Cloning and characterization of human complement component C7 ...

Genes and Immunity (2003) 4, 54–59 & 2003 Nature Publishing Group All rights reserved 1466-4879/03 $25.00 www.nature.com/gene

Cloning and characterization of human complement component C7 promoter S Gonza´lez1, J Martı´nez-Borra2 and C Lo´pez-Larrea2 Functional Biology Department, University of Oviedo, Spain; 2Department of Immunology, Hospital Central de Asturias, Oviedo, Spain

1

To study the transcriptional regulation of the human complement component C7, a 1 kb promoter fragment was cloned and the transcription start site was determined. C7 is expressed by the hepatoma-derived cell line Hep-3B, but not by Hep-G2. Transfection of these cell lines with different C7 promoter–luciferase constructs demonstrated that 1 kb of the 5 0 -flanking region contains the necessary elements for driving C7 transcription in a tissue-specific manner and showed that the sequence between 29/+102 retained the majority of C7 promoter activity in Hep-3B. Electrophoretic mobility shift assays suggested that the binding of the C/EBPa transcription factor to a C/EBP sequence located at +42 is essential for C7 expression. To investigate whether the absence of C/EBPa expression in Hep-G2 cells is responsible for the lack of C7 transcription, Hep-G2 cells were transfected with a C/EBPa expression vector. C/EBPa transactivated the C7 luciferase reported gene and restored the C7 expression in Hep-G2 cells. Genes and Immunity (2003) 4, 54–59. doi:10.1038/sj.gene.6363902 Keywords: C7; complement; human; promoter; C/EBP; transcription factor

Introduction C7 is a terminal component of complement which interacts in a sequence of polymerization reactions with other terminal complement components (C6, C8 and C9) to form a membrane attack complex (MAC).1 The formation of the MAC creates a pore in membranes of certain pathogens that can lead to their death. C7 plays a central role in the MAC cascade, since its incorporation into the nascent complex allows its hydrophilic–amphiphilic transition which permits the direct binding to the target membrane.2 The liver is the main organ responsible for the synthesis of C7.3 The contribution of the liver to C7 serum levels has been estimated to be about 50%.4 However, the hepatic-derived cell line Hep-G2 fails to synthesize several terminal complement components such as C6, C7 or C9.5,6 C7 is also expressed in a variety of cells, such as monocytes, macrophages, polymorphonuclear leucocytes, fibroblasts, umbilical vein endothelial cells, platelets and cells of the central nervous system.7–13 C7 is not regulated as an acute phase protein like other complement proteins and, accordingly, no induction of its expression is detected in vitro in response to IL-1, IL-6, TNF-a or IFN-g.6,14 It has been suggested that this differentiated regulation of C7 may play a role as a limiting factor for MAC formation, and C7 may serve as a modulator of complement formation and activity. Thus, the synthesis of C7, mainly for monocytes,

Correspondence: C Lo´pez-Larrea, Department of Immunology, E-33006, Oviedo Spain. E-mail: [email protected]

macrophages and polymorphonuclear cells at the site of inflammation, appears to be a limiting factor for MAC activation. In spite of the important role of this protein in the complement formation and the innate defence against microorganisms, little is known about the regulation of C7 expression. In this study the promoter region of the human C7 gene was cloned and functionally characterized.

Results Cloning and characterization of 50 flanking region of human C7 gene C7 promoter was isolated from the Human YAC library. The C7 50 flanking region was isolated from one C7positive YAC clone (14AH8) by randomly primed PCR. Three overlapping clones of the human C7 50 flanking region of 719, 815 and 994 bp were amplified from this C7-positive YAC clone. All products contained the sequence of 50 untranslated region (50 UTR) of the previously described cDNA sequence.1 The transcriptional start site was determined in human liver total RNA and in the hepatoma cell line Hep-3B by 50 RACE. Products from the nested PCR were cloned and at least five different clones from each RNA were sequenced. All 50 RACE products obtained from the liver and Hep-3B were identical in size and their sequence exactly matched with such previously isolated from the YAC clone 14AH8 (Figure 1). These data suggest that the human C7 gene has a single transcription start site in the liver located 115 bp upstream from the initiation codon.

