An improved method for achieving high-quality RNA for ... - CiteSeerX

Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

Contents lists available at SciVerse ScienceDirect

Journal of Experimental Marine Biology and Ecology journal homepage: www.elsevier.com/locate/jembe

An improved method for achieving high-quality RNA for copepod transcriptomic studies Huan Zhang a, b,⁎, Michael Finiguerra a, Hans G. Dam a, Yousong Huang b, Donghui Xu b, Guangxing Liu b, Senjie Lin a a b

Department of Marine Sciences, University of Connecticut, Groton, CT 06340, USA Department of Environmental Science, Ocean University of China, Qingdao, Shandong 266100, China

a r t i c l e

i n f o

Article history: Received 27 April 2013 Accepted 29 April 2013 Available online xxxx Keywords: Acartia hudsonica cDNA Copepods RNA isolation Sodium channel Transcriptomics

a b s t r a c t An efficient RNA-extraction method is crucial for transcriptomic studies of ecologically important organisms like copepods. In this study, we used the copepod Acartia hudsonica as a test species to evaluate existing methods, and formulated several improved protocols to consistently and efficiently isolate high-quality RNA from both pooled and individual copepod samples. Our protocols recommend copepod preservation in a phenol/guanidine thiocyanate reagent, followed by bead-beating or micropestle homogenization. To obtain high-quality RNA from pooled samples, one initial chloroform extraction followed by multiple phenol/chloroform extractions are needed before the raw RNA samples are further purified with the Qiagen RNeasy Mini Kit. When analyzing individual samples, one chloroform extraction followed by purification using the Zymo Research Direct-zol™ MiniPrep Kit gives the best results. Using these protocols, we isolated RNA from pooled and individual A. hudsonica samples with consistent recovery rate (individual samples: 95 ± 12 ng/male; 272 ± 57 ng/female). The cDNAs synthesized using these RNAs were proven to be of high quality by successful amplification of transcripts including the >7 kb alpha subunit of the voltage-gated sodium channel gene (SCG). For individual A. hudsonica samples, our protocols yielded significantly higher success rates (95%, n = 456) in reverse transcription quantitative PCR of SCG compared to existing methods (0–85%, n = 150). Applications of these protocols to nine other copepod species from seven families have led us to achieve high-quality RNAs and cDNAs from pooled and/ or individual samples. As a result of testing the protocols, we obtained cDNA sequences of various genes in ten copepod species, some of which are the first record in copepods. Our protocols can easily be adopted by laboratories to facilitate molecular work on copepods. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Copepods are the most abundant multicellular animals on the planet (Humes, 1994) and arguably the most successful in the marine ecosystem (Kiørboe, 2011). They are conventionally considered the key linkage between primary production and higher trophic levels, such as between diatom-rich phytoplankton blooms and fish in coastal waters (Miller, 2004; Runge, 1988). Furthermore, through their processes of ingestion, respiration, excretion, and egestion, copepods constitute an important component of the biological pump (Dam et al., 1995; Longhurst and Harrison, 1988). A major challenge to researchers is to understand and predict how the oceanic biota reacts to environmental change, both at ontogenic

Abbreviations: Na channel, sodium channel; SCG, voltage-gated sodium channel gene; RT-PCR, reverse transcription polymerase chain reaction; qPCR, quantitative PCR. ⁎ Corresponding author at: Department of Marine Sciences, University of Connecticut, Groton, CT 06340, USA. Tel.: +1 860 405 9237; fax: +1 860 405 9153. E-mail address: [email protected] (H. Zhang). 0022-0981/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jembe.2013.04.021

and longer time scales (Dam, 2013). With the rapid advancement of molecular techniques, the possibility now exists to link performance at the individual and molecular levels, to thus gain insight into the nature of adaptive responses to environmental change. Yet, despite their global dominance and demonstrated ecological importance, much remains to be learned regarding molecular pathways in copepods (Bron et al., 2011). To better understand the molecular pathways that regulate life history and physiological functions of copepods, it is crucial to analyze gene expression patterns under different environmental conditions (Lauritano et al., 2012b). Consequently, the number of RNA-based studies in copepods has increased in recent years (e.g., Aruda et al., 2011; Barreto et al., 2011; Flowers and Burton, 2006; Hansen et al., 2008a, 2008b, 2009, 2010; Ki et al., 2009; Kim et al., 2011; Lauritano et al., 2011a, 2011b, 2012a; Lee and Raisuddin, 2008; Rhee et al., 2009; Seo et al., 2006a, 2006b, 2006c; Tarrant et al., 2008; Voznesensky et al., 2004). Most of these studies focused on the gene expression of the stress response proteins in the model copepod species Calanus finmarchicus and Tigriopus japonicus. These RNA-based studies provided valuable insights into questions such as how copepods evolve and how they respond to environmental changes.

58

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

A successful gene expression study hinges on efficient extraction and purification of high-quality RNA; that is, RNA suitable for downstream transcriptomic analyses such as reverse transcription quantitative PCR (RT-qPCR). A validated and streamlined method that addresses this issue is highly desirable. Several RNA extraction methods were used in the studies mentioned above (Table 1); however, no comparison of results from the different methods has been reported. Further, to make the technique as affordable and accessible as possible, the method should be labor- and cost-efficient. Also, because natural selection works at the individual level, one would ideally wish to link gene expression and phenotypic performance of individuals; as such the method should also be reliable at the individual level. Yet, to our knowledge, no systematic evaluation of the efficiency (successful extraction of high-quality RNA for downstream analysis) of methods has been carried out. Also, in the previous studies RNA was mostly isolated from pooled copepod samples, or from large-sized individual copepods such as Calanus (Table 1). The need for tested and improved protocols for RNA isolation for small-sized copepods became evident in a preliminary study of our own. We found that, without proper homogenization, the yields of nucleic acids recovered from copepod samples were low, probably due to the interference of the copepod exoskeleton. Copepods such as Acartia hudsonica often possess strong PCR-inhibitors that complicate downstream applications (discussed below). Further, the methods developed for mammalian single cell RNA isolation (e.g. Bengtsson et al., 2008; Hartshorn et al., 2005; Moon et al., 2011) do not work well for copepods. It is difficult to obtain both sufficient quantity and purity of RNA from individual copepods, especially the small-sized ones such as A. hudsonica, for gene expression analysis. This study aimed to 1) establish an efficient, cost effective protocol to isolate high-quality total RNA (RNA hereafter) from individual and pooled copepods that allows subsequent downstream analysis on gene expression profiles, and 2) compare the efficiency of RNA-extraction methods currently employed for copepod RT-qPCR analyses. We selected A. hudsonica as the test species because it is a small-sized and ubiquitous copepod species (Bradford, 1976; Ueda, 1986), commonly used in ecological and oceanographic studies, but for which it is difficult to isolate high-quality nucleic acids (Chen, 2010). To wit, as of March 2013 only 32 fragments (169–982 bp) of three genes, i.e. 16S ribosomal RNA, cytochrome c oxidase subunit 1 and cytochrome b genes, for this species have been reported to GenBank. Therefore, A. hudsonica represents a common, important, yet understudied species. Furthermore, we selected the alpha subunit of the voltage-gated sodium (Na) channel gene as a test case. Because the transcript of this gene is long (>7 kb)

