DEVELOPMENTAL DYNAMICS 221:231–237 (2001)
BRIEF COMMUNICATION
Zebrafish E-Cadherin: Expression During Early Embryogenesis and Regulation During Brain Development SHERRY G. BABB,1 JESSICA BARNETT,1 ANDREW L. DOEDENS,1 NICOLE COBB,1 QIN LIU,2 BARBARA C. SORKIN,3 PAMELA C. YELICK,3 PAMELA A. RAYMOND,2 AND JAMES A. MARRS1* 1 Department of Medicine, Indiana University Medical Center, Indianapolis, Indiana 2 Department of Cell and Developmental Biology, University of Michigan, Ann Arbor, Michigan 3 The Forsyth Institute, Boston, Massachusetts
ABSTRACT: Zebrafish E-cadherin (cdh1) cell adhesion molecule cDNAs were cloned. We investigated spatial and temporal expression of cdh1 during early embryogenesis. Expression was observed in blastomeres, the anterior mesoderm during gastrulation, and developing epithelial structures. In the developing nervous system, cdh1 was detected at the pharyngula stage (24 hpf) in the midbrain-hindbrain boundary (MHB). Developmental regulation of MHB formation involves wnt1 and pax2.1. wnt1 expression preceded cdh1 expression during MHB formation, and cdh1 expression in the MHB was dependent on normal development of this structure. © 2001 Wiley-Liss, Inc.
Key words: cadherin; zebrafish, Danio rerio; neurogenesis; midbrain; hindbrain; wnt1, pax2.1, cyclops INTRODUCTION Cadherins are homotypic cell-cell adhesion molecules that regulate morphogenesis and differentiation (Marrs and Nelson, 1996). E-cadherin is essential for early embryogenesis in mouse (Larue et al., 1994; Riethmacher et al., 1995). Detailed analysis of E-cadherin expression in embryogenesis was described for mouse, chick, and Xenopus (Broders et al., 1993; Choi and Gumbiner, 1989; Hirai et al., 1989a,b; Levi et al., 1991; Shimamura and Takeichi, 1992; Shimamura et al., 1994; Takeichi, 1988; Thiery et al., 1984). E-cadherin expression in the ectoderm is downregulated during neurulation (Takeichi, 1988). However, discrete regions of E-cadherin expression are activated in the developing and adult brain (Choi and Gumbiner, 1989; Shimamura and Takeichi, 1992; Shimamura et al., 1994; Thiery et al., 1984). The functional significance of neural E-cadherin expression is unclear. Cadherin expression patterns implicate these molecules in regionalization processes during nervous system development (Redies, 1997; Redies and Takeichi, 1996; Yagi © 2001 WILEY-LISS, INC.
and Takeichi, 2000). A combinatorial code has been proposed that describes how differential cell– cell adhesion segregates neuron groups into functional circuits (Redies and Takeichi, 1996). In the mouse and chick but not in Xenopus, E-cadherin is expressed in the MHB (Choi and Gumbiner, 1989; Shimamura and Takeichi, 1992; Shimamura et al., 1994; Thiery et al., 1984). In zebrafish, mutations in the Pax2.1 gene (no isthmus or noi) and in the Fgf8 gene (acerebellar or ace) disrupt MHB development (Brand et al., 1996). When formed, the MHB displays organizer activities (Marin and Puelles, 1994; Martinez et al., 1991), generating signals that induce the development of cerebellum, tegmentum, and optic tectum. wnt1 mutations in mouse disrupt MHB development (McMahon and Bradley, 1990; McMahon et al., 1992; Thomas and Capecchi, 1990; Thomas et al., 1991), and wnt1 distributions suggest a similar role in MHB formation in zebrafish (Kelly and Moon, 1995), but mutations in the zebrafish wnt1 gene have not been identified. wnt1 mutations in mice expand E-cadherin and reduce ␣N-catenin expression domains in the developing diencephalon and mesencephalon (Shimamura et al., 1994). E-cadherin expression domains were reduced in wnt1 mutant mice in a limited domain in the ventral midbrain (Shimamura et al., 1994). In this study, zebrafish E-cadherin cDNAs were cloned and developmental expression patterns were characterized. At the pharyngula stage (24 hpf), cdh1 expression was found in the brain, including the MHB. Disrupting developmental signaling that controls MHB formation also blocked cdh1 expression in this brain region.
