ADP dose phosphorylation assay.
3
Specific activity (pmol-1.min-1.mg-1)
Fig. S2
basal +ADP mock
6
*
*
4
* ***
***
2
0
0
10
20
50 100 ADP (μM)
250
500
Figure S2. Inhibition of CaMKKβ activity by ADP. CaMKKβ activity was measured by phosphorylation of NUAK peptide substrate in the presence of 200 μM ATP and purified ADP in the range 0-500 μM. Equivalent dilutions of a mock ADP preparation, in which ADP was not added to the HILIC HPLC column, were also added to account for effects of formate carried-over during the ADP purification process. Error bars denote mean ± SEM of three independent experiments. Statistical analyses were done with Student’s t test; *P ≤ 0.05 and ***P ≤ 0.001 versus basal (0 μM ADP) activity.
4
Fig. S3
Nucleotide site: WT pThr172 α CamKKβ ADP
-
+ -
+ +
1
(2)
3
4
γD90A
βD224A
γD245A
γD317A
-
+ -
+ +
-
+ -
+ +
-
+ -
+ +
-
+ -
+ +
Figure S3. Contribution of individual γ1 nucleotide binding sites to AMPK regulation by ADP. Immunoblots are single representative experiments of data displayed in Fig. 2A. Vertical black line indicates separate immunoblot.
5
Fig. S4
B 0.8
pThr172 fold change (vs basal)
pThr172 increase vs untreated (arbitrary units)
A 0.6 0.4 0.2 0.0
2.0 1.5
basal +AMP +ADP
1.0 0.5
**
0.0
pThr172 α
un
l P P d t e a sa M A D a b +A + tre
Fig. S4. ADP activation of α-Thr172 phosphorylation is dependent on β-subunit myristoylation. (A) and (B) Error bars denote mean ± SEM of three to seven independent experiments. Statistical analyses were done with Student’s t test. Thr172 phosphorylation; PP2c-dephosphorylated, purified nonmyristoylated AMPK (α1β1(G2A)γ1) was phosphorylated by CaMKKβ ± AMP or ADP. Phosphorylation of Thr172 and total amount of α-subunit were measured by simultaneous immunoblot. (A) Absolute increase in pThr172 compared to untreated (non-CaMKKβ incubated) control. Immunoblot shown is a single representative experiment. (B) Fold change in pThr172 relative to basal (non-nucleotide incubated) phosphorylation of nonmyristoylated AMPK. **P < 0.007 versus basal phosphorylation.
6
Fig. S5
Residual pThr172 vs untreated (%)
100 80 60 40 20 0
pThr172 α
l P P d te asa AM AD a tre b + + n u
Figure S5. α1(1-392) pThr172 phosphatase protection. CaMKKβ-phosphorylated, E.coli-expressed α1(1-392) was incubated with PP2c ± AMP or ADP. Data represented as % residual pThr172 compared to untreated (non-PP2c incubated) control. Error bars denote mean ± SEM of three independent experiments. Immunoblot shown is a single representative experiment.
7
Fig S6
A pThr172 fold increase (vs basal)
**
2
Residual pThr172 vs untreated (%)
B 3
**
1 0
100
l ed asa MP IMP IMP t a A re b + + P/+ t M un +A
Fold activation
*
60 40 20 0
pThr172 α
pThr172 α
C
80
un
l P P d te a sa A M IM a + b + tre
D
2.5
****
2.0
V130
1.5
R299
1.0
R152
0.5 0.0
s ba
al
P P M IM A + +
L277
Site 1
Site 3
Figure S6. IMP has no detectable role in AMPK regulation. (A to C) Error bars denote mean ± SEM of three to seven independent experiments. Statistical analyses were done with Student’s t test. (A) Thr172 phosphorylation; PP2c-dephosphorylated, purified AMPK (α1β1γ1) was phosphorylated by CaMKKβ ± nucleotide combinations as indicated. 75 μM AMP was used as this concentration produces a half-maximal response, IMP was added at 200 μM. Data represented as fold increase in pThr172 relative to basal (non-AMP or IMP incubated) phosphorylation, **P < 0.01 versus basal phosphorylation. (B) Phosphatase protection; CaMKKβ-phosphorylated, purified AMPK (α1β1γ1) was incubated with PP2c ± IMP. Data represented as % residual pThr172 compared to untreated (non-PP2c incubated) controls, *P < 0.05 versus basal (non-IMP incubated) dephosphorylation. In (A) and (B) immunoblots shown are single representative experiments. (C) Direct allosteric activation; activity of purified AMPK (α1β1γ1) expressed in COS7 cells was measured by SAMS assay ± AMP or IMP. ****P < 0.0001 versus basal (non-AMP or IMP incubated) activity. (D) Hydrogen bonds in γ1 nucleotide sites 1 and 3 involving the N6 amine group of AMP.
8
References S1.
J. S. Oakhill et al., Proc. Natl. Acad. Sci. U.S.A. 107, 19237 (2010).
9