– and hence difficult to be reverse-transcribed fully, successful amplification of this gene would verify the utility of the method for a wide variety of genes. We also tested the method for nine other copepod species of various sizes and in different families, with various genes. Successful demonstration of high-quality RNA isolation and downstream applications among several copepod species would be another indication of the potential broad utility of our method. 2. Methods 2.1. Copepod collection Live samples of copepod A. hudsonica were collected using a plankton net of 200-μm mesh size, fitted with a solid cod end, and gently towed ~1–2 m below the surface. Sampling was conducted at three locations: Tuckerton Bay, New Jersey (39°34′60″N, 74°19′18″W); Avery Point, Groton, Connecticut (41°19′50″N, 72°3′44″W); and Casco Bay, Maine (43°43′46″N, 70°9′51″W), USA in April and May, 2008 to 2010. The net contents were transferred into a 20-l insulated container of natural seawater from the sampling location before being brought to the laboratory for processing. To test whether the RNA isolation method developed for A. hudsonica was applicable to other copepods, we also collected samples of nine other copepod species from seven families from Jiaozhou Bay, Shandong, China (36°02′60″N, 120°20′52″E) in May and June, 2012: Acartia pacifica, Calanus sinicus, Centropages dorsispinatus, Centropages tenuiremis, Labidocera bipinnata, Paracalanus parvus, Pseudodiaptomus poplesia, Tortanus dextrilobatus and Tortanus forcipatus. 2.2. Copepod preservation In the laboratory, samples were transferred to petri dishes filled with 0.2 μm-filtered seawater (FSW). Live copepods were pipetted into drop-sized (100–200 μl) aliquots of FSW. Individuals were carefully captured by their antennae or urosomes with a pair of sharp-ended forceps (Dupont # 5 Tweezers), and the trace amount of FSW on the surface of the copepods was removed by lightly touching the samples to a piece of Kim Wipe. The samples were then immersed immediately into 1.5 ml-microcentrifuge tubes containing 50–200 μl TRI Reagent (MRC, Inc., Cincinnati, OH 45212) and stored at −80 °C until RNA isolation was performed. Other guanidine thiocyanate/phenol-based reagents (i.e. TRIzol, RNAzol) are also suitable for the described method. Both guanidine thiocyanate and phenol are very strong protein denaturants

Table 1 Survey of copepod RNA-extraction methods for reverse transcription followed by quantitative polymerase chain reaction (RT-qPCR) analyses. In many instances RNA content per individual was taken from the literature (see footnote). For pooled samples, numbers in parentheses represent the number of copepods per RNA sample. TRIzol-MF, TRI Reagent-MF: Invitrogen TRIzol or MRC TRI Reagent following the manufacturer's suggestions; RNAgents: Promega RNAgents® Total RNA Isolation System; Qiagen: Qiagen RNeasy Mini Kit; Aurum Total RNA: Bio-Rad Aurum Total RNA Mini Kit; Stat 60: Tel-Tes Stat 60 with phenol:chloroform addition. Copepod species

Adult size (mm)

Adult RNA content

Pooled vs individual

Reagent-extraction

Reference

Lepeophtheirus salmonis Tigriopus japonicus

5–10 1.0 ± 0.1

Not reported Not reported

Individual Pooled (50–300)

TRIzol-MF TRIzol/TRI Reagent-MF

Tigriopus californicus Calanus finmarchicus

1.4 ± 0.1 2.5 ± 0.2b

Not reported 5 μg/adult

Pooled Pooled (10–25)

TRI Reagent-MF TRIzol-MF, RNAgents, Qiagen, Aurum, STAT 60

Calanus helgolandicus Calanus sinicus

2.5 ± 0.3c 2.5 ± 0.3

Unknown 2606 ± 642 ng/♀ adult

Individual Pooled (5–40) Individual

Acartia hudsonica

0.9 ± 0.1

Acartia hudsonica

0.9 ± 0.1

272 ± 57 ng/♀ adult; 95 ± 12 ng/♂ adult 150–350 ng/Adult

Aurum total RNA TRIzol-MF TRI Reagent-Modified Zymo column purification TRI Reagent-Modified Zymo column purification Qiagen

Tribble et al. (2007) Kim et al. (2011)a, Lee et al. (2007, 2008), Rhee et al. (2009), Seo et al. (2006a, 2006ba, 2006c) Barreto et al. (2011)a and Willett and Burton (2004)a Hansen et al. (2007, 2008a, 2008b, 2009, 2010)a, Lenz et al. (2012), Tarrant et al. (2008)a, and Voznesensky et al. (2004) Tarrant et al. (2008)a Lauritano et al. (2011a, 2011b) This Study

a b c

Pooled sample size unknown. Wagner et al. (1998). Bottrell and Ronins (1984).

Individual Individual and Pooled

This Study This study

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

that effectively neutralize RNases to prevent RNA degradation. Another guanidine thiocyanate-based reagent, RNAzol®RT (MRC, Inc.) was also used. RNAzol®RT is advertised as having the same benefits as other guanidine thiocyanate-based reagents, such as low sample degradation and removal of RNA-destroying compounds (i.e. TRIzol, RNAzol), but requires water for RNA purification instead of chloroform, which is toxic. For those samples, individual copepods were preserved in 200 μl of RNAzol®RT. In addition, the utmost care in handling the copepods, tubes and reagents was practiced, as the slightest contamination could still lead to RNA degradation, especially when working on individual copepod samples. We routinely spray all surfaces and pipettes with an RNase inhibitor (e.g. RNase Away; Fisher Scientific, Pittsburgh, PA 15275). For pooled copepod samples, 50 to 400 A. hudsonica individuals were sorted and pooled into a 50 ml-centrifuge tube containing approximately 45 ml of FSW, then centrifuged at 2000 ×g, 15 °C, the ambient temperature of the copepods, for 10 min to pelletize any food algae and other debris. Copepods remained suspended in the water after centrifugation. Without disturbing the pellet, copepods were transferred by pouring or pipetting into a new 50 ml-centrifuge tube containing 500 μl TRI Reagent. The tube was briefly vortexed and centrifuged again at 2000 ×g, 4 °C for 1 min. At that point, nearly all the copepods were found at the bottom of the tube within the TRI Reagent layer. The copepods and the TRI Reagent were transferred with a plastic disposable transfer pipette into a sterile 2 ml-microcentrifuge tube and centrifuged at >10,000 ×g for 1 min. Any residual seawater overlaying the TRI Reagent was carefully aspirated by pipetting and 1 ml fresh TRI Reagent was added. The sample was mixed thoroughly with a vortexer at top speed for 1 min and used immediately for RNA extraction, or stored at −80 °C. RNAlater® solution (or RNAlater; Life Technologies) was also tested for preserving pooled and individual A. hudsonica samples. The manufacturer's protocol was followed to store and process the samples. We found RNAlater to be a poor choice, discussed below, and therefore focused the results using guanidine thiocyanate/phenol-based preservation reagents. To facilitate accurate and easy method dissemination, we have presented the following two sections (Sections 2.3 and 2.4) in ‘recipe’ format for RNA isolation of A. hudsonica. Procedures for sample homogenization and RNA extraction can be easily modified based on the specific need of a particular copepod species. 2.3. Sample homogenization Two protocols were used to homogenize individual and pooled A. hudsonica samples stored in TRI Reagent for RNA extractions: a micropestle (manual) or bead-beating (machine-powered) protocol. 2.3.1. Procedure—micropestle 1) If previously frozen, thaw samples at room temperature; if > 50–100 μl of TRI Reagent was used, centrifuge the sample at > 10,000 ×g, 4 °C for 2 min to pelletize copepod(s); transfer most of the supernatant to a 2 ml microtube, leaving ~50–100 μl TRI Reagent with the copepod(s), which is the optimum amount to effectively crush the chitonous carapace of copepods using a micropestle. 2) Homogenize the sample with a disposable plastic micropestle (catalog # 1415–5390; USA Scientific, Inc., Orlando, FL 32891) by tightly fitting the pestle to the bottom of the tube and rotating with pressure 30 to 50 times until no large particles are visible under direct light. The solution should look cloudy, with dust-like particles in suspension. If more than 100 μl of TRI Reagent was used, add it back to the sample after homogenization. If the sample is for pooled copepods, add back the supernatant to the homogenate sample, vortex, centrifuge at >10,000 ×g, 4 °C for 2 min, transfer and save the supernatant and repeat homogenization in step 2 once more; then add back the supernatant to the sample. Specifically, for pooled