Grant sponsor: National Institute of Health; Grant numbers: EY11365, EY04318, EY06892; Grant sponsor: Prevent Blindness America/Fight for Sight. *Correspondence to: James A. Marrs, Department of Medicine, Indiana University Medical Center, Fesler Hall 115, 1120 South Drive, Indianapolis, IN 46202-5116. E-mail:
[email protected] Received 19 September 2000; Accepted 6 February 2001 Published online 17 April 2001
232
BABB ET AL.
Fig. 1. Zebrafish E-cadherin cDNA cloning and sequences. A: Schematic diagram of cDNA clones identified by library screening (clones 26 and 28) and 5⬘-RACE technique. These three clones provide a contiguous sequence of 3,340 base pairs (AF364811). B: RT-PCR using cdh1 primers to probe oocyte total RNA. cdh1 signal was detected in the oocyte RNA sample (oocyte lane), but not wnt1. Positive control: 16 hpf RNA was probed by RT-PCR using cdh1 and wnt1 primers (16 hpf lanes).
RESULTS Zebrafish E-Cadherin cDNA Cloning and Expression in Early Development To identify cadherins expressed during early neural development, a 15–19 hpf embryo cDNA library (generously provided by Dr. Bruce Appel) was screened using a pan-cadherin antibody (Marrs et al., 1993). Two cDNAs (clones 26 and 28) were recovered with significant sequence identity to E-cadherins from other species. Complete sequencing showed that these cDNAs overlap, encoding most of the cadherin, except the N-terminus. 5⬘-RACE was used to recover the remaining coding sequences for this cadherin (Fig. 1A). Sequence comparison, phylogenetic analysis (W.J. Gallin and J.A. Marrs, unpublished data) and developmental expression pattern (see below) indicate that we identified the zebrafish E-cadherin orthologue (cdh1 gene designation). Radiation hybrid analysis using the LN54 panel (Hukriede et al., 1999) localized cdh1 gene to linkage group 7 (lod score 13.1; 39.01 cR from Z20576). cdh1 expression was detected in Northern blots of RNA from cleavage stage embryos and expression was maintained throughout development (data not shown). To determine whether zebrafish E-cadherin is a maternal message, total oocyte RNA was probed by RT-PCR using cdh1 specific primers. cdh1 signal was strongly detected (Fig. 1B). wnt1 is not maternally loaded and was not detected in oocyte RNA (Fig. 1B). As a positive
Fig. 2. cdh1 expression in zebrafish embryos at epiboly, gastrulation, and somite stages. Whole mount in situ hybridization was performed using cdh1 antisense probes. A: At epiboly stage (5.5 hpf), expression was uniform in all blastomeres. B: At shield stage (6 hpf), cdh1 expression was detected in nearly all blastomeres, but we consistently observed a concentration of cdh1 message in the shield (arrow). C,D: At 90% epiboly (9 hpf), cdh1 expression was detected in all cells, but was concentrated along the dorsal midline (arrowheads in C). Strong expression was found in the most anterior mesendoderm (arrowhead in D). C and D are the same embryo rotated in D to show the dorsal pole. In C and D, anterior is right, and dorsal is facing the reader. E,F: cdh1 expression at the 1-somite stage embryo (10.5 hpf) was strong in the adaxial mesoderm, particularly in the anterior embryo where it formed a V-shaped pattern (arrowheads in E and F) directly posterior to the forming polster. In E and F, the same embryo is shown, rotated to show a different perspective. G,H: cdh1 expression in 16 hpf embryos was strongly detected in the anterior mesendoderm (arrowheads in G), the otic placode (arrow in G and H), and the forming nephric duct (arrowheads in H). In G and H, the same embryo is shown, rotated to a different perspective. Scale bar ⫽ 200 m.
