Keith M. Gewain, James L. Occi, Forrest Foor and Douglas J. MacNeil. Merck Research Laboratories, Rahway. NJ, USA. Received by CR. Hutchinson:.
Gene, 119 (1992) 149-150 0 1992 Elsevier Science Publishers
GENE
B.V. All rights reserved.
149
0378-l 119/92/$05.00
06649
Vectors for generating nested deletions and facilitating subcloning G+C-rich DNA between Escherichia coli and Streptomyces sp.* (Recombinant
DNA;
shuttle vectors;
multiple
cloning
site; thiostrepton
resistance;
deletions)
Keith M. Gewain, James L. Occi, Forrest Foor and Douglas J. MacNeil Merck Research Laboratories, Rahway. NJ, USA Received
by CR.
Hutchinson:
10 February
1992; Revised/Accepted:
27 April/30
April; Received
at publishers:
4 June
1992
SUMMARY
New multiple cloning sites (MCS), which facilitate the subcloning of G+C-rich DNA, were added to pUC18, M13mp18, pVE616 (a pBR322-derived insertion vector), and the low-copy-number Streptomyces vector, pIJ922. The MCS in these vectors contain sites found infrequently in Streptomyces DNA, facilitating the exchange of subclones between the vectors. The MCS added to M13mp18 and pUC18 was also designed to generate nested deletions within subcloned fragments.
The pUC plasmids, and the Ml3 phages with the same MCS, are in widespread use as vectors. Their high copy number, and the ability to detect inserts on indicator plates by disrupting a-complementation of lad, have made them popular (for a review see Messing, 1991). We have reconstructed the MCS of pUC 18 and M 13mp 18 to make them more suitable for cloning G+C-rich DNA of streptomycetes. Plasmid pVE1163, derived from pUC18, and phage M13strep, derived from M13mp18, contain MCSl (Fig. 1). Inserts in these vectors can be detected on indicator plates, however, the intensity of the color with pVE1163 or M13strep is noticeably less than that observed in cells containing pUC18 or M13mp18.
Correspondence to; Mr. K.M.
Gewain,
Merck
Bldg. 8OY-235, P.O. Box 2000, Rahway, 594-5961; Fax (908) 594-5468. * On request,
the authors
the conclusions
reached
Research
NJ 07065,
will supply detailed
Laboratories,
USA.
experimental
Tel. (908) evidence for
in this Brief Note.
Abbreviations: bkz, /I-lactamase-encoding gene; bp, base pair(s); kb, kilobase or 1000 bp; MTase, methyltransferase; MCS, multiple cloning site(s); nt, nucleotide(s);
PolIk, Klenow
(large) fragment
polymerase I; Rep, plasmid replication functions; thiostrepton; tsr,gene encoding 23s RNA MTase tance.
of E. coli DNA
S., Streptomyces; Th, that confers Th resis-
Nested deletions of fragments subcloned in the BclI or BglII sites of MCSl can be made using exonuclease III (Henikoff, 1984) or Sau3AI. The latter is suitable with fragments lacking a BamHI (or BcZI) site. The plasmid is digested completely with BamHI (or BclI) and partially with Sau3AI. Linear molecules of the desired length are isolated from agarose gels, ligated and transformed into a suitable host. If necessary, full-length plasmids regenerated after ligation can be removed by Hind111 digestion before transformation. (Hind111 sites rarely occur in G+C-rich DNA). Two low-copy-number Streptomyces vectors have been modified by addition of MCS. Plasmid pVE2036 was derived from pVE6 16 by addition of MCS2 (Fig. 1). Plasmid pVE616 is a 4.2-kb vector derived from pBR322 which integrates by homologous recombination within a cloned fragment and is useful for complementation analysis and gene disruption experiments (MacNeil et al., 1992). Deletions from the BamHI (or BgZII) site to the Sau3AI sites of a fragment cloned into pVE2036 can also be made as described above for pVE1163 and M13strep. MCS3 contains eight unique sites for cloning into pVE1043, a derivative of the broad-host-range Streptomyces vector pIJ922 (Hopwood et al., 1985). Subclones into several sites of pVE1043 have been used in complementation analysis (Gewain et al., 1990).
