Bull Vet Inst Pulawy 55, 581-586, 2011
DETECTION OF RHD VIRUS BY A REAL-TIME REVERSE TRANSCRIPTION PCR ANDRZEJ FITZNER, WIESŁAW NIEDBALSKI, ANDRZEJ KĘSY, AND GRAŻYNA PAPROCKA Department of Foot-and-Mouth Disease, National Veterinary Research Institute, 98-220 Zduńska Wola, Poland
[email protected] Received: October 4, 2011
Accepted: November 22, 2011
Abstract A real-time RT–PCR method for the rapid detection of the rabbit haemorrhagic disease virus (RHDV) in the liver and serum samples of rabbits was described. A primer set that targets 3’ part of VP60 gene and TaqMan probe specific for the conserved region in RHDV genome was used in the method. The assay was able to detect genetic material in rabbits infected with classic RHDV as well as RHDVa variant. RNA of both haemagglutinating and non-heamagglutinating strains were also detected in samples with different virus strains. The detection limit of RHDV RNA by rRT-PCR was 10-7. The method can provide quantitative and qualitative information and is more sensitive and faster than the conventional RT-PCR. Therefore, it seems to be a valuable tool to complete the routine diagnostic procedure in RHD diagnosis.
Key words: rabbit haemorrhagic disease virus, detection, real-time PCR. For nearly thirty years rabbit haemorrhagic disease (RHD) has threatened the rabbit breeding and meat production in the world. The fatal disease with extremely high levels of morbidity and mortality of susceptible wild and domestic rabbits of the species Oryctolagus Cuniculus was recognised in 1984 in China (16). In Europe, highly infectious plaque, of unusual epidemiological, clinical, and pathological findings (named “Mallatia X”) occurred in 1986 in Italy. At the same time, apparently similar haemorrhagic syndrome (EBHS) was recognised in hares (2, 18). In Poland, the first outbreaks of RHD were officially reported in 1988 (9). A common feature found during RHD epidemics, regardless of geographical location, is that young animals, usually less than two months, were immune (11, 12). The causative agent, rabbit haemorrhagic disease virus (RHDV), family Caliciviridae, has a single-stranded positive sense genome of 7.5 Kb (17). RHDV strains are characterised by a high ability to haemagglutinate human red blood cells, although nonheamagglutinating phenotypic variants were also described (5, 10). All known strains of RHDV belong to one serotype. RHDV does not reproduce in cell culture and the main method for its multiplication is infection of sensitive rabbits (12). RHDV is very stable under different environmental conditions. Small, nonenveloped viral particles (about 35 nm) are resistant to ether and chloroform. Under experimental conditions, virus stored in frozen or lyophilised homogenates can
survive for many years without reducing its infectivity, antigenicity, and haemagglutination activity (6, 19, 20). Initially, genetic characterisation of the RHDV strains demonstrated a considerable stability of virus genome with low percentage of mutation. Based on antigenic and genetic characteristics, newly RHDV subtype named RHDVa was detected in 1998 (4, 21). In addition, non-pathogenic calicivirus (RCV), closely related to RHDV, was isolated in the gastrointestinal tract of rabbits (3). In most cases, conventional virological and serological tests (HA, HI, different types of ELISA) allow the confirmation of clinical diagnosis of RHD. For detection of RHDV genetic material, conventional PCR methods were evaluated using numerous sets of nucleotide primers, that amplified the vp60 gene (4, 11, 13). The aim of this study was to determine the diagnostic value of a real-time reverse transcription assay for the detection of RHDV RNA in rabbits from RHDV infected animals.