Human complement component C7 S Gonza´lez et al

Sequence analysis of the 50 region of human C7 gene The analysis of consensus binding sites for transcription factors revealed that human C7 presents a canonical TATA box (at 28, TATATAT), and lacks an identifiable initiation element (Figure 2). C7 promoter includes several potential binding sites for cis-acting factors, such as the one for the NF1 transcription factor (at 21, GAGTGCCAAGA),15 four AP-1 sites (at 882, CCTGACCTCTT; at 635, AATGACCCTGA; at 490, GATGACTATTG; at 418 AGTGACAGAAC)16 and presents a sequence homologous for hepatic-specific transcription factors, such as three sites for the nuclear factor for IL-6 expression C/EBP17 (at 779, AAATCTTGCAAAAT; at 576, TTCTTGAGAAAATT; at +42, TGCTGTTGAAAACT) and two sequences for the hepatic factor HNF3 (at 402, TTAAATATTTTCTTT; and at 385, TAAAATATTTAATCT).18

Figure 1 Characterization of the transcription start site of human C7 gene by RACE 5. The figure shows the autoradiography corresponding to the sequence of the 50 UTR of the C7 gene in human liver. C7 has a single transcription start site in liver located 115 nucleotides upstream from the ATG.

55

Functional analysis of C7 promoter RT-PCR and ELISA were used to assess C7 expression in two hepatoma cell lines (Hep-G2 and Hep-3B) and the fibroblasts cell line M1. C7 RNA and protein (94 7 80 ng/106 cells/48 h) were only detected in Hep3B cells. No expression of C7 was detected in M1 and Hep-G2 cells (data not shown). To determine whether the 1 kb 50 flanking the necessary elements for basal C7 promoter activity, serial 50 deletion of the C7 promoter were constructed by PCR and cloned upstream of the promoter-less luciferase reporter gene (pGL2-Basic). Hep-3B, Hep-G2 and M1 cells were cotransfected with the 50 deletion promoter constructs and pRL-TK. None of the promoter deletions were able to induce promoter activity in M1 and Hep-G2 (data not shown). C7 promoter constructs were only able to promote

Figure 2 DNA sequence and analysis of the human C7 promoter. The transcriptional start site is set as +1. Putative sequence elements are underlined and the transcription start site is labelled with an arrow. Genes and Immunity


56 Relative Luciferase Activity

+102 -911 -522 -241 -67 -41 -29 +19 -29 pGL2

luc

9

+

1

luc

9

+

1

luc

13 + 3

luc

30 + 6

luc

59 + 5

luc

66

+

luc

1

luc

1

7

Figure 3 Effects of the deletion of the C7 promoter reporter plasmid in Hep-3B cells. The figure shows the structure of the constructs containing deletions of the 50 flanking region of the human C7 gene. The luciferase activities of the C7 promoter constructs were normalized using the co-transfected plasmid pRL-TK. Relative luciferase activity was determined comparing the luciferase activity of cells transfected with the promoter-less pGL2-basic luciferase plasmid. The data show the mean and the standard deviation of five different experiments.

transcription in Hep-3B cells (Figure 3). Deletion from 241 to 67 resulted in a marked increase in promoter activity, suggesting the presence of a negative regulatory element in this sequence. Further deletion from 67 to 29 does not affect promoter activity. However, the deletion between +102 and +19 decreased promoter activity near to baseline. These data suggest that the regulatory elements important for basal C7 activity are contained between 29 and +102 and that these sequences are negatively regulated by the segment 241/67. Identification of the sequence essential for driving transcription in Hep-3B cells In an attempt to determine the transcription factors that are responsible for the transcription activity of the C7 promoter, we conducted a series of gel retardation experiments using an end-labelled probe corresponding to the C7 sequence +19/+102. This probe was incubated with similar amounts of nuclear extracts from M1, HepG2 and Hep-3B cells. As shown in Figure 4 one complex appeared exclusively with the Hep-3B nuclear extract. Competition experiments were carried out with a 100fold molar excess of unlabeled double-stranded oligonucleotide PE1 which spans 77 to 55 of the C6 promoter and includes a functional C/EBP site;19 and an oligonucleotide PE2 which spans +38 to +60 of the C7 promoter and includes the putative C/EBP site. Both oligonucleotides compete with the complex, suggesting that a transcription factor or factors bind to the C/EBP site at +42 in the C7 promoter. C/EBPa is not expressed in Hep-G2.19 To analyse whether C/EBPa plays a role in C7 expression and Genes and Immunity

