A Conserved C-Terminal Sequence That Is Deleted in v-ErbA Is ...

Vol. 13, No. 6

MOLECULAR AND CELLULAR BIOLOGY, June 1993, p. 3675-3685 0270-7306/93/063675-11$02.00/O Copyright © 1993, American Society for Microbiology

A Conserved C-Terminal Sequence That Is Deleted in v-ErbA Is Essential for the Biological Activities of c-ErbA (the Thyroid Hormone Receptor) FAHRI SAATCIQGLU,1 PETR BARTUNEK,2 TILIANG DENG,1 MARTIN ZENKE,2 AND MICHAEL KARIN"*

Department of Pharmacology, Center for Molecular Genetics, School of Medicine, University of California, San Diego, La Jolla, California 92093-0636,1 and Research Institute of Molecular Pathology, A-1030 Vienna, Austria2 Received 28 December 1992/Returned for modification 27 January 1993/Accepted 12 March 1993

The thyroid hormone (T3) receptor type alpha, the c-ErbAa proto-oncoprotein, stimulates transcription of T3-dependent promoters, interferes with AP-1 activity, and induces erythroid differentiation in a liganddependent manner. The v-ErbA oncoprotein does not bind hormone and has lost all of these activities. Using c-ErbA/v-ErbA chimeras, we found that a deletion of 9 amino acids, conserved among many members of the nuclear receptor superfamily, which are located at the extreme carboxy terminus of c-ErbAa is responsible for loss of both transactivation and transcriptional interference activities. Single, double, and triple amino acid substitutions within this region completely abolished T3-dependent transcriptional activation, interference with AP-1 activity, and decreased T3 binding by c-ErbAa. However, the lower T3 binding by these mutants does not fully account for the loss of transactivation and transcriptional interference, since a c-ErbA/v-ErbA chimera which was similarly reduced in T3 binding activity has retained both of these functions. Deletion of homologous residues in the retinoic acid receptor alpha (RARa) resulted in a similar loss of transactivation and transcriptional interference activities. The ability of c-ErbAa to induce differentiation of transformed erythroblasts is also impaired by all of the mutations introduced into the conserved carboxy-terminal sequence. We conclude that this 9-amino-acid conserved region is essential for normal biological function of c-ErbAca and RARce and possibly other T3 and RA receptors. In some, but not all, cell types, RAR may have a similar repressive activity in the absence of ligand (3). The v-erbA oncogene of avian erythroblastosis virus is an imprecisely transduced copy of its cellular homolog, the c-erbAa proto-oncogene (27, 50, 62). In addition to gagderived sequences in its N terminus, the v-ErbA protein has sustained small N- and C-terminal deletions, as well as 13 amino acid substitutions (50, 62). In animal cells, v-ErbA does not bind ligand and acts as a dominant repressor of transactivation by its cellular counterpart (10, 15, 51). In yeast cells, v-ErbA can bind ligand, albeit with highly reduced affinity, and activate transcription, presumably by interaction with other cellular factors (45). v-ErbA contributes to transformation of erythroid target cells by blocking terminal differentiation of both normal and transformed erythroblasts (20, 52, 53 [and references therein]). In addition, v-ErbA relieves transformed erythroblasts in culture from certain growth requirements (6, 34). Since c-ErbAa can regulate erythroid differentiation in a T3-dependent manner, it is thought that v-erbA blocks erythroid differentiation by the dominant interfering activity of its gene product (15, 52, 53, 67). The activities of c-ErbA and RAR proteins are modulated by interactions with other proteins. Retinoid X receptors form heterodimers with c-ErbA and RAR proteins that bind more efficiently to T3REs and RAREs, resulting in increased transcriptional activation (35, 38, 65, 68). On the other hand, the AP-1 complex composed of Jun homodimers and Jun/ Fos heterodimers (1, 7, 9, 47; for a review, see reference 2) interferes with transactivation by both c-ErbA and RAR (43, 52, 56, 69). Conversely, the c-ErbA and RAR proteins interfere with AP-1-mediated transactivation in a ligand-

Retinoic acid (RA) and thyroid hormone 3,5,3'-triiodo-Lthyronine (T3) have critical roles in development, growth, and differentiation (for a review, see reference 46). The actions of these hormones and potential morphogens are mediated by nuclear receptors which convert the signals generated by binding of these ligands into changes in transcription of specific target genes (for a review, see references 4, 16, and 29). Sequence comparison of cDNAs encoding the first identified T3 (50, 62) and RA (21, 44) receptors (cErbAa and RARa, respectively) indicated that these proteins belong to the nuclear receptor superfamily of transcription factors. Members of this superfamily, which includes additional T3 and RA receptors (i.e., c-ErbA,B, RARP, and RAR-y), have a distinct modular structure consisting of a highly conserved DNA binding domain in the middle and a moderately conserved C-terminal domain required for ligand binding and receptor dimerization (for a review, see references 4, 16, and 24). The binding sites for the c-ErbA and RAR proteins are flexible and include palindromic and direct repeats of the AGGTCA core motif (42, 60). Both c-ErbA and RAR are potent activators of genes whose promoters contain such binding sites, known as T3REs and RAREs, respectively (for a review, see reference 24). Although both receptors are constitutively nuclear and bind to their recognition sites in the absence of ligand, transactivation is strictly ligand dependent (for a review, see reference 24). However, in the absence of ligand, c-ErbA represses transcription of promoters that contain either T3REs or RAREs (10, 28, 50).

*

Corresponding author. 3675

3676

SAATCIOGLU ET AL.

dependent manner (56, 64, 69). Transcriptional interference in contrast to transactivation is not mediated by direct binding of c-ErbA and RAR proteins to DNA (64, 69) as was originally described for transcriptional interference between the glucocorticoid receptor and AP-1 (33, 55, 63). Interestingly, the v-ErbA oncoprotein is unable to interfere with AP-1 activity (12, 13, 47a). The loss of ability to interfere with AP-1 may be another important contributor to the oncogenic activity of v-ErbA, because AP-1 activity is required for cell proliferation (for a review, see reference 2). To more precisely delineate the structural and functional changes accounting for the oncogenic activity of v-ErbA, we constructed a series of c-ErbA/v-ErbA chimeras and thereby identified a short region at the C terminus of c-ErbA, which is deleted in v-ErbA, as the most critical element for both transactivation and transcriptional interference by c-ErbAa. Introduction of single and multiple amino acid substitutions within this region converts the wild-type c-ErbAca to a protein with v-ErbA activities. This region is also required for optimal ligand binding and for induction of erythroid differentiation. Furthermore, this short C-terminal region is conserved in other members of the nuclear receptor superfamily, and its deletion in RARao results in a similar loss of transactivation and transcriptional interference. In addition, deletion of this region converts RARa into a transcriptional repressor. Together, the data presented here have implications on the oncogenic activation of c-ErbAot and the mechanism of its interference with AP-1. MATERLILS AND METHODS Plasmids. The -73 COL-CAT (1) and 2XT3RE-tk-CAT (28) reporters have been described. Construction of the Cl to C5 v-ErbA/c-ErbA chimeras containing gag sequences was previously described (41). To generate the Cl to C5 chimeric expression vectors without gag sequences used in this study, the EcoRI fragments of Cl to C5 were cloned into the EcoRI site of pSG5 (30). The orientation was checked by multiple restriction digests and the expression of proper size protein products by in vitro transcription and translation (data not shown). The c-ErbAa coding region (49) was cloned into pSG5 as an EcoRI fragment (pSG5-CEA). A PstI-BamHI fragment of pSG5-CEA was cloned into Bluescript KS(+)II, and singlestranded phage DNA was generated by using helper phage K07. Single-stranded DNA was then used as template for site-directed mutagenesis with the oligonucleotides Ml (5'CACCTCGTGGTCCTTGAAGACCTTGAGGAAGAGGG3'), M2 (5'-CACCTCCTGGTCCACCAAGACCACGAGGA AGAGGG-3'), M3 (5'-CTCCTGGTCCTCGGAGGTCTCTA GGAAGAGGGG-3'), and M4 (5'-CTCCTGGTCCTCGGG GACCTCTAGGAAGAGGGG-3'). The initial screening for the mutants took advantage of the XhoI site that is destroyed in all mutants. The positive clones were then sequenced by the chain termination method. The PstI-BamHI fragments harboring the mutations were then subcloned back into pSG5-CEA to generate pSG5-M1 to M4. The recombinant retroviral vectors pNeo-C1 and pNeo-M1 to M4 were constructed by inserting the erbAspecific EcoRI fragment of pSG5-C1 and pSG5-M1 to M4, respectively (see above), into pSFCV-LE (19). Cell culture, transient transfection, and CAT assays. HeLa and CV1 cells were routinely maintained in Dulbecco's modified Eagle's medium (DMEM). For HeLa cells, the medium was supplemented with 9% bovine calf serum (BCS) and 1% fetal calf serum, and for CV1 cells, medium was