ZEBRAFISH E-CADHERIN EXPRESSION IN EMBRYOGENESIS
control, cdh1 and wnt1 were detected in 16 hpf RNA (Fig. 1B). All blastomeres expressed high levels of cdh1 (Fig. 2A,B), until gastrulation began. A subtle concentration of cdh1 expression was consistently detected in the shield (Fig. 2B), a region equivalent to the organizer in amphibian embryos and the node in avian and mammalian embryos. As gastrulation proceeded, cdh1 expression was detected at the midline and in the anterior mesendoderm (Fig. 2C,D). At 10.5 hpf, E-cadherin message was found in the forming polster (a mesendodermal derivative), concentrated in the anterior adaxial mesendoderm in a V-shaped pattern (Fig. 2E,F). In 16 hpf embryos, cdh1 expression was seen in the anterior mesendoderm and in the polster, the most anterior portion of the prechordal plate (Fig. 2G). At this stage, cdh1 message was also detected in the forming otic placode (Fig. 2G,H) and the forming nephric duct (Fig. 2H). Staining was not observed in the developing nervous system at this stage. The pharyngula stage in zebrafish begins at 24 hpf and represents the phylotypic stage, where the body plan has been laid down and the brain has been segmented into the five main divisions (telencephalon, diencephalon, mesencephalon, metencephalon, and myelencephalon). In 24 hpf embryos, cryostat sections and whole mount in situ hybridization showed that cdh1 was expressed in the ectoderm, developing pronephros, gut, otic vesicle, and developing brain (Fig. 3B– E). Expression was found in the telencephalon, diencephalon, and rhombencephalon and was prominent at the MHB (Fig. 3A–C), a structure that acts as an organizer for development of the adjacent optic tectum, tegmentum, and cerebellum (Martinez et al., 1991; Marin and Puelles, 1994; Brand et al., 1996). cdh1 Expression Is Controlled by MHB Formation and Ventral Midline Signaling Pathways A signaling pathway that includes Wnt1, Pax2.1, and Fgf8 controls zebrafish MHB formation (Brand et
Fig. 3. cdh1 expression in pharygula stage embryos. A–D: Whole mount in situ hybridization was performed on 24 hpf embryos using cdh1 antisense probes. Expression was noted in the brain (A), otic vesicle (B), and pronephros (D) at this stage. A, B, and C are the same embryo; focus was on a sagittal plane in A, on a parasagittal plane in B, and viewed dorsally in C. Strong cdh1 expression was detected in the MHB (arrow in A, B, and C), in the midbrain (optic tectum) and hindbrain. Expression was also found in the forebrain, particularly in the epiphysis region (arrowhead in A and C). cdh1 expression in the otic vesicle was concentrated in the dorsal half of this structure (B and C). cdh1 expression was strongly detected in the pronephros in 24 hpf embryos (arrowhead in D). In D, caudal is down, and dorsal is to the left. E: Cross-section of a 24 hpf embryo in the trunk region, at approximately the level of the arrowhead in D. In situ hybridization on this section showed strong staining in the ectoderm, gut epithelium (arrow), and the paired pronephros tubules (arrowheads). c, cerebellum; eye, optic vesicle; n, notocord; ot, optic tectum; ov, otic vesicle; sc, spinal cord; tel, telencephalon. Scale bars ⫽ (A–C) 200 m; (D) 200 m; and (E) 50 m.
233
al., 1996; Kelly and Moon, 1995). In gastrulation stage embryos, wnt1 and pax2.1 expression codistributes in a chevron-shaped domain that represents the presump-
234
BABB ET AL.
Fig. 4. Comparison of cdh1 and wnt1 expression during early embryogenesis. In 10.5 hpf embryos, cdh1 expression was noted in adaxial mesoderm, especially in the anterior of the embryo (arrow in A). B: wnt1 expression at 10.5 hpf was localized to a chevron-shaped band that represents the presumptive MHB, as previously described (Kelly and Moon, 1995). Arrows in A and B mark the same anterior position. In 22 hpf embryos, cdh1 expression was activated in the hindbrain brain but
was not detected in the MHB (arrow in C); wnt1 expression (D) was found in the hindbrain and in the MHB and expression extended rostrally into the midbrain. E: At 24 hpf, cdh1 expression was first detected in the MHB (arrow in E), and cdh1 expression extended into the rostral midbrain. This cdh1 distribution was very similar to the wnt1 expression pattern at the same stage (F). Scale bars ⫽ 200 m.