Figure 4 EMSA. The labelled probe +19/+102 of the C7 promoter was incubated with nuclear extracts from Hep-G2 and Hep-3B cells. One complex appeared exclusively with Hep-3B extracts. This complex competed efficiently by a 100-fold molar excess of oligonucleotide PE1 (which spans 77 to 55 of the C6 promoter and includes a functional C/EBP site) and PE2 (which spans the +38/+60 of the C7 gene and includes a putative C/EBP site).

whether its absence in Hep-G2 is responsible for the lack of C7 expression in these cells, Hep-G2 was transfected with a C/EBPa expression vector (hCMV-C/EBPa) and the expression of C7 was analysed. The transfection of the C/EBPa expression vector restored the expression of C7 to both mRNA and protein (Figure 5A). To assess the effect of C/EBPa at a transcriptional level, Hep-G2 was


57

Figure 5 Transactivation of C7 by the C/EBPa expression vector (hCMV-C/EBPa). (a) Hep-G2 cells were transfected with the C/EBPa expression vector and mRNA expression of C7 and the constitutive gene GAPDH were analysed by RT-PCR at 4, 12, 24, 48 and 72 h. (b) HepG2 cells were cotransfected with the C7 promoter constructs and C/EBPa expression vector. The data show the mean and the standard deviation of three different experiments.

cotransfected with the hCMV-CEBPa and C7 reporter gene constructs. The expression vector dramatically transactivates the expression of the reporter gene (911/+102) (Figure 5B). The deletion of the promoter region from 911 to 29 did not affect the capacity of transactivation, but further deletion from +102 to +19 completely abolished the transactivation capacity of the expression vector.

Discussion In the present study we have analysed the tissue-specific regulation of human C7 in hepatic cells. For this purpose, the human C7 promoter was cloned and the transcription initiation site in liver and Hep-3B cells was mapped. To examine the cis-acting elements controlling the transcription of C7, a series of hybrid C7 promoter– luciferase constructs were generated. These constructs were able to promote transcription in a tissue-specific manner, suggesting that the regulation of the expression of C7 is primarily controlled by transcription. Our results suggest that the sequence between 29 and +102 retains the majority of the promoter sequence necessary to drive the transcription of C7 in a tissue-specific manner. This minimal promoter fragment includes a TATA box, the transcription start site, an NF1 site and part of the 50 UTR. The deletion between +102 and +19 decreased the expression of this minimal promoter to near baseline,

suggesting an essential role of this sequence in tissuespecific expression. EMSA analysis showed that a complex binds to this sequence in Hep-3B cells, but that complex is not present in M1 or Hep-G2 which do not express C7. A search for homology of the binding sequence with previously reported transcription factor binding sites showed that this fragment contains a sequence homologous to C/EBP (90% homology).16 A family of transcription factors may bind to the C/EBP sequence. Six different members of the family have been isolated and characterized (C/EBPa to z).20 All family members share highly conserved DNA binding specificity. They homodimerize or heterodimerize to bind to the C/EBP site. In spite of the fact that C/EBPa is a hepatic transcription factor, it is only expressed in terminally differentiated and growth-arrested cells, and not in proliferating cells or in the majority of cell lines. Hep-G2 cells contain roughly 5% of the C/EBPa content of hepatocytes. C/EBPa plays an essential role for the hepatic expression of several genes and low basal levels of expression of these genes in Hep-G2 have been reported.21,22 We have previously shown that the hepatic transcription factor C/EBPa plays an essential role for the hepatic expression of the terminal complement component C6.19 The binding of C/EBPa to a C/EBP sequence in the C6 promoter is essential for the hepatic expression of C6. C6 and C7 are mainly synthesized by the liver and are not synthesized by Hep-G2 cells. However, Hep-3B, which synthesizes C/EBPa, has Genes and Immunity