MOL. CELL. BIOL.

supplemented with 5% BCS. The calcium phosphate coprecipitation method was used for transfections. The transfected DNA included 3 ,ug of reporter plasmid, 1 to 3 pLg of the appropriate expression vector, and pUC18 to a total of 10 ,ug of DNA per 100-mm dish. After S to 8 h of incubation with the precipitates, the cells were shocked for 2 min with 10% glycerol in DMEM and washed once with phosphatebuffered saline (PBS). HeLa cells were then maintained in DMEM supplemented with 0.5% BCS in the absence or presence of 10' M T3. Tetradecanoyl phorbol acetate (TPA; 100 ng/ml) was added 24 h later, and after 14 h, cells were harvested. After glycerol shock, CV1 cells were maintained in DMEM containing 5% BCS in the absence or presence of 10-7 M T3 for 36 h and then harvested. Chloramphenicol acetyltransferase (CAT) enzyme activities were determined as previously described (26). Generation of erythroblast clones, induction of differentiation, and hormone binding assay. The origin and culture conditions of the erythroblast cell line HD3 (transformed by v-erbA + ts-v-erbB of ts34 avian erythroblastosis virus) were previously described (5). Erythroblast clones expressing the various mutant c-ErbA proteins Ml to M4 were generated by DEAE-dextran transfection of HD3 cells with respective retroviral vectors pNeo-M1 to M4 (see above) and subsequent selection of individual clones in semisolid methocel medium containing G418 (3 mg/ml) (15). Expression of c-ErbA proteins of selected erythroblast clones (six per construct) were verified by immunoprecipitation of [35S]methionine-labeled cell lysates with an ErbA-specific antibody (15, 25). The procedures for induction of erythroid differentiation of such clones in liquid culture were described before (15). In vivo T3 binding assays were performed as previously described (41, 50, 67). For these experiments, primary chick embryo fibroblasts were transfected with the retroviral vectors pNeo-M1 to M4 and pNeo-C1, and neomycin-resistant cells were selected in medium containing G418 (0.8 mg/ml) (19, 66). Cells were incubated in T3-depleted medium with 1 nM [12 I]T3 for 3 h in the presence and absence of a 100-fold molar excess of unlabeled hormone. The amount of bound radiolabeled hormone was determined as previously described (50). RESULTS A C-terminal deletion in v-ErbA is responsible for loss of transactivation and transcriptional interference. The c-ErbA proteins, but not v-ErbA, can activate transcription of promoters that contain T3REs (10, 15, 22, 51, 60). In addition, c-ErbA, but not v-ErbA, can inhibit activation of AP-1-dependent promoters in a T3-dependent manner (12, 13, 47a, 69). An N-terminal deletion mutant of v-ErbA, termed v-ErbA*, that lacks viral gag sequences and is therefore equivalent in its overall structure to chicken c-ErbA, was deficient in transactivation of the T3-dependent reporter 2XT3RE-tk-CAT (69), a well-established reporter for c-ErbA and RARs. Similar results were obtained with the naturally occurring T3RE of the myosin heavy-chain gene (MHC-tk-CAT [69; data not shown]). v-ErbA* was also deficient in transrepression of the AP-1-dependent reporter -73 COL-CAT (1). This is demonstrated by the results of the cotransfection experiments shown in Fig. 1. Although this figure only shows the results obtained with HeLa cells, similar findings were also obtained in CV1 and NIH 3T3 cells (data not shown). These results indicate that the gag sequence is not responsible for the altered activities of v-ErbA.

ONCOGENIC ACTIVATION OF c-ErbAot

VOL. 13, 1993

T3RE

AP-1

T3 Empty Expression Vector

+

36(7)

33(6)

61(15) 63(16)

12(3)

100(18)

100(23) 12(4)

v-ErbA

17(4)

15(4)

124(18) 115(20)

v-ErbA*

17(3)

20(2)

120(20) 115(24)

16(4)

14(3)

55(12)

LIGAND

DNA

c-ErbA

I

I

3677

11

I

65(11)

C1

I

I

C2

I

I

15(4)

18(3)

71(15) 76(20)

C4

I

I

13(2)

56(8)

95(12)

18(3)

51(9)

82(15) 28(6)

I I

CS

20(5)

FIG. 1. Mapping the structural changes that account for the different transcriptional properties of v-ErbA. To determine the structural changes that account for the different transcriptional activities of v-ErbA and chicken c-ErbAot, a series of chimeric protein constructs, diagrammed on the left, were generated. Open, hatched, and solid black boxes denote c-ErbAot, v-ErbA, and gag sequences, respectively. The locations of amino acid substitutions present in v-ErbA are denoted by the open circles. The various expression vectors encoding the wild-type and chimeric proteins (3 p.g each) were cotransfected into CV1 cells with the 2XT3RE-tk-CAT reporter (3 pg) to measure the ability of the proteins to activate transcription through a T3RE. After transfection, cells were incubated for 36 h in the absence (-) or presence (+) of T3 (10-' M) and harvested, and CAT activity was determined. To examine their ability to interfere with AP-1 activity, the various constructs (3 p,g each) were cotransfected into HeLa cells with the -73 COL-CAT reporter (3 xg). After transfection, the cells were incubated for 24 h in the absence (-) or presence (+) of T3 (10-7 M), and TPA (100 ng/ml) was added for additional 14 h to induce AP-1 activity. Results shown are the averages of three separate experiments done in each cell line. The maximal level of expression of 2XT3RE-tk-CAT was observed after cotransfection with wild-type c-ErbAot in the presence of T3 and was set as 100% for each experiment. The level of -73 COL-CAT expression in cells cotransfected with wild-type c-ErbAot in the absence of T3 was also set as 100% for each experiment. Other values are shown in percentages relative to these values. Standard deviations are indicated within parentheses.