59

samples one must ensure that all copepods are thoroughly homogenized. 3) Rinse the pestle with 150 μl fresh TRI Reagent into the microcentrifuge tube and keep the samples on ice until RNA extraction/ purification. 2.3.2. Procedure—bead-beating 1) If the sample is frozen, thaw at room temperature. Add TRI Reagent to a total volume of 200 μl; if the volume exceeds 200 μl, centrifuge, then decant the copepod-free supernatant to a final volume of 200 μl. Proceed with homogenization steps below, then add back supernatant. 2) Add ~70 mg (50–100 mg) of 0.5 mm-zirconia/silica beads (Biospec Products, INC., Bartlesville, OK 74005), and seal the cap with a piece of parafilm. 3) Put the samples on ice for 2 min, then set the tubes in a MP Fast Prep-24 Tissue and Cell Homogenizer (MP Biomedicals; Solon, OH 44139), or similar machine, and homogenize the samples for 10– 120 s at a speed of 4 or 6 meters per second (m/s). See below for discussion on choosing homogenization settings. For A. hudsonica, 10 s at 4 m/s was used. Add back any TRI Reagent removed during step 1 above. 4) Keep the samples on ice until RNA extraction/purification. 2.4. RNA extraction/purification Several protocols were compared for extracting individual and pooled copepod samples. All reagents are Molecular Grade, and certified RNase- and DNase-free. 2.4.1. Standard protocol Procedure: 1) Add 1/5 by volume of chloroform to the homogenized copepod samples in TRI Reagent (e.g. 40 μl for individual copepod sample in 200 μl total TRI Reagent), vortex thoroughly and centrifuge at > 10,000 ×g, 4 °C for 20 min. For samples homogenized with bead-beating, add chloroform directly into the homogenate with the beads, and vortex. 2) Transfer the supernatant, ~60% of total volume, (e.g. ~120 μl for a sample in 200 μl total of TRI Reagent) to a clean 1.5 ml tube, add an equal volume of a phenol:chloroform (5:2; water saturated phenol, pH 4.3) mixture, vortex thoroughly and centrifuge at >10,000 ×g, 4 °C for 5 min. For pooled copepods, repeat this step 2–3 more times until no white interface at the phase separation is observed. 3) Transfer the supernatant (crude RNA) to a new, sterile 1.5 ml tube, add 2.5 volumes of 100% ethyl ethanol (EtOH), vortex thoroughly and keep the sample at −20 °C for at least 12 h. 4) Centrifuge the samples at >10,000 ×g, 4 °C for 20 min. Wash the pellet with 500 μl of 80% EtOH [diluted with Diethyl Pyrocarbonate (DEPC)-treated RNase-free water], centrifuge at >10,000 ×g, 4 °C for 2 min, carefully remove the supernatant and repeat the washing once more. 5) Completely remove the supernatant, air-dry the pellet for 5 min, dissolve RNA in 20–200 μl of DEPC-treated RNase-free water. 2.4.2. Modified Qiagen column purification using RNeasy Mini Kit (Qiagen Inc., Valencia, CA 91355) Procedure: 1) Start with the crude RNA extract (i.e. supernatant) obtained in Standard protocol step “2” (above). 2) Transfer the crude RNA, being careful not to disturb the interface layer, to a new sterile 1.5 ml tube. Add 1 volume of 70% EtOH, mix thoroughly by pipetting and purify the RNA following the manufacturer's protocol.

60

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

3) Elute the RNA with 30 μl of DEPC-treated water. *Optional: to increase the recovery rate (by 5–10%) from RNA columns (both Qiagen and Zymo, below), pipette the RNA back on the column and repeat the elution.

downstream applications. Therefore, the ultimate evidence of high quality and usable quantity of the RNA was obtained from reverse transcription polymerase chain reaction (RT-PCR), either regular PCR or quantitative PCR (qPCR), which are described below.

2.4.3. Zymo column purification using Direct-zol™ RNA MiniPrep Kit (Zymo Research, Irvine, CA 92614) Procedure: 1) Start with copepod samples homogenized in TRI Reagent. 2) Add 1 volume of 100% EtOH, mix thoroughly by pipetting and purify the RNA following the manufacturer's protocol. 3) Elute the RNA with 30 μl of DEPC-treated water.

2.6. First-strand complementary DNA (cDNA) synthesis

2.4.4. Modified Zymo column purification using Direct-zol™ RNA MiniPrep Kit Procedure: 1) Start with the crude RNA supernatant obtained in the Standard protocol step “1)” for individual copepod samples, or after step “2)” for pooled copepods (i.e., Section 2.4.1; after chloroform extraction for individual, and after phenol:chloroform extraction for pooled samples); 2) Transfer crude RNA to a new sterile 1.5 ml tube. Add 1 volume of 100% EtOH, mix thoroughly by pipetting. 3) Purify RNA following the manufacturer's protocol. Elute the RNA with 30 μl of DEPC-treated water. 2.4.5. Zymo Direct-zol Purification with samples preserved in RNA®zol RT Procedure: 1) Start with copepod samples homogenized in RNA®zol RT. 2) Add 40% volume of DEPC water, mix thoroughly by pipetting. 3) Process using Zymo Direct-zol columns and reagents according to the manufacturer's protocol. 4) Elute the RNA with 30 μl of DEPC-treated water. 2.5. Check of quality of RNA Two microliter of RNA was used to measure absorbance at 260 (A260) and 280 (A280) nm on a NanoDrop 1000 spectrophotometer for each sample (Thermo Scientific, Wilmington, DE 19810). The value of A260 multiplied by 40 gives an estimate of RNA concentration (ng/μl), whereas the A260:A280 ratio indicates quality of RNA; values between 1.8 and 2.0 suggest RNA free of contaminants. When RNA concentration is low (b15 ng/μl), which is common for individual copepod samples, the spectrum graph becomes rough, causing A260:A280 ratio to be less accurate; therefore, the A260:A280 ratio was taken only as a reference qualitatively. More care was taken to interpret at which wavelength the RNA peak occurred. Moreover, the ultimate purpose of this method is to produce RNA that is suitable for