Material and Methods Sample origin. The 23 archival Polish RHDV isolates, including non-haemagglutinating phenotypic variants and RHDVa subtype strains were collected in our laboratory from 1988 to 2006. Among them, there were KGM and SGM strains isolated in 1988 from the first officially confirmed RHD outbreak in Poland (9), and KGM HA positive isolate, which has been used as a vaccine strain until 2008. Additionally, French strain
582
(PLF 83/92-352), passage of German HA-negative strain Frankfurt, and passage of Czech strain V-351 (kindly provided from the Centre National d’Etudes Vétérinaires et Alimentaires (CNEVA) in Ploufragan (France) and the University of Szczecin, Poland) were used (Table 1). RHD virus was extracted from the liver taken from infected rabbits and stored frozen at -18 - -26°C. A total of 2 g of liver tissue was homogenised in 8 ml of PBS, purified with chloroform (10%), and centrifuged at 7,000 g for 10 min. A part of the homogenates was stored frozen after mixing with glycerol (1:1) or in a lyophilised form at final concentrations 10% w/v. All samples were confirmed positive for the presence of RHD virus by ELISA, heamagglutination test, and conventional reverse transcriptase polymerase chain reaction. Additionally, the following material was tested: seven liver specimens of healthy rabbits taken from the slaughterhouse between 2008 and 2011 (two non vaccinated, 3-month-old New Zealand white rabbits, five mixed-race rabbits, one mixed-race rabbit f with hepatic coccidiosis) (Table 1), seven serum samples of seropositive convalescent rabbits taken after 7 d, 6 weeks, and 7 months after beginning of two RHD outbreaks (in 1994 and 2004), and serum samples of vaccinated and control (non vaccinated) rabbits taken prior and after experimental infection (two control rabbits survived the challenge and exhibited a maximum body temperature rise to 41.7-41.3°C at 3-5d p.i. (Table 3). Moreover, bluetongue virus (BTV) RNA extracted from EDTA blood sample (serotype 8) was used. Nucleid acid extraction. A hundred microlitres of the liver tissue homogenate or serum samples was used. The total RNA was extracted in a volume of 35 µl using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instruction. Extracted undiluted RNA and ten-fold serial dilutions were used for the real time PCR, or in reverse transcription for conventional RTPCR. Real-time reverse transcription (rRT-PCR). The probe (6986-7010): FAM-CCA ARAGCACRCTCGTGTTCA ACCT-TAMRA, and a pair of oligonucleotide primers P7vp60 (6941-6961) ACYTGACTGAACTYATTGACG, P8 vp60 (70447022) TCAGACATAAGAAAAGCCATTGG were used according to Gall et al. (8). The assay was performed in Real Time 7300 thermal cycler (Applied Biosystems) as a one-step reaction using the Quanti Tect Probe PCR Kit (Qiagen). The reaction mixture at the volume of 25 µl contained 5 µl of extracted RNA, 12.5 µl of 2x Quanti tect Probe RT-PCR Master Mix, 0.25 µl of Quanti Tect RT Mix, 0.5 µl (2.5 pmol) of Taqman probe, 1.0 µl of forward primer and 1.0 µl of reverse primer, both at concentration of 10 pmol, 1.25 µl of MgSO4, and 3.5 µl of H2O. The cycling conditions were as follows: I reverse transcription - 50°C/30 min; II - reverse transcription inactivation and Taq DNA polymerase activation - 94°C/2 min; III – 45 cycles of PCR 94°C/30 s, 55°C/45 s, 68°C/45 s (8). The reporter dye (FAM) was measured at the stage of annealing in the exponential phase of the amplification plot of each cycle.
After completion of the PCR run, threshold – crossing values (CT) were established automatically at 0.2 level. Reverse transcription (RT) and conventional PCR. The total RNA was incubated for 15 min in 1826°C with the reaction mixture. The synthesis of cDNA was performed at 42°C for 60 min in a 60 µl reaction using 1 µl of oligo dt15 primer (Promega), PCR nucleotide mix, and AMV reverse transcription enzyme (Promega). The PCR conditions were as follows: denaturation for 3 min at 94°C, 35 cycles of amplification (1 min at 94°C, 1 min at 55°C, 1 min at 72°C), and final elongation 10 min at 72°C. The 510 bp amplicon of VP60 gene was obtained with the use of oligonucleotide primers: P1(5182) 5’GAGCTCGAGCGACAACAGGC, P2 (5692) 5’CAAACACCTGACCCGGCAAC according to Guittré (13). The primers were synthesised in the Institute of Biochemistry and Biophysics (Warsaw). RNAase free water was used as a negative cDNA template.
Results The mean CT value for undiluted RNA of 26 samples extracted from liver homogenates of RHDV infected rabbits was established at the 21st cycle (threshold line 0.2). In 22 samples, CT values ranged from 16.86 to 22.95. In this group, four of 26 samples revealed CT values significantly higher; they ranged from 27.4 to 31.2. All analysed liver samples of infected rabbits diagnosed positive in HA or ELISA were recognised as positive by rRT-PCR, independently from the genetic subtype or haemagglutination characterstics (Table 1). For series of RNA dilution of the seven RHDV strains, a mean CT values from 17.62 at undiluted samples to Ct 40.01 at 10-7 dilution were obtained. At the highest dilution (10-7), Ct values fluctuated around 40, ranging from 36.5 in one case to over 45 in the others (Table 2). An example of rRT-PCR results of KGM RHDV vaccine strain isolated from the liver of experimentally inoculated rabbit (passage 5 from 2007) is presented in Fig.1. The CT values of RNA extracted from the liver of two healthy rabbits (L15/IV/2008 and L8/RI/2008) and rabbit with hepatic coccidiosis (B 2011) were outside the 45 cycle. In the liver of four rabbits rRT-PCR test demonstrated CT values near 40, and in one case (L3/RI/2008) CT value was 32 (Table 1). The mean CT value for RNA of serum samples taken from infected rabbits, or animals suspected of infection corresponded to 41 (Table 3). In sample 6/8 taken from two rabbits, about a week after disease started, CT of 35 was demonstrated. A similar result was obtained for serum of control rabbit, which survived 10 d after the experimental infection and its maximum body temperature was 41.7°C on day 3 post challenge. No amplification RNA RHDV was detected with BT virus sample.