58

normal expression of C6 and C7. The competition experiments suggest that C/EBPa binds to the C/EBP sequence located at +42 in the C7 promoter and that it is part of the complex found in the EMSA experiments (Figure 4). These data suggest that C/EBPa may also play an essential role in C7 hepatic expression and that negligible expression of such in Hep-G2 is responsible for the lack of expression of C7 in this cell line. Accordingly, the transfection of Hep-G2 cells with the C/EBPa expression vector dramatically transactivated the transcription driven by the C7 promoter and restored the expression of C7. C7 expression is not increased in vivo in the course of an acute phase response.14 In agreement, we have not detected C7 induction in response to cytokines involved in the acute phase response (IL-1, IL-6, TNF-a and IFN-g) in Hep-G2 or Hep-3B cells (data not shown). The family of C/EBP transcription factors may also participate in this differentiated regulation. C/EBP transcription factors do not only participate in the liver-specific expression. In several genes, they are intermediates between liver-specific expression and acute phase response.23 In the human C3 promoter, C/EBPa is replaced by C/EBPd following IL1 stimulation and mediates IL1 responsiveness.24 C/EBPb also mediates the effect of IL6 in several acute phase genes.25 The induction of both C/EBPb and C/EBPd by inflammatory stimuli occurs in most of the tissues analysed including macrophages and granulocytes.23 Thus, the synthesis of C7, mainly by macrophages and polymorphonuclear cells, could also be specifically regulated by C/EBP family members at the site of inflammation. Further analysis is needed to clarify the regulation of terminal complement components.

Materials and methods Rapid amplification of cDNA ends (50 RACE) of human C7 The 50 end of the human C7 gene was determined with the 50 RACE using total cellular human liver and Hep-3B RNA as described elsewhere.26 The oligonucleotide (50 ATAGAAGTC CCACTGGCA 30 , located at +991) was used to generate 50 end dA-tailed cDNA. The cDNA was amplified by PCR using an adaptor primer (50 ATTTAGGTG ACACTATAGAATACGTCGACATCGATGG (dT18) 30 ) and primer (50 - AGAGGA GGCACTTGAAAAACTTTGGA 30 , located at +72). The PCR profile was 941C for 1 min and 35 cycles at 941C for 1 min, 601C for 1 min and 721C for 1 min followed by an extension at 721C for 5 min. The resulting PCR products were reamplified using the adaptor primer and GSP5 (50 AACTCTCCTATAAATCCCAC 30 , located at +47) with the follow cycling conditions: at 941C for 1 min and 35 cycles at 941C for 1 min, 501C for 1 min and 721C for 1min followed by an extension at 721C for 5 min. The PCR products were cloned into pBlue-Script vector and sequenced using M13 universal and reverse primers. Cloning of human C7 promoter The C7 promoter was isolated from an ICI Human YAC library.27 The YAC library was screened by PCR using the primers (sense: 50 GGGAGAGGCAGAGAGGCA 30 ; antisense: 50 TTCAGGGCAGAAGAGAGGAG GAA 30 ) specific for the human C7 sequence.1 The promoter Genes and Immunity