We followed the manufacturer protocol of Superscript II Reverse Transcriptase (Invitrogen/Life Technologies, Grand Island, NY 14072), with slight modifications by using a less expensive reverse transcriptase (Improm II, Promega Corporation, Fitchburg, WI 53711). The firststrand cDNA was then diluted with 60 μl of 10 mM Tris·Cl (pH 8) and stored it at −20 °C for future use in qPCR. 2.7. Regular and quantitative PCR Several primer sets were designed using Primer Premier 6 software (Premier Biosoft, Palo Alto, CA 94303) to detect the expression of several A. hudsonica genes including the alpha subunit of the voltage-gated Na channel, RNA polymerase, transmembrane protein 195, and solute carrier organic anion transporter (Table 2). Regular PCR was performed using Takara ExTaq HS DNA polymerase (Clontech Laboratories, Inc., Mountain View, CA 94043). Four microliter of the diluted cDNA [equivalent to 1 μl of the original cDNA reaction (20 μl), or 0.5–1% of the RNA isolated from each individual copepod sample] was used as the template. Other components of the PCR, for a total volume of 25 μl, were assembled following the manufacturer's instructions. Quantitative PCR was performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA 94547) in an iCycler (Bio-Rad) basically following the manufacturer's instruction. Briefly, 4 μl of the cDNA sample was used as the template with the addition of 1 μl of primer mix containing 2.5 mM of the forward and reverse primers, respectively, and 5 μl of the fluorescent Supermix (final volume to 10 μl). For both regular and qPCR, the following program was used: an initial denaturing step at 95 °C for 1 min, followed by 40 cycles of denaturing at 95 °C for 10 s, annealing at 62 °C for 30 s, and extension at 72 °C for 10 s. cDNAs synthesized from the RNA templates extracted using the modified Qiagen and modified Zymo column protocols were used in qPCR. Success rates were defined as the number of positive RT-qPCR results out of the total extraction attempts, and recorded as a percentage. Success rates for individual copepod RNA extractions were compared to each other using multiple z-tests performed with Sigma Plot 11.0 software. 2.8. Application to other copepod species To test whether our method could be applied to other copepod species, we also isolated RNAs from 12 individuals of the large-sized

Table 2 Primers used in the present study for Acartia hudsonica. The annealing temperature for all primers was 56 °C. Primer name

Sequences (5′–3′)

Application

ASCcomIS2F3 ASCcomIS2R1 AhudRNApol-F1 AhudRNApol-F2 AhudRNApol-R1 AhudTR-F1 AhudTR-R1 AhudTR-F2 AhudTR-R2 AhudSCOA-F1 AhudSCOA-F2 AhudSCOA-R

CAGCAGCCCATCAGAGAAATC GTTCAAGGCAAAGTTCCACATCTC ATWAATTYTTTYTGGAATHTBGGTTT TGCGTTCCACCTACTGTCTT ATGATCTGATCTCAGTCTTGTAAGC GATCTATGTCTACCTGGTCAGATTATG GCTTGTCCATTGCTCCATACC GCAATGGACAAGCCTGTTGATAA ATAGCAGCAGAACCTGTGTAGAG GGCTCCAGACGACACATACC CACTGGTGTCCTGTTTATGGG CTTAGCAGCATCCTTGATACAGTT

A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica A. hudsonica

sodium channel forward sodium channel reverse RNA polymerase forward RNA polymerase forward RNA polymerase reverse transmembrane protein forward transmembrane protein reverse transmembrane protein forward transmembrane protein reverse solute carrier organic anion transporter forward solute carrier organic anion transporter forward solute carrier organic anion transporter reverse

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

copepod species C. sinicus (adult size 2.5–2.9 mm), or pooled samples (2–100 individuals) of eight other copepod species ranging in size from 1.0 mm to 2.2 mm (see Section 2.2 for detailed species information). Samples were homogenized using the micropestle protocol, and RNA was isolated using both the Modified Qiagen column purification and Modified Zymo column purification protocols for pooled and individual copepods, respectively. Using these RNA samples, cDNAs were synthesized and tested for five genes (for C. sinicus) using primers designed based on the conserved regions of the reported gene sequences for C. finmarchicus and those of the other organisms (Table 3), or used for large scale sequencing (Zhang et al., unpublished result). A touch-up program was used in PCR as follows: an initial denaturing step at 95 °C for 1 min, followed by 5 cycles of denaturing at 95 °C for 10 s, annealing at 52 °C for 30 s, extension at 72 °C for 10 s, then 35 cycles of denaturing at 95 °C for 10 s, annealing at 58 °C for 30 s, and extension at 72 °C for 10 s. PCR products for C. sinicus were recovered from gel and directly sequenced as reported (Zhang and Lin, 2005).

3. Results 3.1. Sample preservation and homogenization No significant RNA degradation (verified by RT-qPCR of the >7 kb Na channel transcript) was detected for copepod samples preserved in TRI Reagent or TRIzol and stored at 4 °C for up to two weeks, or − 80 °C for two years. Two homogenization protocols for copepods were developed in this study: one by micropestle, and one by bead-beating. We tested various time lengths (10, 20, 60, 120 s) and intensities (4 m/s and 6 m/s) in bead-beating for individual A. hudsonica samples to obtain a high quantity of good-quality RNA for Na channel expression analyses. Bead-beating at 6 m/s, 120 s (strongest condition tested) resulted in the highest RNA yield (460 ± 90 ng/female, n = 12), which was on average 69% higher than homogenization at 4 m/s, 10 s (weakest condition tested, RNA yield 272 ± 57 ng/female, n = 370). However, out of the 12 samples tested, six cDNAs synthesized with the RNAs extracted under the strongest condition failed to amplify the Na channel cDNA fragment (amplicon size ~300 bp, locating in the middle of the >7 kb cDNA, the longest transcript tested) in PCR, indicating that long RNA molecules, such as the Na channel transcript, could be damaged when subjected to prolonged, intense mechanical homogenization. In contrast, when we homogenized the individual copepod samples at 4 m/s for 10 s, although RNA yield was lower, all cDNAs synthesized using these RNAs were proven to be of high quality by successful qPCR-amplification of all four genes with the cDNAs as the templates (see Section 3.3 for detail). There was no significant difference in RNA

61

quality and quantity obtained between the micropestle method and bead-beating method under the weakest condition (4 m/s, 10 s). 3.2. Comparison of RNA extraction methods 3.2.1. Standard method RNA extracted from pooled samples using this method usually contained a large amount of contaminants, as indicated by a large shoulder of the A260 peak (Fig. 1A). We tested four RNA samples extracted from 50–100 A. hudsonica individuals using the standard protocol; all of them failed to produce PCR-amplifiable cDNAs for the Na channel gene. Furthermore, when the standard protocol was used to process single copepod samples, no detectable RNA was obtained; we proceeded to synthesize cDNA and run PCR, assuming there was some RNA in the samples; however, PCR failed to amplify Na channel gene fragments. 3.2.2. Qiagen column purification method In our preliminary work, we used the Qiagen RNeasy Mini Kit to isolate RNA from A. hudsonica following the manufacturer's protocol after homogenizing copepod samples with pestles. We found that contaminants still remained in the RNA after purification, evident because approximately 40% (5 of 12 samples) of the cDNAs synthesized with the RNA samples failed to amplify the Na channel gene (Zhang et al., unpublished result). We then modified the manufacturer's protocol by adding several phenol/chloroform extraction steps before purifying the raw RNA with the column. Contaminants observed in RNA isolated from pooled copepods using the standard method were largely removed by the modified Qiagen column purification method (Fig. 1B), as indicated by a clean peak at A260. We tested this protocol for groups of 50, 100, 200, and 400 individuals (dominated by females, but containing both sexes) homogenized with a micropestle and obtained consistent yields and high quality RNA (267 ± 32 ng RNA/individual). Using the same procedure for individual copepods yielded 150– 350 ng RNA per individual, with high purity as indicated by a low left shoulder of the A260 peak (Fig. 1C). The quality of these RNA samples was demonstrated by successful RT-qPCR (Fig. 2). Following our protocols, genomic DNA contamination that may exist in the RNA samples, if at all, is negligibly low. This is because the Qiagen RNA columns specifically bind to RNA, and our phenol:chloroform extraction steps further remove DNA contamination. The lack of genomic DNA contamination was further proven by the absence of detectable amplicon using the RNA samples directly as templates in RT-qPCR (i.e. −RT control), for the four genes tested (data not shown). 3.2.3. Zymo column purification method The Zymo Direct-zol™ RNA MiniPrep Kit was first used to isolate RNA from individual copepod samples following the manufacturer's protocol.