I I
vVE1043
\
\
fvKX8DraP AaaF BeI1&III Hind111 SmaI KpnI XhoI SstI PstI NheI SphI BamHI EcoRI HpaI k&S:! Or@ Aser* HindIIl BamHI S&I SphI XhoI BgrrrPstI Nhe1 EC&I Hpa1 MCS3 EcoRI HpaI PstI NheI AseI HindIIIDraI BamHI
Fig. 1. Plasmid constructs and restriction sites in the MC% Plasmid DNA was prepared and manipulate according to published procedures (M~atis et al., 1982). Below the plasmid maps are the restriction enzyme sites in the MCS. The sites marked with an * are not unique in the vector but can be used to transfer inserts to pVE1043. Cloning sites located outside the MCS are also indicated on the maps. Plasmid pVEl163 and phage M13strep were constructed by cleaving pUC18 and M13mp18 DNA with &oRI +HindIII, followed by ligation to the linker containing MCSl: 5’-AATTGCTTTAAATTAATGATCAGATCTAAGCTTCCCG~TACCTCGAGCTCTGCAGGCTAGCATGCGGATCCGAATTCGTTAAC CGAAATTTAATTACTAGTCTAGATTCGAAGGGCCCATGGAGCTCGAGACGACCGATCGTACGCCTAGGCTTAAGCAATTGTCGA Since M13strep has a BgZIl site outside the MCS, M13strep has twelve unique cloning sites in MCSl and pVE1163 has thirteen unique cloning sites in MCSI. Oligodeoxynucleotides were prepared on a ABI Model 394 according to the manufacturer’s protocols. PIasmid pVE2036 was derived from pVE616 (MacNeil et al., 1992) by replacing the 400-bp EcoRI-PstI fragment with a linker containing MCS2 which has sites for twelve restriction enzymes: 5’-AATTTAAATTAATAAGCTTGGATCCGAGCTCGCATGCTCGAGATCTGCAGCTAGCGAATTCGTTAACGTGCA ATTTAATTATTCGAACCTAGGCTCGAGCGTACGAGCTCTAGACGTCGATCGCTTAAGCAATTGC The resulting vector, pVEl053, contains two Hind111 sites, one of which was eliminated by partial digestion of pVE1053 with HindIII, followed by filling-in the ends with PolIk. The full-size linear DNA was gel purified, ligated, and cleaved to completion with HindIIf, gel purified and ligated to yield pVE2036 with a single Hind111 site in the MCS. A derivative of pIJ922 without a PstI site, pVE1023, was isolated after digesting pIJ922 DNA with PstI, treating the DNA with PolIk to remove the 3’ overhangs, and ligating the blunt ends. Plasmid pVE1043 was constructed by replacing the 0.59-kb EcoRI-BarnHI fragment of pVE1023 with a linker containing MCS3: 5’-AATTCGTTAACTGCAGCTAGCATTAATAAGCTTTAAAG GCAATTGACGTCGATC~TAATTATTCGAAATTTCCTAG The nt sequences in MCSl and MC%? were confirmed by sequencing. The restriction sites in MCS3 were confirmed by restriction enzymedigestion of pVE1043 DNA. The GenBank accession Nos. for MCS 1, MCS2 and MCS3 are M88476, M88477 and M88478, respectively.
The MCS of the four vectors in Fig. 1 contain cleavage sites for Drul(, AseI, HiizdIIf, H&I and Chef which rarely cleave Streptamyces DNA [zero to three sites occur in 83 kb of sequenced Streptomyces DNA (GenBank release 69)]. These sites facilitate the transfer of subclones among the E. coli vectors, or to pVE1043, by directional cloning. A combination of H&dIII and HpaI, or Hind111 and NkeI, can be used to move subclones among the three E. co& vectors or to pVE1043. DruI or AxeI may be substituted for Hind111 to transfer subclones to pVE1043. We have repeatedly used directional cloning to transfer subclones from the E. coli vectors to pVEl.043 for subsequent functional analysis of the fr~ent(s) (results to be pub~sh~ elsewhere).
REFERENCES Gewain, K.M., Paress, P.S., MacNeil, D.J., Ruby, CL., Streicher, S.L. and MacNeil, T Cloning genes from Strepromyces a~~jiil~ for avermectin biosynthesis and methods for their use. (1990) Europ. Patent Appl. 0391594. Henikoff, S.: Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28 (1984) 35 l-359. Hopwood, D.A., Bibb, M.J., Chater, K.F., Kieser, T., Bruton, C.J., Kieser, H.M., Lydiate, D.J., Smith, C.P., Ward, J.M. and Schrempf. H.: Genetic Manipulation of Streptomyces: A Laboratory Manual. The John Innes Foundation, Norwich, UK, 1985. MacNeil, D.J., Gewain, K.M., Ruby, CL., Dezeny, G., Gibbons, P.H. and MacNeil, T.: Analysis of Streptomyces avemitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111 (1992) 61-68. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Messing, J.: Cloning in Ml3 phage or how to use biology at its best. Gene 100 (1991) 3-12.