To localize the region(s) in v-ErbA responsible for the loss of both activities, we utilized the series of chicken c-ErbA/vErbA* chimeras (41) illustrated in Fig. 1. These chimeric proteins were tested for their abilities to transactivate the T3-dependent reporter 2XT3RE-tk-CAT in CV1 cells. As observed before (3, 10, 51), both c-ErbAa and v-ErbA repressed expression of 2XT3RE-tk-CAT in the absence of T3 two- to threefold. v-ErbA* and all of the chimeras displayed similar repressive activity (Fig. 1). These results and Western blot (immunoblot) analysis (data not shown) indicate that all constructs were expressed to a similar extent, localized to the nucleus, and most likely bound DNA in the absence of T3. In the presence of T3, c-ErbAot, C4, and C5 stimulated expression of 2XT3RE-tkCAT three- to eightfold, whereas v-ErbA, v-ErbA*, Cl, and C2 did not. An essentially identical activity profile was displayed by these chimeras with a naturally occurring T3RE present in the MHC-tk-CAT reporter (data not shown). These results suggest that the 9-amino-acid region in the C terminus of c-ErbAa that is deleted in v-ErbA is indispensible for transactivation by either the wild-type or chimeric receptors. The chimeras were also tested for their abilities to interfere with AP-1 activity. An AP-1-dependent deletion derivative of the collagenase promoter fused to the CAT reporter gene, -73 COL-CAT, was cotransfected into HeLa cells with expression vectors specifying c-ErbAa, v-ErbA*, and the various chimeras. After transfection, the cells were kept

in low serum, treated with T3 for 36 h to activate the receptors, and treated with TPA for 14 h to increase AP-1 activity. While T3 had no effect on -73 COL-CAT expression in cells cotransfected with an empty expression vector, cotransfection with an expression vector specifying c-ErbAa, C4, or C5 led to a four- to eightfold decrease in -73 COL-CAT expression. However, no decrease in -73 COL-CAT expression was observed in cells cotransfected with a vector specifying v-ErbA, v-ErbA*, Cl, or C2 (Fig. 1). Interestingly, in the absence of T3, both c-ErbAax and v-ErbA* led to a small increase (twofold) in basal -73 COL-CAT expression. This stimulation was not observed with Cl and was weaker for C2, C4, and C5 (data not shown). Similar results were obtained with CV1 cells (data not shown). The stimulation of TPA-induced -73 COL-CAT stands in marked contrast to the repression of 2XT3RE-tkCAT expression by unliganded c-ErbAa and v-ErbA*. The basis for the stimulation of -73 COL-CAT expression is not clear at present. However, as published recently by Sharif and Privalsky (57), similar results were obtained in c-jun, v-erbA, and c-erbAot cotransfection experiments. For simplicity, Fig. 1 only shows the effects of the receptors on -73 COL-CAT expression in cells treated with TPA, an agent that stimulates AP-1 activity (2). However, similar effects were observed on basal -73 COL-CAT expression in the absence of TPA (Fig. 2a). Proteins containing the intact C-terminal region of c-ErbAot, such as the wildtype receptor and C5, but not v-ErbA*, Cl, or C2 (data not

3678

a

SAATCIOGLU ET AL.

MOL. CELL. BIOL. LIGAND

DNA

L111L

180-

I

160-

cc-ErbAa hc-ErbAaz

hc-ErbA,B 140-

I

120-

I

I--

e;100-

RARa RAR, RARy RXRa RXRF6 v-ErbA*

F P F P L P MP MP MP I D I D

P P P P P P T T

S p -

~E V IL~L 93 LLE L ! V E D Q E V* F LEVESD * LL L.IJQ E MI,Z N SE G IL.I.QE MLJE N SE G IL RZ MML Z NP EM EI M 3 MIL AAP H Q EZLMnM LEAP H Q - - - - - - - -Q E V*

408 410 456 419 412 421 419 419 387

._

ER GR PR MR AR

80-

LYDLa;L L3MILDAHRL

FPEaI.LAEII.TNQIP FPEIaX SZV IAAQLP

54 9 7 62 918 969 903

FPAIa,LV9IISDQLP F P E L15b A i I I S V Q V P FIG. 3. Sequence alignment of the c-ErbAa C terminus with the equivalent region of other nuclear receptors. All sequences are those of the human proteins except for cc-ErbAca, which is the chicken T3 receptor type alpha, RXRI which is from mouse, and v-ErbA. Stars represent the extreme C terminii of the proteins. The conserved hydrophobic residues are underlined, and the glutamic acid residues are highlighted. RXR, retinoid X receptor (31, 40); AR, androgen receptor; MR, mineralocorticoid receptor; PR, progesterone receptor. For references, see reference 16.

60 -

40-

20

0

T3

-E+ -b+

TPA

--+

c-ErbA

pSG5

+

-E+ b

+

+

+

-

v-ErbA*

b40] 301 ,s

? 20

10'

o, ne-

T3 TPA

-

+

-

-

-

+

pSG5

+ +

+

+

+ +

c-ErbAa

FIG. 2. Effects of ErbA proteins on AP-1 activity. (a) HeLa cells were cotransfected with the -73 COL-CAT reporter (3 jig) and the expression vectors specifying the production of the indicated ErbA proteins (3 ,ug each). Control transfections were done with equal amounts of the empty expression vector (pSG5). After transfection, the cells were incubated in the absence (-) or presence (+) of T3 (10-7 M) for 24 h and for an additional 14 h in the absence (-) or presence (+) of TPA (100 ng/ml) as indicated. The level of -73 COL-CAT expression in cells cotransfected with pSG5 in the absence of T3 and in the presence of TPA was set as 100% for each experiment. Error bars indicate standard deviations. (b) HeLa cells were cotransfected with the -60 COL-LUC reporter and empty expression vector pSG5 or c-ErbAa expression vector as indicated. Conditions are as for panel a, except that the level of expression was determined by the luciferase assay. Results shown are averages of two experiments done in duplicate.

shown), were able to interfere with both basal and TPAinduced AP-1 activity in HeLa cells (Fig. 2a). As with the TPA-induced levels, in the absence of T3, both c-ErbAao and v-ErbA* increased basal -73 COL-CAT expression approximately twofold, whereas C5 had no effect. In contrast, expression of -60 COL-LUC, in which the AP-1 site is deleted, was not induced by TPA and was not repressed by c-ErbAa in the absence of T3 (Fig. 2b). This indicates that it is the AP-1 binding site in the -73 COL-CAT which is the target for the repressive effect of the liganded c-ErbAa. Since expression of -60 COL-LUC was not significantly changed in the presence of c-ErbAao, in contrast to an approximately twofold increase in -73 COL-CAT expression, the AP-1 site may also be the target for this stimulation. Mutational analysis of the conserved C-terminal region. These results indicated that sequences that are located at the extreme C terminus of c-ErbAa and deleted in v-ErbA are functionally important. As pointed out before (67) and shown in Fig. 3, this region is conserved in many other members of the nuclear receptor superfamily. While this work was being prepared for publication, Danielian et al. (11) also reported the conservation of this region and its importance for transactivation by the estrogen (ER) and glucocorticoid (GR) receptors. This region has the potential to form a short, negatively charged amphipathic a helix (67). To test if this region is part of the c-ErbAa transcriptional activation domain, we fused the carboxy-terminal 208 residues (amino acid positions 200 to 408 [50]) of c-ErbAa to the DNA binding domain of GAL4 (amino acids 1 to 147) (48). In addition, we fused the entire ligand binding domain of c-ErbAa (amino acids 121 to 408) to the GAL4 DNA binding domain. While the GAL4(1-147)/ErbA(200-408) construct, containing only part of the ligand binding domain, failed to activate transcription of a 5XGAL4-tk-CAT reporter, either in the absence or presence of T3, the GAL4(1-147)/

VOL. 13, 1993

ONCOGENIC ACTIVATION OF c-ErbAa

3679

LIGAND

DNA

100-

c-ErbA

Ml M2 M3 M4

P L F L E V F E D - - - - R - - K - - - - V - L V - - - - - T S - P_ F___-p_

e

80-

405 405 405

._ '

60-

405

*: *, M

l,

405

40-

v

20

oU r3

pSG5

C 120.

d

c-ErbA

Cl

Ml

M2

M4

M3

200.

I

100.

I

150-

e 80*sn

IT

I T

60.