Table 3 Primers used in the present study for Calanus sinicus. The annealing temperatures in PCR for all primers were 52 °C then 58 °C (see Section 2.8 for details). Primer name

Sequences (5′–3′)

Application

copepodPFKF1 copepodPFKR2 copepodPFKR1 copepodPGIF1 copepodPGIF2 copepodPGIR1 copepodRXRF1 copepodRXRR2 copepodRXRR1 copepodactinF1 copepodactinR2 copepodactinR1 copepodHSP60F1 copepodHSP60R1 copepodHSP60F2 copepodHSP60R2

AACAGATATGACCATTGGAACTGACTC CCAGCAACAAGAGCAAGRTANCC CCAATCCTCTTCTGGNGGCCA TTCACGACTCAGGAAACNATHAC ATGTTTGAGTTCTGGGAYTGGGT TCTGCTCCATAGAAGTTACCATACCA TGTGAGGGTTGTAAGGGTTTYTTYAA ACCTGTTCCTCTGCCTYTTRTC ACTGCCTCTCTCTTCATNCCCAT GCTCACCAACTACYTGATGAAGAT GGATGTCAACATCGCACTTCATHAT GACAGTGTTGGCATAGAGATCCTT TTGCCACAATCTCTGCCAATGG ACTGGATGGAGGAGATCTTCTTCTC GCTGTCAAGGCTCCNGGNTTTGG TCCGATCTTGAGCACAGCCAC

Copepod 6-phosphofructo-1 kinase (PFK) forward Copepod PFK reverse Copepod PFK reverse Copepod phosphoglucose isomerase (PGI) forward Copepod PGI forward Copepod PGI reverse Copepod retinoid X receptor (RXR) forward Copepod RXR reverse Copepod RXR reverse Copepod actin forward Copepod actin reverse Copepod actin reverse Copepod heat shock protein 60 (HSP60) forward Copepod HSP60 reverse Copepod HSP60 forward Copepod HSP60 reverse

62

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

A

1.00

1.60

10 mm Absorbance

10 mm Absorbance

2.00

1.20 0.80 0.40 0.00

D

0.80 0.60 0.40 0.20 0.00

220

240

260

280

300

320

340

220

240

Wavelength (nm)

1.00

B

260

280

300

320

340

320

340

Wavelength (nm)

2

1.00

E

0.60

10 mm Absorbance

10 mm Absorbance

1 0.80

3

0.40

4

0.20 0.00 240

260

280

300

320

340

Wavelength (nm)

10 mm Absorbance

0.60 0.40 0.20 0.00

220

1.00

0.80

220

240

260

280

300

Wavelength (nm)

C

0.80 0.60 0.40 0.20 0.00 220

240

260

280

300

320

340

Wavelength (nm) Fig. 1. Comparison of yield and quality of RNA from Acartia hudsonica isolated using various protocols (see Section 2.4 RNA extraction/purification for details). RNA was measured by NanoDrop Spectrophotometers. A) Absorption plot of total RNA isolated using standard protocol from a pooled sample of 50 individuals; B) absorption plot of total RNA isolated using Modified Qiagen column purification with RNeasy Mini Kit from groups of 50, 100, 200 and 400 individuals; C) absorption plot of total RNA isolated from individual copepod samples using Modified Qiagen column purification with RNeasy Mini Kit; D) absorption plot of total RNA isolated from individual copepod samples using Zymo Direct-zol™ RNA MiniPrep Kit following manufacturer's protocol; E) absorption plot of total RNA isolated from individual copepod samples using modified Zymo column purification with Direct-zol™ RNA MiniPrep Kit.

When the RNA quality was checked using NanoDrop, contamination was revealed, causing the peak of RNA UV absorbance to shift from wavelengths 260 to 270 (Fig. 1D). As mentioned earlier, at the low RNA concentrations of individual copepods, the NanoDrop report must be interpreted cautiously. Specifically, while the read of the RNA concentration cannot be too precise, the wavelength of the RNA peak is an indication of purity, or quality. A shift from 260 to 270 nm indicates the presence of contaminants that may interfere with downstream applications. There was a 20–30% failure rate in Na channel RT-qPCR for the cDNAs synthesized using the RNA samples processed with Direct-zol™ (Fig. 1D). Further, Direct-zol™ columns bind to both DNA and RNA. If genomic DNA contamination is a concern, an additional on-column

DNase digestion step is recommended by the manufacturer's protocol; however, this additional incubation step could be time-consuming when a large number of RNA samples are handled, and could cause RNA degradation if the procedure is not followed carefully. We modified the manufacturer's protocol by adding a chloroform extraction step for individual samples, and further phenol/chloroform extraction steps for pooled samples, before passing the crude RNA samples through the Zymo columns. After this modification, the contaminants that cause a shift in the peak of RNA UV absorbance disappeared (Fig. 1E), and the cDNA synthesized using RNAs from both pooled and individual copepod samples gave a consistently high rate of success in PCR amplification (Fig. 2); additionally a higher throughput was afforded

n=456

C n=70

B

80

n=24

60

n=24

40

20

A n=24

Female Male

400

300

200

100

0

100

200

300

400

ifi

ed

Di

re c

Individual Fig. 3. RNA content for individual Acartia hudsonica females (n = 370; filled diamonds) and males (n = 24; unfilled circles). RNA was isolated using modified Zymo column method for individuals.

M

od

ifi

ed

t-z ol

i-K M in sy

RN

ea

NA ,R t-z ol

re c Di

M od

zo l

ag Re RI ,T

t-z ol

it

M P RT

tM P en

nt ge ea IR TR re c Di

500

63

0

0 M P

Success Rate (Sodium Channel Gene: RT-qPCR)

D 100

Acartia hudsonica RNA content (ng RNA Individual-1)

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

Fig. 2. Comparison of RT-qPCR success rate using RNAs of Acartia hudsonica individual samples isolated with different protocols. Success rate was defined as the amount of positive RT-qPCR reactions of the alpha subunit of the voltage-gated sodium channel gene out of the total extraction attempts. Samples refer to the 5 protocols tested (see Section 2.4 RNA extraction/purification for details). TRI Reagent MP: TRI Reagent samples with Manufacturer's Protocol; Direct-zol, TRI Reagent MP: Zymo Direct-zol™ RNA MiniPrep Kit for TRI Reagent samples, Manufacturer's Protocol; Direct-zol, RNAzol RT MP: Zymo Direct-zol™ RNA MiniPrep Kit for RNAzol RT samples, Manufacturer's Protocol; Modified RNeasy Mini-Kit: Modified Qiagen column purification using Qiagen RNeasy Mini Kit; Modified Direct-zol: Modified Zymo column purification using Direct-zol™ RNA MiniPrep Kit. Letters correspond to statistical groupings (multiple z-tests, p b 0.05).