tive MHB (Kelly and Moon, 1995) (Fig. 4B). At this early time, cdh1 expression was not detected in this domain (Fig. 4A). At 22 hpf, cdh1 expression was detected in the hindbrain, but no cdh1 signal was detected at the MHB (Fig. 4E). At 24 hpf, cdh1 and wnt1 were coexpressed in the developing MHB (Fig. 4G,H). To examine the effects of disrupting ventral midline signaling and pax2.1 expression on E-cadherin expression in the developing nervous system, cyclops mutant embryos (Hatta et al., 1991) were studied. In cyclops mutant embryos, ventral midline signaling is defective, producing a graded effect on ventral neural induction that is greatest in the forebrain, more moderate in the midbrain, and least in the hindbrain (Hatta et al., 1994). In the forebrain ventral midline of cyclops mutant embryos, the optic stalk is reduced, and development of retinal tissue expands along the ventral margin of the diencephalon, giving rise to an enlarged, single, fused eye field (Hatta et al., 1991, 1994). In cyclops mutant embryos, pax2.1 expression is decreased and pax6.1 expression is expanded in the eye/ optic stalk and throughout the neural axis (Macdonald et al., 1995). In the most severe mutant phenotype, pax2.1 message was not detected in the MHB, and these embryos showed little MHB formation (Fig. 5F). In severe cyclops mutant embryos, cdh1 was also not detectable in the MHB (Fig. 5E). Forebrain cdh1 staining was lost in cyclops mutant embryos displaying both moderate and severe phenotypes, but hindbrain cdh1 staining was maintained (Fig. 5C,E). In embryos dis-
playing a less severe cyclops mutant phenotype, pax2.1 staining was reduced but detectable in the MHB (Fig. 5D), and cdh1 staining in the MHB was correspondingly reduced (Fig. 5C). DISCUSSION cdh1 Expression During Early Embryogenesis Indicates a Role in Gastrulation, Morphogenetic Movements, and the Formation of Signaling Centers cdh1 message was concentrated in the shield, maintained in the anterior mesendoderm during gastrulation and concentrated in a V-shaped, anterior adaxial region. Previous studies have implicated cadherin function in promoting cell migrations and in maintaining associations between cells during morphogenetic movements that accompany gastrulation (Levine et al., 1994; Yamamoto et al., 1998). cdh1 expression in anterior mesendodermal cells during gastrulation indicates a similar role of regulating cell movements and maintaining adhesion among this cell population. These anterior mesendodermal cells are implicated in neural induction processes and organizing the anteriorposterior axis (Bally-Cuif and Boncinelli, 1997). Ecadherin adhesion may sequester this cell population during these signaling events. cdh1 was detectable in the developing brain, notably in the MHB, a signaling center that induces the formation of the optic tectum and tegmentum of the mesencephalon and the cerebellum of the metencephalon
ZEBRAFISH E-CADHERIN EXPRESSION IN EMBRYOGENESIS
235
Fig. 5. Effects of cyclops mutation on cdh1 expression in the brain of pharygula stage embryos. cdh1 and pax2.1 expression was compared between wildtype (A,B) and cyclops mutant (C–F) embryos. C,D: Arrows show reduced cdh1 and pax2.1 expression in embryos displaying a moderate cyclops mutant phenotype. Lack of expression of cdh1 and
reduced pax2.1 (arrows) at the MHB was observed in cyclops embryos with a severe phenotype. cdh1 and pax2.1 expression was not detectable in the MHB (E,F). In this figure, anterior is to the right, and dorsal is up. Scale bar ⫽ 200 m.
(Brand et al., 1996; Joyner, 1996; Marin and Puelles, 1994; Martinez et al., 1991). E-cadherin adhesion may help maintain the integrity of this organizing center.
tures (Hatta et al., 1994). However, cdh1 expression was noted in the epiphysis, a dorsal structure, and cdh1 expression in this domain was significantly affected in cyclops mutant embryos.