region was amplified from those YAC clones containing human C7 gene using the unpredictably primed PCR (UP-PCR).28 The nested primers (50 TTCAGGGCAGAAGAGAGG AGGAA 30 , located at +102 from the transcription start site, and 50 AAGATTTCC TCT GTAAGGG 30 , located at +81 from the transcription start site) specific for the 50 UTR of the C7 gene were used in combination with the adaptor primer C69 (150 (T)14GTTTGTTCT(G)7TT30 ). Primary PCR reactions were performed with C7-positive YAC DNA as template and GSP1 and C69 as primers at 941C for 1 min and 35 cycles at 941C for 1 min, 58–681C for 1 min and 751C for 1 min followed by an extension at 721C for 5 min. The primary PCR products were diluted 1:100 and 2 ml was reamplified with the nested primers GSP2 and C69. The PCR products were gel-purified and cloned in the EcoRV digested pBlue-Script plasmid. At least three different PCR products were sequenced from each PCR amplification. Analysis of transcription factor binding sites was made using the program TRANSFAC database.29 Analysis of C7 expression The ELISA procedure for the quantification of C7 has been described elsewhere.30 Two micrograms of total RNA was reverse transcribed using oligo(dT)18 primer and Superscript II reverse transcriptase (Life Technologies, Inc.) in a 20 ml reaction. The resulting cDNA was amplified using primer specific for the human C7 gene1 (sense: 50 GAGGGGTTGATGGAGGTTGGA G 30 , located at +1490; antisense: 50 CTGACAATGCATTTCCCCAACAAG 30 , located at +1881) GADPH21 (sense: 50 ATGGCCTTCCGTGTCCC 30 , located at 4371; antisense: 50 GAGCTTGACAAAGTGGTC G 30 , located at 4610). PCR reactions were performed at 941C for 1 min, 30 cycles at 941C for 1 min, 651C for 1 min, 721C for 1 min, followed by an extension step at 721C for 5 min. Generation of promoter–luciferase constructs Seven fragments containing various lengths of the human C7 promoter were obtained by PCR. The PCR products were cloned into the SmaI site of the promoterless pGL2-Basic firefly luciferase reported vector (Promega).19 The deletion constructs were sequenced prior to use in a reporter assay. Cell culture, transfection and luciferase assays The human hepatic cell lines Hep-G2, Hep-3B and a fibroblast cell line M1 were grown in DMEM medium supplemented with 10% of FCS. Confluent cells (40–60%) were cotransfected with the C7 promoter–luciferase vectors and pRL-TK (Promega) which contains the herpes simplex virus thymidine kinase promoter region upstream of the Renilla luciferase gene (ratio 50:1). Cells were transfected using LipoFectAMINE (Life Technologies, Inc.) The luciferase activities of the constructs were analysed 48 h after transfection using Dual-LuciferaseTM Reporter Assay system (Promega) and Turner Designs luminometer. The promoter activity was normalized using the cotransfected plasmid pRL-TK. Preparation of nuclear extracts and electromobility shift assay (EMSA) The method of Dignman et al,31 as modified by Andrews et al,32 was employed for the preparation of nuclear extracts. DNA binding reactions were performed as


described elsewhere.19 For competition experiments, a 100-fold molar excess of unlabelled competitor was preincubated with the nuclear extracts at 301C for 15 min before adding the radioactive probe.

Acknowledgements We thank Dr R Wuzner for providing us with the anti-C7 antibodies, Dr M Hobart for providing us with the YAC clones, Dr GJ Darlington for the kind gift of the C/EBPa expression vector and David H Wallace (Member of the Council of Biology Editors and the Association of European Science Editors) for critical revision of the manuscript. This work was supported in part by a Spanish Ministry of Health grant Fis 00/0208.

References 1 DiScipio RG, Chakravarti DN, Muller-Eberhard HJ, Fey GH. The structure of human complement component C7 and C5b7. J Biol Chem 1988; 264: 549–560. 2 Podack ER, Tschopp J. Membrane attack by complement. Mol Immunol 1984; 21: 589–603. 3 Wuzner R, Joysey V, Lachmann P. Complement component C7. Assessment of in vivo synthesis after liver transplantation reveals that hepatocytes do not synthesize the majority of human C7. J Immunol 1994; 152: 4624–4629. 4 Naughton M, Walportm M, Wuzner R et al. Organ-specific contribution to circulating C7 levels by the bone marrow and liver in humans. Eur J Immunol 1996; 26: 2108–2112. 5 Morris KM, Aden DP, Knowless BB, Colten HR. Complement biosynthesis by the human-derived cell line Hep-G2. J Clin Invest 1982; 70: 906–913. 6 Perisutti S, Tedesci F. Effect of cytokines on the secretion of the fifth and eighth complement components by Hep-G2 cell. Int J Clin Lab Res 1994; 70: 906–911. 7 Wuzner RA, Orren A, Lachmann PJ. Inherited deficiencies of terminal components of human complement. Immunodefic Rev 1992; 3: 123–147. 8 Hogansen AK, Wuzner R, Abrahamsen TG, Dierich MP. Human polymorphonuclear leucocytes store large amounts of terminal complement components C7 and C6, which may be released on stimulation. J Immunol 1995; 154: 4734–4740. 9 Gasque P, Fontaine M, Morgan BP. Complement expression in human brain. Biosynthesis of terminal pathway components and regulators in human glial cells and cell lines. J Immunol 1995; 154: 4726–4733. 10 Langeggen H, Pausa M, Johnson E, Casarsa C, Tedesco F. The endothelium is an extrahepatic site of synthesis of the seventh component of the complement system. Clin Exp Immunol 2000; 121: 8–10. 11 Thomas A, Gasque P, Vaudry D, Gonza´lez B, Fontaine M. Expression of a complete and functional complement system by human neuronal cells in vitro. Int Immunol 2000; 12: 1015–1023. 12 Pettersen HB, Johnson E, Hetland G. Human alveolar macrophages synthesize active complement components C6, C7 and C8 in vitro. Scand J Immunol 1987; 25: 567–570. 13 Houle JJ, Leddy JP, Rosenfeld SI. Secretion of the terminal complement proteins C5–C9, by human platelets. Clin Immunol Immunopathol 1989; 50: 385–393.