— typically 2–3× more samples processed in equivalent time compared to other methods. We checked for genomic DNA contamination of our modified Direct-zol™ method by using the RNAs directly as template in RT-qPCR; no amplification was detected (n = 24 individual samples). We also performed DNase digestion for the RNA obtained and found no significant change of the final RNA yield and result of RT-PCR. Using this protocol, we found that the RNA content of female individuals ranged from 150 to 420 ng, similar to that of the Qiagen column purification protocol (all at the lowest bead-beating machine setting for homogenization). 3.2.4. A. hudsonica samples fixed in RNAlater A. hudsonica individual samples preserved in RNAlater were processed according to the manufacturer's protocol in conjunction with our modified Qiagen or Zymo protocol, and gave a similar yield and quality of RNA to the TRI Reagent protocol. However, A. hudsonica became transparent after RNAlater fixation and a single individual was easily lost during homogenization, resulting in no detectable RNA for 6 out of 24 individual samples. 3.3. Application examples 3.3.1. The copepod A. hudsonica We used the Modified Zymo column purification method to isolate RNA from both female and male individuals of A. hudsonica (Fig. 3). The results showed consistent RNA yields and qualities (Fig. 1C). In regard to yields, the use of the method gave 272 ± 57 ng RNA per individual (n = 370) for females, and 95 ± 12 ng RNA per individual (n = 24) for males (Fig. 3), with relatively small variations within each sex. The difference between the two sexes (t-test, p b 0.001) can be attributed to females' larger body sizes and more active gene transcription during the reproductive stage. The high quality of

these RNA samples was indicated by a sharp A260 peak detected by NanoDrop, as indicated above, and the successful amplification of a number of genes using RT-PCR. One of these genes was the alpha subunit of the voltage-gated Na channel gene, which has proven to be challenging to amplify due to its large size (>7 kb, Chen, 2010). Using the Modified Zymo column purification protocol, we were able to detect the differential expression pattern of this gene in individual A. hudsonica exposed to different treatments (Finiguerra et al., unpublished result). Use of this method also allowed us to detect the expression of three other genes (transcript length 1–2 kb) in A. hudsonica: RNA polymerase, transmembrane protein 195, and solute carrier organic anion transporter. Twenty-four individual copepod RNA samples were used for cDNA synthesis and subsequent PCR using primers designed specifically for these genes. Real time PCR amplification cycle graphs showed that for all samples, the exponential increase started at 22–29 cycles (i.e. Ct = 22 to 29), and the amplicons with expected sizes were obtained (Fig. 4). 3.3.2. Other copepod species To demonstrate that our method is suitable for a variety of copepod species of various sizes, we isolated RNA from nine different copepod species in seven families. We first tested RNA isolation from the individuals of the large-sized copepod C. sinicus. For the 12 samples tested, the RNA amounts obtained per individual were similar to both the modified Qiagen protocol and the modified Zymo protocol, yielding 2606 ± 642 ng RNA/adult (female) overall. cDNAs were synthesized using these RNA samples and tested for 5 genes: 6-phosphofructo-1kinase, phosphoglucose isomerase, retinoid X receptor, actin, and heat shock protein 60. Positive amplifications were obtained for all 12 cDNAs; direct sequencing proved that all amplicons were of the targeted genes. We further isolated RNAs from the pooled samples (2–100 individuals per sample) and constructed cDNA libraries for each of the other eight copepod species. Large-scale sequencing for these libraries yielded various cDNA sequences, some of which are new to copepods (e.g., prohormone-4, trypsin, ferritin heavy subunit, Calponin-3). One hundred twenty-four full-length cDNA sequences obtained from A. pacifica have been reported to GenBank; sequences from other species will be published elsewhere. 3.3.3. GenBank accession numbers The cDNA sequences reported in this study have been deposited to GenBank under accession nos. JQ946330-JQ94632, KC989790KC989919. We also have obtained full-length cDNA of Na channel alpha subunit gene, which will be reported elsewhere (Chen et al., unpublished result).

64

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

A

may delay or inhibit accurate testing of research hypotheses. In our view, the present study represents a significant improvement in our ability to carry out transcriptomic analyses while accounting for individual variability. The purified RNA product from our recommended protocols (see below) can be used for transcriptomics and other expression studies. Furthermore, positive tests on nine other species suggest that this method should be widely applicable to copepods.

1 2 3 4 5 6 7 8 9 10 111213 141516 171819 20 2122 23

300

PCR Efficiency: 90.5%

200

100

4.1. Sample preservation We used TRI Reagent to preserve copepod samples for RNA isolation. TRI Reagent is a monophasic solution of phenol and guanidine thiocyanate maintained at a low pH (Chomczynski and Sacchi, 1987) that has been widely used to effectively isolate RNA from various organisms, and is our recommended storage reagent for copepods. We also tested RNAlater – an aqueous, nontoxic tissue storage reagent often used to stabilize and protect cellular RNA – for preserving pooled and individual A. hudsonica samples. Samples preserved in RNAlater and processed according to the manufacturer's protocol gave similar yield and quality of RNA to the TRI Reagent protocol when used in conjunction with our modified Qiagen or Zymo protocol. However, small-sized copepods such as A. hudsonica became transparent after RNAlater fixation and were easily lost during the RNA extraction process; therefore, this fixation method does not seem to be suitable for RNA-isolation of individual small-sized copepods. However, due to the highly corrosive nature of TRI Reagent, we acknowledge that preservation in TRI Reagent may not be possible in some cases, such as working at sea or remote field sites. As such, if RNAlater must be used even for small-sized copepods, we recommend increasing the sample size of preserved individuals to account for a reduced overall success rate.

0

PCR Baseline Subtracted CF RFU

0

B 1 2 3 4 5 6 7 8 9 10 1112131415 161718 19202122 23

300

PCR Efficiency: 92.0% 200

100

0 0

C 300

4.2. Sample homogenization

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

PCR Efficiency: 90.4%

200

100

0 0

10

20

30

40

Cycle Fig. 4. Real time PCR amplification cycle graphs and the gel images of the amplicons of three Acartia hudsonica genes. Twenty-four copepod individual cDNA samples equivalent to 0.5% of the RNA isolated from each individual were used as the templates. Only the gel images of the first 23 samples are shown. A, RNA polymerase gene; B, transmembrane protein 195 gene; C, solute carrier organic anion transporter gene.

4. Discussion This paper reports the first effort to rigorously test and compare copepod RNA extraction protocols (Table 1). This comparison was important to our goal of developing an effective method for extracting high-quality RNA from individual as well as pooled copepods to be used for downstream applications. The methods developed to isolate high-quality RNA from single mammalian embryos, or even single cells, do not necessarily work for copepods for various reasons (e.g., copepods have hard carapace, high quantity of inhibitors). While other labs have reported successful methods to extract RNA from copepods, no systematic study has been conducted to compare methods. Thus, researchers may be using an inefficient and expensive method that

Homogenization is a crucial step to efficiently isolate RNA from copepods, especially from individual copepod samples. Speekmann et al. (2007) used a sonic dismembrator as well as pestle/mortar methods modified from Westerman and Holt (1988) and Vrede et al. (2002) to homogenize and extract nucleic acids from individual Acartia tonsa copepods for RNA:DNA ratio measurements. These homogenization efforts were aimed at measuring bulk quantities of nucleic acids instead of achieving intact RNA for cDNA synthesis; as such, these methods may not be suitable for such downstream applications as RT-PCR or transcriptome profiling, especially when long transcripts are the target (long transcripts will be sheared during the intense sonication step). Further, in our preliminary study (Zhang et al., unpublished result), RNA recovered from A. hudsonica individuals that were not properly homogenized resulted in poor quality of cDNA, as indicated by the low success rate of RT-qPCR for the Na channel transcripts (typically 30–50%); under-homogenization resulted in low RNA recovery, and over-homogenization caused RNA shearing. Therefore, we have developed two copepod homogenization protocols. The micropestle protocol is inexpensive, but more labor-intensive. Homogenizing copepod samples by bead-beating requires a specific instrument, but this protocol effectively breaks down tough copepod carapaces while allowing one to obtain intact mRNA of long genes such as the Na channel gene for RT-qPCR analysis. Further, the machine-based bead-beating protocol allows for higher throughput. When using a mechanical homogenizer, it is very important to determine the best homogenization setting for the copepod and downstream application desired. A balance between duration and strength must be found for each specific study to ensure success. When choosing the homogenization settings, one must take into consideration the length and expression level of the targeted transcripts. Because the bead-beating protocol, even under the weakest condition, provided an adequate amount of RNA suitable for cDNA synthesis, and enabled a higher throughput, we found this method of homogenization to be most