100-

C4 ps

40T T 50

0

pSG5 c-ErbA

MI

M2

M3

M4

T3

cE

pSG5

bm+

c-ErbA

C1

M1

M2

M3

M4

FIG. 4. Mutational analysis of the conserved C-terminal region of c-ErbAa. (a) The sequence of conserved C-terminal region of c-ErbAa and the various mutants are shown. For the mutants, only those residues which are replaced are shown. (b) The ability of the wild-type and mutant c-ErbAa proteins to stimulate transcription of the 2XT3RE-tk-CAT reporter was tested by transient cotransfection of CV1 cells with 3 p.g of expression vector and 3 pg of reporter plasmid. Transcriptional activation was measured 36 h after transfection and incubation in the absence (-) or presence (+) of T3 (10-' M). The results shown represent the averages of three different experiments. Transactivation by wild-type c-ErbAa in the presence of T3 was arbitrarily set as 100%. Error bars indicate standard deviations. (c) Same as for panel b, except MHC-tk-CAT has been used as the reporter. (d) The abilities of wild-type and mutant c-ErbAa proteins to interfere with AP-1 activity were tested by transient cotransfection of the various expression vectors (3 ,ug) with the -73 COL-CAT reporter (3 p1g) into HeLa cells. Cells were incubated in the absence (-) or presence (+) of T3 (10-7 M) for 24 h and then for 14 h in the presence of TPA (100 ng/ml). The results shown are the averages of three different experiments. The level of -73 COL-CAT expression in cells cotransfected with the wild-type c-ErbAa expression vector incubated without T3 was arbitrarily set as 100%. Error bars indicate standard deviations.

ErbA(121-408) construct was an efficient T3-dependent transactivator (47b). These results suggest that the C terminus of c-ErbAa does not contain an independent activation domain which is able to operate on its own in the presence or absence of hormone. It is possible that this short region requires additional sequences or ligand binding to adjacent sequences to assume a conformation which is transcriptionally active. The contribution of various residues within the conserved C-terminal region to the biological activities of c-ErbAa was examined by site-directed mutagenesis (Fig. 4A). The two conserved acidic amino acid residues, E401 and E404, were changed to basic (lysine) or hydrophobic (valine) residues (Ml and M2, respectively). Conversely, two conserved hydrophobic residues (V-402 and F-403) were replaced by hydrophilic serine and threonine residues (M3). In addition, F-403 was changed to proline to disrupt the putative a-helical structure of this domain (M4). Analysis of transcriptional

activation by these mutant receptors indicated that all of them lost the ability to stimulate expression of 2XT3RE-tkCAT and MHC-tk-CAT in CV1 cells (Fig. 4b and c), primary chick embryo fibroblasts, and transformed chicken erythroblasts (data not shown). Instead, all mutants displayed a v-ErbA-like phenotype, repressing basal levels of 2XT3REtk-CAT or MHC-tk-CAT expression two- to fourfold in the absence or presence of T3. In addition, all mutants had dominant negative activity over wild-type c-ErbAa, similar to that of v-ErbA (unpublished results). These results indicate that the mutant proteins were expressed and appropriately targeted to the nucleus. Recombinant Ml protein produced in Eschenichia coli had similar DNA-binding activity to the wild-type receptor in a mobility shift assay (data not shown), which suggests that the loss of transcriptional activity by the mutant proteins is not due to their impaired DNA binding. Mutant M2, containing three amino acid substitutions, showed a significantly stronger repressive

3680

SAATCIOGLU ET AL.

MOL. CELL. BIOL.

activity than the other mutants. All of the mutant proteins were efficiently expressed in vivo as demonstrated by immunoprecipitation analysis (see Fig. 6). Along with the loss of transactivation, all of the mutants also lost their ability to interfere with AP-1 activity after T3 treatment (Fig. 4d). In fact, all of the mutants, with the exception of M2, led to an approximately twofold increase in -73 COL-CAT expression similar to what has been observed for the unliganded wild-type receptor and v-ErbA* (see above). The conserved region is functionally important for RARa. To check if the conserved C-terminal region has an important functional role in the context of another nuclear receptor, we compared the activities of wild-type RARa to those of a mutant lacking the C-terminal region, RARa-A404 (22). We found that wild-type RARao stimulated transcription of the RA-dependent reporter 2XT3RE-tk-CAT approximately 5-fold in response to RA, while RARa-A404 repressed basal levels by about 10-fold in the presence or absence of RA (Fig. 5a). The repressive effect of RARao-A404 was specific to the RARE-containing reporter and was not observed on the collagenase (Fig. Sb) or Rous sarcoma virus (RSV) promoters (data not shown). Thus, RARa.-A404 acts as a constitutive repressor of an RA-responsive promoter, similar to the effect of v-ErbA on a T3-responsive promoter. That RARaA404 is efficiently expressed and binds to RAREs was demonstrated previously (22). Like GR and c-ErbA, RARs can also interfere with AP-1 activity (56, 64). To examine the effect of the C-terminal deletion on the ability of RARa to repress AP-1 activity, the AP-1-responsive -73 COL-CAT was cotransfected with RARac or RARa-A404 expression vectors or with an empty expression vector (RSVO) into HeLa cells. Cells were treated with TPA and/or RA, and CAT activity was determined. Figure Sb shows that RARa-A404 no longer interfered with AP-1 activity, whereas the wild-type receptor efficiently inhibited both basal and TPA-induced -73 COLCAT expression. The C terminus of c-ErbAa is indispensible for induction of erythroid differentiation. Next we attempted to evaluate the effect of C-terminal c-ErbAa mutations on erythroblast phenotype, the cell-type in which v-ErbA acts as an oncoprotein by blocking differentiation (20, 52-54). As a first step in that direction, the Ml to M4 mutants were stably expressed in the AEV (v-erbA + ts-erbB)-transformed erythroblast cell line HD3, in which the wild-type c-ErbAa protein induces terminal differentiation in response to T3 (15). The Ml to M4 mutants of c-ErbAao were cloned into a recombinant chicken retrovirus vector containing the neomycin resistance gene as a selectable marker (19). HD3 erythroblasts were transfected with these vectors and seeded into semisolid methocel medium for selection of G418-resistant colonies. Individual cell clones were analyzed for expression of the mutant c-ErbA proteins by immunoprecipitation with an ErbA-specific antibody (15). With the exception of small clonal variability, all of the mutant proteins were expressed in levels similar to that of wild-type c-ErbA (Fig. 6). Erythroblast clones efficiently expressing p75v-ErbA and the p46 mutant c-ErbA proteins were chosen for further analysis. To determine the biological activity of the c-ErbAot mutants, we analyzed several erythroblast clones expressing the Ml to M4 proteins for their abilities to differentiate in response to T3. Cells were either treated with T3 for 24 h or left untreated and were then incubated for 2 additional days under conditions which allow terminal differentiation into

a 12010080>1

60-

04 40-

T

200

RA

R

RSVO

RARa -A404

RARa

II

b 120100

I -

i, 80._

6 Cd

40 -

20

-

20 RA TPA

-

+

-

-

-

+

RSVO

+ +

-

+

-

-

+

RARa

+ +

-

+ -

+ + +

RARa-A404

FIG. 5. The conserved C-terminal region of RARa is required for its ability to stimulate transcription and to interfere with AP-1 activity. (a) To examine transcriptional activation, expression vectors specifying either wild-type RARa or RARa-A404 or the empty expression vector RSVO (3 pg of each plasmid) were cotransfected with the 2XT3RE-tk-CAT reporter (3 pg) into CV1 cells. The cells were incubated for 36 h in the absence (-) or presence (+) of RA (10-6 M). The averages of three different experiments are shown. The level of activation by wild-type RARot in the presence of RA was set as 100%. Error bars indicate standard deviations. (b) To examine transcriptional interference with AP-1 activity, the different expression vectors (3 pg of each) were cotransfected with the -73 COL-CAT reporter (3 p.g) into HeLa cells. Cells were incubated in the absence (-) or presence (+) of RA (10-6 M) for 24 h and then for 14 h in the presence of TPA (100 ng/ml), before harvesting and determination of CAT activity. The results shown are the averages of three experiments; the level of -73 COL-CAT expression in TPA-plus RA-treated cells cotransfected with the empty expression vector (RSVO) set as 100%. Error bars indicate standard deviations.