Regulation of cdh1 During MHB Formation and by cyclops Zebrafish cdh1 was expressed in the MHB at the pharyngula stage. Temporal analysis of wnt1 and cdh1 expression showed that cdh1 expression was delayed by over 12 hr from the onset of wnt1 (and pax2.1) expression (Kelly and Moon, 1995). Therefore, any actions of wnt1 and pax2.1 that lead to the activation of cdh1 neural expression must be indirect or have a significant temporal delay. Analysis of cyclops mutant embryos showed that cdh1 expression in the MHB correlated with pax2.1 expression and MHB differentiation. In the forebrain, cdh1 expression was severely downregulated in embryos displaying moderate and severe cyclops mutant phenotypes. Previous analysis of cyclops mutants suggested that effects were limited to ventral brain struc-
EXPERIMENTAL PROCEDURES Animals Adult zebrafish were obtained from a local pet store and maintained under standard laboratory conditions (Westerfield, 1995). Developmental ages were given as hours postfertilization (hpf). cyclops (cyc) mutant embryos were obtained by breeding adult zebrafish heterozygous for cyclopsb16 (provided to Q.L. and P.A.R. by Dr. John Kuwada with permission of the University of Oregon Zebrafish Mutant Stock Center). Library Screening, DNA Sequencing, and Radiation Hybrid Analysis A 15 to 19 hpf zebrafish embryo cDNA expression library in lZAP (generously provided by Dr. Bruce Appel, Vanderbilt University) was screened with anti-E-
236
BABB ET AL.
cadherin cytoplasmic domain library antibody B.5 (Marrs et al., 1993) as described (Liu et al., 1999). All clones were fully sequenced within the Biochemistry Biotechnology Facility at Indiana University School of Medicine. Sequence analysis was performed using Vector NTI Suite (InforMax, North Bethesda, MD) and Basic Local Search Alignment Tool (BLAST) (Altschul et al., 1990) at the National Center for Biotechnology Information web site (http://www.ncbi.nlm.nih.gov/ BLAST/). Radiation hybrid analysis was performed on the LN54 panel (Hukriede et al., 1999) using primers ctgcacctcagtacagacctcg and ctttccactgagccatcgcaac. 5ⴕ-Rapid Amplification of cDNA Ends (5ⴕ-RACE) Total RNA was isolated from 24 hpf embryos using Trizol Reagent (Life Technologies Inc., Rockville, MD) using a kit (Roche Molecular Biochemicals, Indianapolis, IN) and primers: GSP1 (160 nM) (ttaccagtgttcctgtgcca) for first strand synthesis; GSP2 (ggaataaactcaggtggttc) for PCR; and GSP2 (tgaccaggctgttctcgtg) for nested PCR. A band of approximately 1.7 kb was excised, purified with Geneclean III (Bio 101, Vista, CA), and this fragment was cloned into pCR2.1 vector using the Original TA Cloning Kit (Invitrogen, Carlsbad, CA). Northern Blotting and Analysis of Maternal RNA by RT-PCR Total RNA from embryos was isolated using Trizol Reagent (Life Technologies Inc.). Northern blotting was performed as described (Ausubel et al., 1995). For RT-PCR, first strand cDNA was prepared from 2 g total RNA using SuperScript II reverse transcriptase (Life Technologies, Inc.) and a cdh1 specific antisense primer (cccttgtcaccagcaatgat) or wnt1 specific antisense primer (cctgctccattcgagtcttg). In negative controls, reverse transcriptase was excluded. Samples were then RNase treated (Sigma), purified using the High Pure PCR Kit (Roche Molecular Biochemicals), and amplified by 35 cycles of PCR using cdh1 specific primers (ccaagatccaccatctccaa and cccttgtcaccagcaatgat) or wnt1 specific primers (actgtcgcatcagagatgca and cctgctccattcgagtcttg). Probe Synthesis and In Situ Hybridization Digoxigenin-labeled or fluorescein-labeled riboprobes were synthesized from cDNA as run-off transcripts from linearized templates