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

useful when working with individual A. hudsonica samples. Using this method, we have processed >400 samples reported here and >3000 samples to be reported elsewhere (Finiguerra et al., unpublished result). 4.3. Comparison of RNA extraction methods and recommendations RNA extracted from A. hudsonica samples using the standard method often contained contaminants that could not be completely removed by the phenol/chloroform extraction, which were apparently co-precipitated with RNA during ethanol precipitation (Fig. 1A). Clearly, the standard protocol is not amenable for achieving high-quality RNA for RT-PCR of long gene transcripts such as Na channel mRNA. Through incorporating various components from currently used protocols and exploring new commercial kits and tools, we have developed an improved method for extracting RNA from copepods. The Modified Zymo column purification protocol shows clear advantages over the others tested. Our labs have exclusively used the modified Zymo protocol for more than 3000 individual copepod RNA extractions for many reasons. First, the RNAs isolated from individual copepods provide the highest success rate of downstream RT-qPCR even for the 7-kb Na channel transcript (>98% of the tested individuals; Fig. 4, z-test, p b 0.05). Second, after adding chloroform to separate RNA from DNA/protein, the multiple phenol/chloroform extraction steps are not necessary, which reduces labor substantially. Third, the new Direct-zol™ RNA MiniPrep Kit is less expensive (by ~ 60%, based off of advertised online prices) than the long available Qiagen RNeasy Mini Kit. Taken together, the modified Zymo protocol allows for the extraction of high quality RNA from large sample sizes of individual copepods quickly, and at a reduced cost over other methods; however, if many copepods are pooled together, then the modified Qiagen column method is needed due to the higher RNA binding capacity of the Qiagen columns. Further, the multiple phenol:chloroform purification steps are required to eliminate contaminants that are more concentrated in pooled samples. In the process of testing the protocols, we achieved cDNA sequences of various genes for A. hudsonica and nine other copepod species, some of which had never before been reported for copepods, which verifies the high quality of the cDNA libraries synthesized. These results also indicate that our method should be applicable to a wide variety of copepod species, both small- and large-sized, and for both individual and pooled samples. We hope that the improved methods will facilitate more studies on copepod transcriptomes, leading to a better understanding of the molecular mechanisms underlying a wide array of processes at higher levels of biological organization. In particular, the effectiveness of the method to work with individual copepod samples will greatly help any effort to link phenotypic performance to a molecular basis. Acknowledgments We thank our colleagues Drs. David Avery, Lihua Chen, Hongju Chen, Ms. Feifei Yang and Xiaoyan Yi for copepod samplings, identification, culturing, and technical assistance. We thank several anonymous reviewers for critically reading the manuscript and their suggestions. This study was supported by the National Science Foundation grants IOS-0950852 and EF-0629624, and the National Science Foundation of China grant 41076085. [SS] References Aruda, A.M., Baumgartner, M.F., Reitzel, A.M., Tarrant, A.M., 2011. Heat shock protein expression during stress and diapause in the marine copepod Calanus finmarchicus. J. Insect Physiol. 57, 665–675. Barreto, F.S., Moy, G.W., Burton, R.S., 2011. Interpopulation patterns of divergence and selection across the transcriptome of the copepod Tigriopus californicus. Mol. Ecol. 20, 560–572.