erythrocytes (15). As shown in Fig. 7, a control clone expressing the wild-type c-ErbAao differentiates under these experimental conditions in response to T3 into mature erythrocytes (65% fully mature erythrocytes, 30% late reticulocytes, and 15% early reticulocytes, as judged by hemoglobin expression and cell morphology). However, none of the erythroblast clones expressing the mutant c-ErbA proteins

VOL. 13, 1993

ONCOGENIC ACTIVATION OF c-ErbAat

3681

TABLE 1. Specific T3 binding of the mutant c-ErbAa proteins in vivo'

c-erbA MIM2M3M4 WT-

___m4

_"0

.0p75

v-erbA

46c-erbA

12 3 4

5 6

FIG. 6. Expression of wild-type and mutant c-ErbA proteins in transformed erythroblasts. HD3 erythroblast clones expressing wild type (WT) and mutant p46c-ErbA (Ml to M4) proteins together with p75v-ErbA were analyzed by [35S]methionine labeling and immunoprecipitation as described in Materials and Methods. An HD3 clone stably transfected with the empty pSFCV-LE vector and expressing p75v-ErbA is shown as a control.

underwent terminal differentiation in response to T3 (Fig. 7, and data not shown). These results suggest that the point mutations introduced into the conserved C-terminal region abolish the ability of c-ErbAox to induce erythroid cell differentiation. To investigate the hormone binding properties of the

FIG. 7. T3-dependent induction of differentiation of v-erbAtransformed erythroblast clones that express c-ErbAcx and mutants Ml and M4. HD3 erythroblast clones expressing wild-type (WT) (clones 12 and 13) and mutant c-ErbA proteins Ml and M4 were treated with T3 or left untreated under conditions which allow erythroid differentiation (see Materials and Methods). Cytospin preparations of these cells were stained with neutral benzidine and histological dyes and photographed under blue light to reveal the

hemoglobin content.

Protein

Specific binding"

Wild-type c-ErbAa Ml M2 M3 M4 C1 C5 v-ErbA Wild-type CEF

19.7 2.5 2.2 4.2 3.1 4.1 5.5 1.4 0.8

% Specific binding' (SD) 100.0 17.8 (3.1) 17.8 (2.7) 24.5 (1.1) 13.5 (1.1) 21.3 (6.5) 24.3 (3.0) 10.7 (3.2) 8.3 (1.7)

a T3 binding assays (41, 50) were performed on chicken embryo fibroblasts (CEFs) stably expressing wild-type c-ErbAa, Ml, M2, M3, M4, Cl, CS, v-ErbA, or wild-type CEFs as indicated. b Ratio between the amount of [1251I]T3 bound in the absence or presence of a 1,000-fold molar excess of unlabeled T3 as competitor. Average of triplicate values of a representative experiment are shown. c Average relative values of T3-specific binding from three independent experiments done in triplicate are shown as percentages of the binding activity of wild-type c-ErbA, set arbitrarily at 100%.

mutant and chimeric c-ErbA proteins, T3 binding studies were performed with proteins stably expressed in chick embryo fibroblasts. The Ml to M4 mutants and the Cl and C5 chimeras exhibited a reduced but still appreciable T3 binding activity, ranging between 13 to 24% of the binding activity exhibited by the wild-type receptor (Table 1). Thus, all of the mutations introduced into the conserved C-terminal region of c-ErbAaL diminish but do not abolish T3 binding activity. Most importantly, the T3 binding properties of the transcriptionally active C5 chimera were not significantly different from those of the transcriptionally inactive M3 mutant and the Cl chimera. Previous studies (41, 67) have shown that dissociation constants for Cl and C5 are about the same (5.6 and 4.8 nM, respectively), in accord with the T3 binding data in Table 1.

DISCUSSION We have identified a short region located at the extreme C terminus of c-ErbAa that is deleted in v-ErbA as an important determinant of receptor function. Deletion of this sequence, which is conserved among other members of the nuclear receptor family or introduction of single and multiple amino acid substitutions within it interferes with the ability of c-ErbAa to activate transcription of a T3-dependent reporter. The analysis of c-ErbA/v-ErbA chimeras indicates that deletion of this region is responsible for the inability of v-ErbA to activate transcription of T3-responsive genes. On the other hand, replacing the C-terminal deletion in v-ErbA by c-ErbA-specific sequences reconstitutes T3 receptor function. Such a c-ErbA/v-ErbA chimera (C5) is capable of activating transcription in a T3-dependent manner and is only twofold less potent than the wild-type receptor. Furthermore, mutant proteins with single-amino-acid substitutions within this short C-terminal region displayed a v-ErbAlike phenotype in their transcriptional properties. Therefore, the other mutations present in v-ErbA make only a minor contribution to its impaired transactivation potential. These results are in contrast to previous findings in which changes within the DNA binding domain of v-ErbA were implicated for its inability to activate transcription (61). In addition to activating transcription, certain nuclear receptors can interfere with AP-1 activity (14, 33, 39, 55, 58,

3682

SAATCIOGLU ET AL.

63, 64, 69). In the case of c-ErbA, sequences required for this activity were localized to the ligand binding domain, and v-ErbA was shown to be incapable of interfering with AP-1 activity (12, 13, 47a, 69). We extended these findings by showing that the conserved C-terminal region is required for interference with AP-1 activity and that its loss is responsible for lack of transcriptional interference by v-ErbA. Since the loss of both transactivation and transcriptional interference is thought to be important for the oncogenic activity of v-ErbA (12, 66, 67), the deletion of the conserved C-terminal region is likely to have a major role in the oncogenic activation of c-ErbAa. The same region is also absolutely required for the ability of c-ErbAa to induce erythroid differentiation in response to T3. The homologous region in RARa, which may also have a role in erythroid differentiation and transformation (12), is also important for both transactivation and transcriptional interference. As in the case of c-ErbAa and v-ErbA, deletion of this region converts RARa from a hormone-dependent activator of RA-responsive promoters to a constitutive transcriptional repressor of such promoters. Function of the C-terminal region. The conserved C-terminal region has the potential to form a short, amphipathic a helix (67). However, its exact structure within the context of the intact receptor is unknown. The function of the conserved region was probed by site-directed mutagenesis. Substitution of one of the conserved hydrophobic residues (F-403) by a proline residue was sufficient to convert c-ErbAa to a protein with v-ErbA-like activity. This mutant, M4, was defective both in transactivation of a T3-responsive reporter and interference with AP-1 activity. Similar effects were observed by replacing two conserved hydrophobic residues (V-402 and F-403) with hydrophilic serine and threonine residues (M3) and substitution of the two conserved acidic residues (E-401 and E-404) by either basic (lysine) or hydrophobic (valine) residues (Ml and M2, respectively). These results underscore the functional importance of the short C-terminal region. Deletion of the same region in RARa had essentially identical consequences on receptor function. While this work was being completed, we learned that Danielian et al. (11) also recognized the importance of this C-terminal region because of its conservation among a large number of nuclear receptors. Those authors demonstrated that this region is involved in transactivation by ER and GR. Although substitutions of the conserved acidic residues had little effect on ER activity, substitution of the hydrophobic residues of the putative amphipathic a helix resulted in decreased transactivation by either ER or GR. Since in the context of both ER and GR, none of the mutations had a severe effect on ligand binding, Danielian et al. (11) concluded that the conserved C-terminal region constitutes an important part of the C-terminal ligand-dependent activation domain, known as TAF-2 (for references, see reference 11). The same authors concluded that the C-terminal region is not important for ligand binding and suggested that this region may have similar functions in other family members. Our results confirm that the conserved C-terminal region is important for transactivation by both c-ErbAa and RARa and that any changes introduced in this region in c-ErbAa completely abolish transactivation. This is in contrast to equivalent mutations in ER which retain substantial transactivation ability. All of the c-ErbAa mutants we have tested exhibited a diminished but still appreciable T3 binding activity, consistent with earlier reports which have demonstrated that additional residues in the ligand binding domain