583
Table 1 CT values of RHDV strains obtained by rRT-PCR assay after RNA isolation from liver samples RHDVstrain
Antigenic type
HA titer
KGM 1988 (passage 5/2007)
RHDV
10,240
SGM 1988 (passage 2/1991) PD 1989 BLA 1994 (lyoph). MAL 1994 (lyoph). PRB 1995
RHDV RHDV RHDV RHDV RHDV
2,560 5,120 Negative 2,560 10,240
BDG 1/1996 BDG 2/ 1997 BDG 3/1997 BDG 4/1998 GSK 1998 (lyoph.) PIA 1999 POZ 1999 ZD0 2000 SIZ 2002 ZDU 2003 OPO 2004 GRZ 2004 ROK 2004 CB 2005 KRY 2005 ZKA 2005 DCE 2006 V-351 (lyoph.) Frankfurt PLF 83/92-353 (lyoph.) B 2011 (coccidiosis)
RHDV RHDV RHDV RHDV RHDV RHDV RHDV RHDV RHDV RHDVa HA neg. RHDVa RHDVa RHDVa RHDVa RHDVa RHDVa RHDV HA neg. RHDV negative L3/RI/2008 L13/RII/2008 L5/RIV/2008 L15/RIV/2008 L7/RI/2011 L8/RI/2011 L6/RII/2011
2,560 160 2,560 20,480 5,120 10,240 5,120 2,560 2,560 10,240 negative 20,480 20,480 10,240 2,560 5,120 160 1,280 negative 10,240 negative negative negative negative negative negative negative negative
Liver of healthy rabbits
CT (The mean of four repetitions) 17.67 17.99 27.38 18.17 21.83 22.58 16.68 17.21 18.08 19.97 19.20 21.14 19.60 22.20 21,19 27.61 22.95 16.86 17.86 17.71 19.64 18.60 31.19 19.78 18.20 28.03 18.75 22.48 undetected (>45) 32.35 40.79 40.04 undetected (>45) 40.99 undetected (>45) 40.75
Table 2 CT values of diluted RHDV RNA obtained by rRT-PCR RHDV strain (RNA isolation number) KGM (1) (2) GRZ (RHDVa) ROK (RHDVa) DCE (RHDVa) Frankfurt ZDU (RHDVa) PRB (1) (2)
10-1
10-2
10-3
20.04
23.67 22.00 24.69 21.85 23.28 21.56 21.77 23.09 22.71
28,2
19.78 19.33 19.59 18.4 18.25 19.04 18.44
29.59 24.44 28.89 25.38 24.69 27.84 26.28
RNA dilution 10-4 10-5
10-6
30,77 27.64 33.18 25.39 33.47 28.62 27.60 32.74 30.10
37,42 34.76 40.33 31.78 37.8 35.43 35.00 40.05 36.17
34,02 31.37 37.03 29.17 34.03 32.63 31.70 35.60 33.07
10-7
37.92 36.47 40.96 38.98 37.54 undet. (>45) 39.74
584
Table 3 CT values of RNA isolated from rabbit serum obtained by rRT-PCR assay. Serum samples collected from rabbits at various time points since the disease outbreak, or after experimental vaccination and inoculation test Sample origin Serum number HI antibody titer CT Sera 2, 3, 4, and 8 - 6 weeks S2 1,280 42.09 after RHD outbreak in S3 1,280 41.80 Małogoszcz (MAL), 1994. S4 2,560 42.99 Serum 10 - 7 months after S8 640 43.00 RHD outbreak in Małogoszcz S10 640 41.58 1994. Serum samples – 7 d after S6/8 5,120 35.71 RHD outbreak in Opole S10 160 41.31 (OPO), 2004. Serum of control rabbits (non- S1 – 0 d