using the Genius System DIG RNA Labeling Kit (Roche) or the Genius System DIG RNA Labeling Kit and fluorescein RNA Labeling Mix (Roche). Template cDNA of cdh1 clone 26 in plasmid BlueScript was linearized with EcoRI and transcribed with T7 RNA polymerase to generate antisense probe, or linearized with XhoI and then transcribed with T3 RNA polymerase to generate sense probe. wnt1 cDNA in plasmid pGEM1 (provided by Dr. Randall Moon, Howard Hughes Medical Institute, University of Washington) was linearized with EcoRI and transcribed with SP6 RNA polymerase to generate an-
tisense probe, or linearized with HindIII and transcribed with T7 RNA polymerase to generate sense probe. Full-length zebrafish pax2.1 cDNA was obtained by RT-PCR, and subcloned into pCRII-TOPO (Invitrogen, Carlsbad, CA). HindIII was used to linearize the pax2.1 plasmid and T7 polymerase was used for the transcription of antisense probe. In situ hybridization of wholemount and thin sectioned zebrafish embryos was then performed as described (Liu et al., 1999). Images were digitally acquired with a color SPOT camera (Diagnostic Instruments Inc, Sterling Heights, MI) mounted on either a Leica MZ12 dissecting stereomicroscope (Leica Microsystems, Inc., Deerfield IL) or a Nikon Diaphot equipped with DIC optics (Nikon, Inc., Melville, NY). ACKNOWLEDGMENTS The authors thank Dr. Bruce Appel (Vanderbilt University) for providing the cDNA library, and we thank Dr. Randall Moon (Howard Hughes Medical Institute, University of Washington) for providing wnt1 cDNA. We also thank Dr. John Kuwada for cyclops mutant strain. This work was supported by National Institute of Health grants to James Marrs (EY11365) and Pam Raymond (EY04318). Sherry Babb was supported by a postdoctoral fellowship from Prevent Blindness America/Fight For Sight. Qin Liu was supported by a NRSA award (EY06892) from the National Institute of Health. REFERENCES Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403– 410. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. 1995. Current protocols in molecular biology. New York, NY: John Wiley and Sons, Inc. Bally-Cuif L, Boncinelli E. 1997. Transcription factors and head formation in vertebrates. Bioessays 19:127–135. Brand M, Heisenberg CP, Jiang YJ, Beuchle D, Lun K, Furutani-Seiki M, Granato M, Haffter P, Hammerschmidt M, Kane DA, Kelsh RN, Mullins MC, Odenthal J, van Eeden FJ, Nusslein-Volhard C. 1996. Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development 123:179 –190. Broders F, Girault JM, Simonneau L, Suzuki S, Thiery JP. 1993. Sequence and distribution of Xenopus laevis E-cadherin transcripts. Cell Adhes Commun 1:265–277. Choi YS, Gumbiner B. 1989. Expression of cell adhesion molecule E-cadherin in Xenopus embryos begins at gastrulation and predominates in the ectoderm. J Cell Biol 108:2449 –2458. Hatta K, Kimmel CB, Ho RK, Walker C. 1991. The cyclops mutation blocks specification of the floor plate of the zebrafish central nervous system. Nature 350:339 –341. Hatta K, Puschel AW, Kimmel CB. 1994. Midline signaling in the primordium of the zebrafish anterior central nervous system. Proc Natl Acad Sci USA 91:2061–2065. Hirai Y, Nose A, Kobayashi S, Takeichi M. 1989a. Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. I. Lung epithelial morphogenesis. Development 105:263–270. Hirai Y, Nose A, Kobayashi S, Takeichi M. 1989b. Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. II. Skin morphogenesis. Development 105:271–277. Hukriede NA, Joly L, Tsang M, Miles J, Tellis P, Epstein JA, Barbazuk WB, Li FN, Paw B, Postlethwait JH, Hudson TJ, Zon LI, McPherson JD, Chevrette M, Dawid IB, Johnson SL, Ekker M.