MOL. CELL. BIOL.

are involved in hormone binding by c-ErbAao (32, 41). The effect of these mutations on ligand binding is more severe than the effect of similar mutations within the equivalent regions of ER, which only slightly decreased estradiol binding and retained substantial transactivation ability. Taken together, these results show that C terminus of c-ErbAa is indispensible for transactivation and important for efficient ligand binding. However, decreased ligand binding cannot fully explain the transcriptional defect of these mutants, as the transcriptionally inactive M3 mutant and Cl chimera were no more defective in ligand binding than the transcriptionally active C5 chimera. Although C5 exhibited only 24% of wild-type T3 binding activity, it was only reduced twofold in its ability to activate T3-dependent promoters or to interfere with AP-1 activity. The present findings have implications for interference between AP-1 and nuclear receptors. Previous studies on interference between AP-1 and the GR and RAR resulted in somewhat different findings and interpretations (14, 33, 39, 43, 55, 56, 58, 63, 64, 70). Three mechanisms were proposed to account for this phenomenon. (i) The two factors prevent each other from binding to their respective response elements. Even though in vitro binding studies support this possibility (55, 56, 63, 64, 70), genomic footprinting experiments showed no changes in the binding of AP-1 to its recognition site in the collagenase promoter in vivo after treatment with glucocorticoids (37). (ii) The receptor and AP-1 interact directly to block each other's transactivation potential. While some groups were able to demonstrate such interactions (14, 63, 64), others have failed (39, 55, 58). So far, we have not detected an interaction between c-ErbAa and c-Jun in coimmunoprecipitation experiments (unpublished results). (iii) The receptor and AP-1 compete for an important cofactor required for efficient activation by either protein. This mechanism is most consistent with the results presented in this paper. The ability to interfere with AP-1 activity is lost after single-amino-acid substitutions within the C terminus of c-ErbAa which abolish its ability to activate transcription of T3-responsive promoters but only partially interfere with ligand binding. This suggests that the C terminus of c-ErbAa could be the site of interaction with a cofactor which is also required for efficient activation by AP-1. Our finding that a mutant of RARa lacking the homologous C-terminal region, RARa-A404, which is transcriptionally inactive can no longer interfere with AP-1 supports this hypothesis. However, we do not know if RARa-A404 binds RA efficiently and therefore cannot conclude whether its inability to interfere with AP-1 is due to lack of transactivation potential or inability to bind ligand. As mentioned above, reduced ligand binding cannot account for the complete loss of transcriptional interference ability by c-ErbA mutants, such as Cl and M3. The role of the C-terminal region in oncogenic activation. By introducing single- and double-amino-acid substitutions into the conserved C-terminal region of c-ErbAa, we hoped to dissociate its transactivation from its transcriptional interference function and determine loss of which function is most important for oncogenic activation. However, all of the mutants were defective in both functions. In addition, like v-ErbA, all of the mutants were constitutive repressors of T3-dependent reporters. Therefore, because of the lack of appropriate mutants, we are unable at the time being to determine which of the three different activities is most important for v-ErbA-mediated oncogenesis. It is quite possible, however, that loss of transactivation and transcriptional interference as well as gain of a constitutive repressor

ONCOGENIC ACTIVATION OF c-ErbAa

VOL. 13, 1993

activity all make important contributions to the oncogenic activity of v-ErbA. The lack of transactivation and ability to repress expression of T3-inducible genes seem to be important for blocking erythroblast differentiation, because c-ErbAa has an important positive role in this process and is involved in the induction of several erythroid differentiation markers (52, 53, 66). In addition, the lack of interference with AP-1 may be important for full v-ErbA oncogenic potential, since its capacity to arrest erythroid cell differentiation requires cooperation with activated tyrosine kinases (52). Constitutively activated tyrosine kinases, such as v-Src, are known to stimulate AP-1 activity (2, 59), which is required for stimulation of cell proliferation (for a review, see reference 2). While it is difficult to sort which lost or gained function is most important for the oncogenic potential of v-ErbA, our results strongly suggest that the deletion of the conserved C-terminal region had a major role in its oncogenic activation. These conclusions are different from those of previous studies which suggested that amino acid substitutions within the DNA binding domain of c-ErbAa have an important role in its transactivation potential and oncogenic activation (8, 61). While wild-type c-ErbAa can induce terminal differentiation of v-ErbA-transformed erythroblasts (15; this work), none of the C-terminal mutants was able to induce erythrocyte differentiation (Fig. 7). This is consistent with previous studies of c-ErbA/v-ErbA chimeras which demonstrated that proteins containing the C-terminal deletion are also defective in induction of erythroid differentiation (67). These findings raise the interesting possibility that inactivation of the C-terminal region of c-ErbA by single- or double-amino-acid substitutions might be sufficient to confer oncogenic potential on c-ErbA when overexpressed within a retrovirus. This is an important point, because v-ErbA has also sustained multiple point mutations within both the DNA and hormone binding domains, the functions of which are poorly understood at present. Experiments examining this possibility are in progress. ACKNOWLEDGMENTS We are grateful to A. Munoz for recombinant plasmids, Chris Glass for the RARa and RARa-A&404 constructs, and Jacques Ghysdael for anti-ErbA-specific antiserum. F.S. and T.D. are recipients of postdoctoral fellowships from the Tobacco Related Disease Research Program of the University of California. Research was supported by grants from the National Institutes of Health (PO1 CA 50528-03 and P01 HL35018-06) to M.K. and from the Fond zur Forderung der wissenschaftlichen Forschung (FWF) to M.Z.

6. Beug, H., P. Kahn, G. Doderlein, M. J. Hayman, and T. Graf. 1985. Characterization of hematopoietic cells transformed in vitro by AEV-H, an erbB-containing avian erythroblastosis virus, p. 290-297. In R. Neth et al. (ed.), Modern trends in human leukemia VI Springer-Verlag, Heidelberg, Germany. 7. Bohman, D., T. J. Bos, A. Admon, T. Nishimura, P. K. Vogt, and R. Tjian. 1987. Human proto-oncogene c-jun encodes a DNA binding protein with structural and functional properties of transcription factor AP-1. Science 238:1386-1392. 8. Bonde, B. G., M. Sharif, and M. L. Privalsky. 1991. Ontogeny of the v-erbA oncoprotein from the thyroid hormone receptor: an alteration in the DNA binding domain plays a role crucial for v-erbA function. J. Virol. 65:2037-2046. 9. Chiu, R., W. J. Boyle, J. Meek, T. Smeal, T. Hunter, and M. Karin. 1988. The c-Fos protein interacts with cJun/Ap-1 to stimulate transcription from AP-1 responsive genes. Cell 54:

541-552. 10. Damm, K., C. C. Thompson, and R. M. Evans. 1989. Protein encoded by v-erbA functions as a thyroid hormone receptor antagonist. Nature (London) 339:593-597. 11. Danielian, P. S., R. White, J. A. Lees, and M. G. Parker. 1992. Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11:1025-1033. 12. Desbois, C., D. Aubert, C. Legrand, B. Pain, and J. Samarut. 1991. A novel mechanism of action for v-ErbA: abrogation of the inactivation of transcription factor AP-1 by retinoic acid and thyroid hormone receptors. Cell 67:731-740. 13. Desbois, C., B. Pain, C. Guilhot, M. Benchaibi, M. French, J. Ghysdael, J.-J. Madjar, and J. Samarut. 1991. v-erbA oncogene abrogates growth inhibition of chicken embryo fibroblasts induced by retinoic acid. Oncogene 6:2129-2135. 14. Diamond, M. I., J. Miner, S. K. Yoshinaga, and K. Yamamoto. 1990. Transcriptional factor interactions: selectors of positive and negative regulation from a single DNA element. Science 249:1266-1272. 15. Disela, C., C. Glineur, T. Bugge, J. Sap, G. Stengl, J. Dodgson, H. Stunnenberg, H. Beug, and M. Zenke. 1991. v-erbA overexpression is required to extinguish c-erbA function in erythroid cell differentiation and regulation of the erbA target gene CAII. Genes Dev. 5:2033-2047. 16. Evans, R. M. 1988. The steroid and thyroid hormone receptor superfamily. Science 240:889-895. 17. Forman, B. M., and H. H. Samuels. 1990. Interactions among a subfamily of nuclear hormone receptors. Mol. Endocrinol. 4:1293-1301. 18. Forman, B. M., C. R. Yang, M. Au, J. Casanova, J. Ghysdael,

19.

REFERENCES 1. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin. 1987. Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729-739. 2. Angel, P., and M. Karin. 1991. The role of Jun, Fos and the AP-1 complex in cell proliferation and transformation. Biochim. Biophys. Acta 1072:129-157. 3. Baniahmad, A., A. C. Kohne, and R. Renkawitz. 1992. A transferable silencing domain is present in the thyroid hormone receptor, in the v-erbA oncogene product and in the retinoic acid receptor. EMBO J. 11:1015-1023. 4. Beato, M. 1989. Gene regulation by steroid hormones. Cell 56:335-344. 5. Beug, H., G. Doederlein, C. Freudenstein, and T. Graf. 1982. Erythroblast cell lines transformed by a temperature-sensitive mutant of avian erythroblastosis virus: a model system to study differentiation in vitro. J. Cell. Physiol. Suppl. 1:195-207.

3683

20.

21. 22.

23.

and H. H. Samuels. 1989. A domain containing leucine zipperlike motifs mediate novel in vivo interactions between the thyroid hormone and retinoic acid receptors. Mol. Endocrinol. 3:1610-1626. Fuerstenberg, S., H. Beug, M. Introna, K. Khazaie, A. Munoz, S. Ness, K. Nordstrom, J. Sap, I. Stanley, M. Zenke, and B. Vennstrom. 1990. Ectopic expression of the erythrocyte band 3 anion-exchange protein, using a new avian retrovirus vector. J. Virol. 64:5891-5902. Gandnllon, O., P. Jurdic, P. Pain, C. Desbois, J. J. Madjar, M. G. Moscovici, C. Moscivici, and J. Samarut. 1989. Expression of the v-erbA product, an altered nuclear hormone receptor, is sufficient to transform erythrocytic cells in vitro. Cell 58:115-121. Giquere, V., E. S. Ong, P. Segul, and R. M. Evans. 1987. Identification of a receptor for the morphogen retinoic acid. Nature (London) 330:624-629. Glass, C. K., J. M. Holloway, 0. V. Devary, and M. G. Rosenfeld. 1988. The thyroid hormone receptor binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen response elements. Cell 54:313323. Glass, C. K., S. M. Lipkin, 0. V. Devary, and M. G. Rosenfeld. 1989. Positive and negative regulation of gene transcription by a retinoic acid-thyroid hormone receptor heterodimer. Cell 59: 697-708.

3684

SAATCIOGLU ET AL.

24. Glass, C. K., and M. G. Rosenfeld. 1991. Regulation of gene transcription by thyroid hormones and retinoic acid, p. 299-327. In G. Foulkes and P. Cohen (ed.), The hormonal control of gene transcription, vol. 6. Elsevier, Amsterdam. 25. Glineur, C., M. Zenke, H. Beug, and J. Ghysdael. 1990. Phosphorylation of the v-erbA protein is required for its function as an oncogene. Genes Dev. 4:1663-1676. 26. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 27. Graf, T., and H. Beug. 1983. Role of the v-erbA and v-erbB oncogenes of avian erythroblastosis virus in erythroid cell transformation. Cell 34:7-9. 28. Graupner, G., K. N. Wills, M. Tzukerman, X.-K. Zhang, and M. Pfahl. 1989. Dual regulatory role for thyroid hormone receptors allows control of retinoic acid receptor activity. Nature (London) 340:653-656. 29. Green, S., and P. Chambon. 1988. Nuclear receptors enhance our understanding of transcriptional regulation. Trends Genet. 4:309-314. 30. Green, S., I. Issemann, and E. Sheer. 1988. A versatile in vivo and in vitro eukaryotic expression vector for protein engineering. Nucleic Acids Res. 16:369. 31. Hamada, K., S. L. Gleason, B.-Z. Levi, S. Hirschfeld, E. Appella, and K. Ozato. 1989. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element. Proc. Natl. Acad. Sci. USA 86:8289-8293. 32. Horowitz, Z. D., C. Yang, B. M. Forman, J. Casanova, and H. H. Samuels. 1989. Characterization of the domain structure of chick c-erbA by deletion mutation: in vitro translation and cell transfection studies. Mol. Endocrinol. 3:148-156. 33. Jonat, C., H. J. Rahmsdorf, K.-K. Park, A. C. B. Cato, S. Gebel, H. Ponta, and P. Herrlich. 1990. Antitumor promotion and antiinflammation: down-regulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189-1204. 34. Kahn, P., L. Fryberg, T. Graf, B. Vennstrom, and H. Beug. 1986. Cooperativity between v-erbA and v-src-related oncogenes in erythroid cell transformation, p. 41-50. In F. Deinhard (ed.), Symposium for Comparative Research on Leukemia and Related Diseases XII. Springer-Verlag, Heidelberg, Germany. 35. Kliewer, S. A., K. Umesono, D. J. Mangelsdorf, and R. M. Evans. 1992. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature (London) 355:446-449. 36. Knight, J., M. Zenke, C. Disela, E. Kowenz, P. Vogt, D. Engel, M.-J. Hayman, and H. Beug. 1988. Temperature-sensitive v-sea transformed erythroblasts: a model system to study gene expression during erythroid differentiation. Genes Dev. 2:247-258. 37. Konig, H., H. Ponta, J. Rahmsdorf, and P. Herrlich. 1992. Interference between pathway-specific transcription factors: glucocorticoids antagonize phorbol ester-induced AP-1 activity without altering AP-1 site occupation in vivo. EMBO J. 11: 2241-2246. 38. Leid, M., P. Kastner, K. Lyons, H. Nakshatri, M. Saunders, T. Zocharewski, J.-Y. Chen, A. Staub, J.-M. Garnier, S. Mader, and P. Chambon. 1992. Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind to target sequences efficiently. Cell 68:377-396. 39. Lucibello, F. C., E. P. Slater, K. U. Jooss, M. Beato, and R. Muller. 1990. Mutual transrepression of Fos and the glucocorticoid receptor: involvement of a functional domain in Fos which is absent in FosB. EMBO J. 9:2827-2834. 40. Mangelsdorf, D. J., S. E. Ong, J. A. Dyck, and R. M. Evans. 1990. Nuclear receptor that identifies a novel retinoic acid response pathway. Nature (London) 345:224-229. 41. Munoz, A., M. Zenke, U. Genring, J. Sap, H. Beug, and B. Vennstrom. 1988. Characterization of the hormone-binding domain of the chicken c-erbA/thyroid hormone receptor protein. EMBO J. 7:155-159. 42. Naar, A. M., J.-M. Boutin, S. M. Lipkin, V. C. Yu, J. M. Holloway, C. K. Glass, and M. G. Rosenfeld. 1991. The orien-