59 14 Thomson RA, Lachmann PJ. The complement-mediated lysis of unsensitized cells. J Exp Med 1970; 131: 643–657. 15 Catala F, deBoer E, Habets G, Grosveld F. Nuclear protein factors and erythroid transcription of the human A gammaglobin gene. Nucleic Acid Res 1989; 17: 3811–3827. 16 Lee W, Haslinger A, Kearim M, Tjian R. Activation of transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40. Nature 1987; 325: 368–372. 17 Landschulz WH, Johnson PJ, Adahi EY, Graves BJ, McKnight SL. Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 1988; 2: 786–800. 18 Overdier DG, Porcella A, Costa RH. The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino acid residues adjacent to the recognition helix. Mol Cell Biol 1994; 14: 2755–2766. 19 Gonza´lez S, Lo´pez-Larrea C. Characterization of the human C6 promoter. Requirement of the CCAAT enhancer binding protein binding site for C6 gene promoter activity. J Immunol 1996; 157: 2282–2290. 20 Lekstrom-Himes J, Xanthopoulos KG. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem 1998; 273: 28545–28548. 21 Agellon LB, Zhang P, Jiang XC, Mendelsohn L, Tall AR. The CCAAT/Enhancer binding protein trans-activates the human cholesteryl ester transfer protein gene promoter. J Biol Chem 1992; 267: 22336–22339. 22 Birkenmeier EH, Gwynn B, Howard S et al. Tissue-specific expression developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev 1989; 3: 1146–1156. 23 Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem 1988; 273: 29179–29182. 24 Juan TS, Wilson DR, Wilde MD, Darlington GJ. Participation of the transcription factor C/EBPd in acute-phase regulation of the human gene for complement component C3. Proc Natl Acad Sci USA 1993; 90: 2584–2588. 25 Akira S, Isshiki H, Suguita T et al. A nuclear factor for IL6 expression (NF-IL6) is a member of C/EBP family. EMBO J 1990; 9: 1897–1906. 26 Frohman MA, Dush MK, Martin GR. Rapid production of fulllength cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 1988; 85: 8998–9002. 27 Anand R, Riley JH, Butler R, Smith JC, Markam AF. A 3.5 kb genome equivalent multi-access YAC library: construction, characterisation, screening and storage. Nucleic Acid Res 1990; 18: 1951–1956. 28 Domı´nguez O, Lo´pez-Larrea C. Gene walking by unpredictable primed PCR. Nucleic Acid Res 1994; 15: 3247–3248. 29 Wingender E, Chen X, Hehl R et al. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acid Res 2000; 28: 316–319. 30 Wuzner R, Nitze R, Gotze O. C7*9, a new frequent allele detected by an allotype-specific monoclonal antibody. Complement Inflamm 1990; 7: 290–297. 31 Dingam J, Lobovitz R, Roeder R. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acid Res 1983; 11: 1475–1489. 32 Andrews N, Faller D. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting number of mammalian cells. Nucleic Acid Res 1991; 19: 2499.

Genes and Immunity