ZEBRAFISH E-CADHERIN EXPRESSION IN EMBRYOGENESIS 1999. Radiation hybrid mapping of the zebrafish genome. Proc Natl Acad Sci USA 96:9745–9750. Joyner AL. 1996. Engrailed, Wnt and Pax genes regulate midbrainhindbrain development. Trends Genet 12:15–20. Kelly GM, Moon RT. 1995. Involvement of wnt1 and pax2 in the formation of the midbrain-hindbrain boundary in the zebrafish gastrula. Dev Genet 17:129 –140. Larue L, Ohsugi M, Hirchenhain J, Kemler R. 1994. E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci USA 91:8263– 8267. Levi G, Gumbiner B, Thiery JP. 1991. The distribution of E-cadherin during Xenopus laevis development. Development 111:159 –169. Levine E, Lee CH, Kintner C, Gumbiner BM. 1994. Selective disruption of E-cadherin function in early Xenopus embryos by a dominant negative mutant. Development 120:901–909. Liu Q, Sanborn KL, Cobb N, Raymond PA, Marrs JA. 1999. R-cadherin expression in the developing and adult zebrafish visual system. J Comp Neurol 410:303–319. Macdonald R, Barth KA, Xu Q, Holder N, Mikkola I, Wilson SW. 1995. Midline signalling is required for Pax gene regulation and patterning of the eyes. Development 121:3267–3278. Marin F, Puelles L. 1994. Patterning of the embryonic avian midbrain after experimental inversions: a polarizing activity from the isthmus. Dev Biol 163:19 –37. Marrs JA, Nelson WJ. 1996. Cadherin cell adhesion molecules in differentiation and embryogenesis. Int Rev Cytol 165:159 –205. Marrs JA, Napolitano EW, Murphy-Erdosh C, Mays RW, Reichardt LF, Nelson WJ. 1993. Distinguishing roles of the membrane-cytoskeleton and cadherin mediated cell-cell adhesion in generating different Na, K-ATPase distributions in polarized epithelia. J Cell Biol 123:149 –164. Martinez S, Wassef M, Alvarado-Mallart RM. 1991. Induction of a mesencephalic phenotype in the 2-day-old chick prosencephalon is preceded by the early expression of the homeobox gene en. Neuron 6:971–981. McMahon AP, Bradley A. 1990. The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62:1073–1085.
237
McMahon AP, Joyner AL, Bradley A, McMahon JA. 1992. The midbrain-hindbrain phenotype of Wnt-1-/Wnt-1- mice results from stepwise deletion of engrailed-expressing cells by 9.5 days postcoitum. Cell 69:581–595. Redies C. 1997. Cadherins and the formation of neural circuitry in the vertebrate CNS. Cell Tissue Res 290:405– 413. Redies C, Takeichi M. 1996. Cadherins in the developing central nervous system: an adhesive code for segmental and functional subdivisions. Dev Biol 180:413– 423. Riethmacher D, Brinkmann V, Birchmeier C. 1995. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development. Proc Natl Acad Sci USA 92:855– 859. Shimamura K, Hirano S, McMahon AP, Takeichi M. 1994. Wnt-1dependent regulation of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain. Development 120:2225– 2234. Shimamura K, Takeichi M. 1992. Local and transient expression of E-cadherin involved in mouse embryonic brain morphogenesis. Development 116:1011–1019. Takeichi M. 1988. The cadherins: cell-cell adhesion molecules controlling animal morphogenesis. Development 102:639 – 655. Thiery JP, Delouvee A, Gallin WJ, Cunningham BA, Edelman GM. 1984. Ontogenetic expression of cell adhesion molecules: L-CAM is found in epithelia derived from the three primary germ layers. Dev Biol 102:61–78. Thomas KR, Capecchi MR. 1990. Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346:847– 850. Thomas KR, Musci TS, Neumann PE, Capecchi MR. 1991. Swaying is a mutant allele of the proto-oncogene Wnt-1. Cell 67:969 –976. Westerfield M. 1995. The Zebrafish Book. Eugene OR: University of Oregon Press. Yagi T, Takeichi M. 2000. Cadherin superfamily genes: functions, genomic organization, and neurologic diversity. Genes Dev 14:1169 –1180. Yamamoto A, Amacher SL, Kim SH, Geissert D, Kimmel CB, De Robertis EM. 1998. Zebrafish paraxial protocadherin is a downstream target of spadetail involved in morphogenesis of gastrula mesoderm. Development 125:3389 –3397.