MOL. CELL. BIOL.

tation and spacing of core DNA-binding motifs dictate selective transcriptional responses to three nuclear receptors. Cell 65: 1267-1299. 43. Nicholson, K. C., S. Mader, S. Nagpal, M. Leid, C. RochetteEgly, and P. Chambon. 1990. Negative regulation of the rat stromelysin gene promoter by retinoic acid is mediated by an AP-1 binding site. EMBO J. 9:4443-4454. 44. Petkovich, M., N. J. Brand, A. Krust, and P. Chambon. 1987. A human retinoic acid receptor belongs to the family of nuclear receptors. Nature (London) 330:444-450. 45. Privalsky, M. L., M. Sharif, and K. R. Yamamoto. 1990. The viral erbA oncogene protein, a constitutive repressor in animal cells, is a hormone-regulated activator in yeast. Cell 63:12771286. 46. Ragsdale, C. W., and J. P. Brockes. 1991. In M. G. Parker (ed), Nuclear hormone receptors, p. 235-259. Academic Press, Inc., New York. 47. Rauscher, F. J., III, D. R. Cohen, T. Curran, T. J. Bos, P. K. Vogt, D. Bohmann, R. Tjian, and B. R. Franza, Jr. 1988. Fos-associated protein p39 is the product of the jun protooncogene. Science 240:1010-1016. 47a.Saatcioglu, F. Unpublished data. 47b.Saatcioglu, F., and T. Deng. Unpublished data. 48. Sadowski, I., and M. Ptashne. 1989. A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Res. 17:7539. 49. Sap, J., L. de Magistris, H. Stunnenberg, and B. Vennstrom. 1990. A major thyroid hormone response element in the third intron of the rat growth hormone gene. EMBO J. 9:887-896. 50. Sap, J., A. Munoz, K. Damm, Y. Goldberg, J. Ghysdael, A. Leutz, H. Berg, and B. Vennstrom. 1986. The c-erb-A protein is a high affinity receptor for thyroid hormone. Nature (London) 324:635-640. 51. Sap, J., A. Munoz, J. Schmitt, H. Stunnenberg, and B. Vennstrom. 1989. Repression of transcription mediated by a thyroid hormone response element by the v-erb-A oncogene product. Nature (London) 340:242-244. 52. Schroeder, C., L. Gibson, and H. Beug. 1992. The v-erbA oncogene requires cooperation with tyrosine kinases to arrest erythroid differentiation induced by ligand-activated endogenous c-erbA and retinoic acid receptor. Oncogene 7:203-216. 53. Schroeder, C., L. Gibson, M. Zenke, and H. Beug. 1992. Modulation of normal erythroid differentiation by the endogenous thyroid hormone and retinoic acid receptors: a possible target for v-erbA oncogene action. Oncogene 7:217-227. 54. Schroeder, C., C. Raynoschek, U. Fuhrmann, K. Damm, B. Vennstrom, and H. Beug. 1990. The v-erbA oncogene causes repression of erythrocyte-specific genes and an immature, aberrant differentiation phenotype in normal erythroid progenitors. Oncogene 5:1445-1453. 55. Schule, R., P. Rangarajan, S. Kliewer, L. J. Ransone, J. Bolado, N. Yang, I. M. Verma, and R. M. Evans. 1990. Functional antagonism between oncoprotein c-Jun and the glucocorticoid receptor. Cell 62:1217-1226. 56. Schule, R., P. Rangarajan, N. Yang, S. Kliewer, L. J. Ransone, J. Bolado, I. M. Verma, and R. M. Evans. 1991. Retinoic acid is a negative regulator of AP-1 responsive genes. Proc. Natl. Acad. Sci. USA 88:6092-6096. 57. Sharif, M., and M. L. Privalsky. 1992. v-erbA and c-erbA proteins enhance transcriptional activation by c-jun. Oncogene 7:953-960. 58. Shemshedini, L., R. Knauthe, P. Sassone-Corsi, A. Pornon, and H. Gronomeyer. 1991. Cell-specific inhibitory and stimulatory effects of Fos and Jun on transcription activation by nuclear receptors. EMBO J. 10:3839-3849. 59. Smeal, T., B. Binetruy, D. Mercola, A. Grover-Bardwick, G. Heidecker, U. R. Rapp, and M. Karin. 1992. Oncoproteinmediated signalling cascade stimulates c-Jun activity by phosphorylation of serines 63 and 73. Mol. Cell. Biol. 12:3507-3513. 60. Umesono, K., K. K. Murakami, C. C. Thompson, and R. M. Evans. 1991. Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255-1266.

VOL. 13, 1993 61. Verneuil, H., and D. Metzger. 1990. The lack of transcriptional activation of the v-erbA oncogene is in part due to a mutation present in the DNA binding domain of the protein. Nucleic Acids Res. 18:4489-4497. 62. Weinberger, C., C. Thompson, E. S. Ong, R. Lebo, D. J. Grvol, and R. M. Evans. 1986. The c-erbA gene encodes a thyroid hormone receptor. Nature (London) 324:641-646. 63. Yang-Yen, H.-F., J.-C. Chambard, Y.-L. Sun, T. Smeal, T. J. Schmidt, J. Drouin, and M. Karin. 1990. Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62:1205-1215. 64. Yang-Yen, H.-F., X. Zhang, G. Graupner, M. Tzukerman, B. Sakamoto, M. Karin, and M. Pfahl. 1991. Antagonism between retinoic acid receptors and AP-1: implications for tumor promotion and inflammation. New Biol. 3:1206-1219. 65. Yu, V. C., C. Delsert, B. Andersen, J. M. Holloway, 0. V. Devary, A. M. Niar, S. Y. Kim, J.-M. Boutin, C. Glass, and M. G. Rosenfeld. 1991. RXRO: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67:1251-1266.

ONCOGENIC ACTIVATION OF c-ErbAa

3685

66. Zenke, M., P. Kahn, C. Disela, B. Vennstrom, A. Leutz, K. Keegan, M. J. Hayman, H. R. Choi, N. Yew, J. D. Engel, and H. Beug. 1988. v-erbA specifically suppresses transcription of the avian erythrocyte anion transporter (band 3) gene. Cell 52:107119. 67. Zenke, M., A. Munoz, J. Sap, B. Vennstrom, and H. Beug. 1990. v-erbA oncogene activation entails the loss of hormone-dependent regulator activity of c-erbA. Cell 61:1035-1049. 68. Zhang, X., B. Hoffman, P. B.-V. Tran, G. Graupner, and M. Pfahl. 1992. Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature (London) 355:441-446. 69. Zhang, X. K., K. N. Wills, M. Husmann, T. Hermann, and M. Pfahl. 1991. Novel pathway for thyroid hormone receptor action through interaction with jun and fos oncogene activities. Mol. Cell. Biol. 11:6016-6025. 70. Zhang, X.-K., K. N. Wills, M. Tzukerman, T. Hermann, and M. Pfahl. 1991. Ligand-binding domain of thyroid hormone receptors modulates DNA binding and determines their bifunctional roles. New Biol. 3:169-181.