65

Bengtsson, M., Hemberg, M., Rorsman, P., Ståhlberg, A., 2008. Quantification of mRNA in single cells and modelling of RT-qPCR induced noise. BMC Mol. Biol. 9, 63. http://dx.doi.org/10.1186/1471-2199-9-63. Bottrell, H., Ronins, D., 1984. Seasonal variations in length, dry weight, carbon and nitrogen of Calanus helgolandicus from the Celtic Sea. Mar. Ecol. Prog. Ser. 14, 259–268. Bradford, J.M., 1976. Partial revision of the Acartia subgenus Acartiura (Copepoda: Calanoida: Acartiidae). N.Z. J. Mar. Freshwater Res. 10, 159–202. Bron, J., Frisch, D., Goetze, E., Johnson, S., Lee, C., Wyngaard, G., 2011. Observing copepods through a genomic lens. Front. Zool. 8, 22. Chen, L., 2010. A Molecular Approach to the Study of Saxitoxin Resistance in the Copepod Acartia hudsonica. Ph. D dissertation. University of Connecticut. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Dam, H.G., 2013. Evolutionary adaptation of marine zooplankton to global change. Annu. Rev. Mar. Sci. 5, 349–370. Dam, H.G., Zhang, X., Butler, B., Roman, M.R., 1995. Mesozooplankton grazing and metabolism at the equator in the central Pacific: implications for carbon and nitrogen fluxes. Deep Sea Res. Part II 42, 735–756. Flowers, J.M., Burton, R.S., 2006. Ribosomal RNA gene silencing in interpopulation hybrids of Tigriopus californicus: nucleolar dominance in the absence of intergenic spacer subrepeats. Genetics 173, 1479–1486. http://dx.doi.org/10.1534/ genetics.106.058719. Hansen, B.H., Altin, D., Nordtug, T., Olsen, A.J., 2007. Suppression subtractive hybridization library prepared from the copepod Calanus finmarchicus exposed to a sublethal mixture of environmental stressors. Comp. Biochem. Physiol. D: Genomics Proteomics 2, 250–256. Hansen, B.H., Altin, D., Hessen, K.M., Dahl, U., Breitholtz, M., Nordtug, T., Olsen, A.J., 2008a. Expression of ecdysteroids and cytochrome P450 enzymes during lipid turnover and reproduction in Calanus finmarchicus (Crustacea: Copepoda). Gen. Comp. Endocrinol. 158, 115–121. Hansen, B.H., Altin, D., Vang, S.H., Nordtug, T., Olsen, A.J., 2008b. Effects of naphthalene on gene transcription in Calanus finmarchicus Crustacea: Copepoda. Aquat. Toxicol. 86, 157–165. Hansen, B.H., Nordtug, T., Altin, D., Booth, A., Hessen, K.M., Olsen, A.J., 2009. Gene expression of GST and CYP330A1 in lipid-rich and lipid-poor female Calanus finmarchicus Copepoda: Crustacea. exposed to dispersed oil. J. Toxicol. Environ. Health Part A 72 (3–4), 131–139. http://dx.doi.org/10.1080/15287390802537313. Hansen, B., Dag, A., Booth, A., Vang, S.H., Frenzel, M., Sorheim, K., Brakstad, O., Storset, T., 2010. Molecular effects of diethanolamine exposure on Calanus finmarchicus (Crustacea: Copepoda). Aquat. Toxicol. 99, 212–222. Hartshorn, C., Anshelevich, A., Wangh, L.J., 2005. Rapid, single-tube method for quantitative preparation and analysis of RNA and DNA in samples as small as one cell. BMC Biotechnol. 5 (2). http://dx.doi.org/10.1186/1472-6750-5-2. Humes, A.G., 1994. How many copepods? Hydrobiology 292–293, 1–7. Ki, J., Raisuddin, S., Lee, K., Hwang, D., Han, J., Rhee, J., Kim, I., Park, H., Ryu, J., Lee, J., 2009. Gene expression profiling of copper-induced responses in the intertidal copepod Tigriopus japonicus using a 6 K oligochip microarray. Aquat. Toxicol. 93, 177–187. Kim, B.M., Rhee, J.S., Park, G.S., Lee, J., Lee, Y.M., Lee, J.S., 2011. Cu/Zn- and Mnsuperoxide dismutase SOD. from the copepod Tigriopus japonicus: molecular cloning and expression in response to environmental pollutants. Chemosphere 84, 1467–1475. Kiørboe, T., 2011. What makes pelagic copepods so successful? J. Plankton Res. 33, 677–685. Lauritano, C., Borra, M., Carotenuto, Y., Biffali, E., Miralto, A., Procaccini, G., Ianora, A., 2011a. First molecular evidence of diatom effects in the copepod Calanus helgolandicus. J. Exp. Mar. Biol. Ecol. 404, 79–86. Lauritano, C., Borra, M., Carotenuto, Y., Biffali, E., Miralto, A., Procaccini, G., Ianora, A., 2011b. Molecular evidence of the toxic effects of diatom diets on gene expression patterns in copepods. PLoS One 6, e26850. Lauritano, C., Carotenuto, Y., Miralto, A., Procaccini, G., Ianora, A., 2012a. Copepod population-specific response to a toxic diatom diet. PLoS One 7 (e47262). http:// dx.doi.org/10.1371/journal.pone.0047262. Lauritano, C., Procaccini, G., Ianora, A., 2012b. Gene expression patterns and stress response in marine copepods. Mar. Environ. Res. 76, 22–31. Lee, J.S., Raisuddin, S., 2008. Modulation of expression of oxidative stress genes of the intertidal copepod Tigriopus japonicus after exposure to environmental chemicals. In: Murakami, Y., Nakayama, K., Kitamura, S.I., Iwata, H., Tanabe, S. (Eds.), Interdisciplinary Studies on Environmental Chemistry-Biological Responses to Chemical Pollutants. TerraPub, Tokyo, pp. 95–105. Lee, Y.M., Lee, K.W., Park, H., Park, H.G., Raisuddin, S., Ahn, I.Y., Lee, J.S., 2007. Sequence, biochemical characteristics and expression of a novel Sigma-class of glutathione Stransferase from the intertidal copepod, Tigriopus japonicus with a possible role in antioxidant defense. Chemosphere 69, 893–902. Lee, K.W., Rhee, J.S., Raisuddin, S., Park, H.G., Lee, J.S., 2008. A corticotropin-releasing hormone binding protein (CRH-BP) gene from the intertidal copepod, Tigriopus japonicus. Gen. Comp. Endocrinol. 158, 54–60. Lenz, P.H., Unal, E., Hassett, R.P., Smith, C.M., Bucklin, A., Christie, A.E., Towle, D.W., 2012. Functional genomics resources for the North Atlantic copepod, Calanus finmarchicus: EST database and physiological microarray. Comp. Biochem. Physiol. D: Genomics Proteomics 7, 110–123. Longhurst, A.R., Harrison, W.G., 1988. Vertical nitrogen flux from the oceanic photic zone by diel migrant zooplankton and nekton. Deep Sea Res. Part 1 35, 881–889. Miller, C.B., 2004. Biological Oceanography. Blackwell Publishing, Oxford. Moon, S., Kim, Y.G., Dong, L., Lombardi, M., Haeggstrom, E., Jensen, R.V., Hsiao, L.L., Demirci, U., 2011. Drop-on-demand single cell isolation and total RNA analysis. PLoS One 6 (3), e17455. http://dx.doi.org/10.1371/journal.pone.0017455.

66

H. Zhang et al. / Journal of Experimental Marine Biology and Ecology 446 (2013) 57–66

Rhee, J.S., Raisuddin, S., Lee, K.W., Seo, J.S., Ki, J.S., Kim, I.C., Park, H.G., Lee, J.S., 2009. Heat shock protein (Hsp) gene responses of the intertidal copepod Tigriopus japonicus to environmental toxicants. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 149, 104–112. Runge, J.A., 1988. Should we expect a relationship between primary production and fisheries? The role of copepod dynamics as a filter of trophic variability. Hydrobiology 167–168, 61–71. Seo, J.S., Lee, K.W., Rhee, J.S., Hwang, D.S., Lee, Y.M., Park, H.G., Ahn, I.Y., Lee, J.S., 2006a. Environmental stressors (salinity., heavy metals., H2O2) modulate expression of glutathione reductase (GR) gene from the intertidal copepod Tigriopus japonicus. Aquat. Toxicol. 80, 281–289. Seo, J.S., Lee, Y.M., Park, H.G., Lee, J.S., 2006b. The intertidal copepod Tigriopus japonicus small heat shock protein 20 gene (Hsp20) enhances thermotolerance of transformed Escherichia coli. Biochem. Biophys. Res. Commun. 340, 901–908. Seo, J.S., Park, T.J., Lee, Y.M., Park, H.G., Yoon, Y.D., Lee, J.S., 2006c. Small heat shock protein 20 gene of the intertidal copepod Tigriopus japonicus as a possible biomarker for exposure to endocrine disruptors. Bull. Environ. Contam. Toxicol. 76, 566–572. Speekmann, C., Nunez, B., Buskey, E., 2007. Measuring RNA:DNA ratios in individual Acartia tonsa (Copepoda). Mar. Biol. 151, 759–766. Tarrant, A.M., Baumgartner, M.F., Verslycke, T., Johnson, C.L., 2008. Differential gene expression in diapausing and active Calanus finmarchicus (Copepoda). Mar. Ecol. Prog. Ser. 355, 193–207. Tribble, N.D., Burka, J.F., Kibenge, F.S.B., 2007. Evidence for changes in the transcription levels of two putative P-glycoprotein genes in sea lice (Lepeophtheirus

salmonis) in response to emamectin benzoate exposure. Mol. Biochem. Parasitol. 153, 59–65. Ueda, H., 1986. Redescription of the planktonic calanoid copepod Acartia hudsonica from Atlantic and Pacific waters: a new record from Japanese waters. J. Oceanogr. 42, 124–133. Voznesensky, M.H., Lenz, P., Spanings-Pierrot, C., Towle, D.W., 2004. Genomic approaches to detecting thermal stress in Calanus finmarchicus (Copepoda: Calanoida). J. Exp. Mar. Biol. Ecol. 311, 37–46. Vrede, T., Persson, J., Aronsen, G., 2002. The influence of food quality (P:C ratio) on RNA:DNA ratio and somatic growth rate of Daphnia. Limnol. Oceanogr. 47, 487–494. Wagner, M., Durbin, E., Buckley, L., 1998. RNA:DNA ratios as indicators of nutritional condition in the copepod Calanus finmarchicus. Mar. Ecol. Prog. Ser. 162, 173–181. Westerman, M.E., Holt, J., 1988. The RNA–DNA ratio: measurement of nucleic acids in larval Sciaenops ocellatus. Contrib. Mar. Sci. 30, 117–124. Willett, C.S., Burton, R.S., 2004. Evolution of interacting proteins in the mitochondrial electron transport system in a marine copepod. Mol. Biol. Evol. 21, 443–453. Zhang, H., Lin, S., 2005. Development of a cob-18S rDNA Real-Time PCR assay for quantifying Pfiesteria shumwayae in the natural environment. Appl. Environ. Microbiol. 71, 7053–7063.