Disruption of the mouse RBP-Jκ gene results in

Development 121, 3291-3301 (1995) Printed in Great Britain © The Company of Biologists Limited 1995

3291

Disruption of the mouse RBP-Jκ gene results in early embryonic death Chio Oka1,*, Toru Nakano1,*, Andrew Wakeham2,*, Jose Luis de la Pompa2,*, Chisato Mori3, Takashi Sakai1, Saeko Okazaki1, Masashi Kawaichi1, Kohei Shiota3, Tak W. Mak2 and Tasuku Honjo1 1Department of Medical Chemistry and 3Department of Anatomy, Faculty 2Ontario Cancer Institute, Amgen Institute, Toronto M4X 1K9, Canada

of Medicine, Kyoto University, Kyoto 606, Japan

*First four authors equally contributed to this work

SUMMARY The RBP-Jκ protein is a transcription factor that recognizes the sequence C(T)GTGGGGA. The RBP-Jκ gene is highly conserved in a wide variety of species and the Drosophila homologue has been shown to be identical to Suppressor of Hairless [Su(H)] which plays important roles in the development of the peripheral nervous system. To explore the function of the RBP-Jκ gene in mouse embryogenesis, a mutation was introduced into the functional RBP-Jκ gene in embryonic stem (ES) cells by homologous recombination. Null mutant ES cells survived but null mutant mice showed embryonic lethality before 10.5 days of gestation. The mutant mice showed severe growth retardation as early as 8.5 days of gestation. Developmental

INTRODUCTION RBP-Jκ is a unique transcription factor that does not contain any of the known DNA-binding protein motifs such as zinc finger, helix turn helix, helix loop helix and leucine zipper (Matsunami et al., 1989; Hamaguchi et al., 1989). Series of replacement mutations have shown that there are at least two functionally important regions, mutations that reduce the DNA-binding ability of the RBP-Jκ protein. These two regions are mapped upstream and downstream of the integrase-related motif that is located in the middle of the region coding the protein and is shared by a group of site-specific recombinase (Chung et al., 1994). The mouse RBP-Jκ protein recognizes a consensus sequence C(T)GTGGGAA (Tun et al. 1994). Recently, RBP-Jκ was shown to play important roles in regulation of viral gene transcription. The RBP-Jκ protein represses the transcription of the adenovirus pIX gene by binding immediately upstream of the TATA sequence in the promoter region (Dou et al. 1994). One of Epstein-Barr virus (EBV) transactivator proteins, EBNA2, which plays a crucial role in the immortalization of EBV-infected B cells, requires the RBP-Jκ protein for its transactivation of viral genes. RBP-Jκ associates directly with cis-responsive DNA elements in EBV gene promoters and transactivates the genes by subsequent interaction with EBNA2 (Henkel et al., 1994; Grossman et al., 1994; Zimber-Strobl et al., 1994). Not only viral genes but also cellular genes appear to be regulated by RBP-Jκ because the RBP-Jκ-binding motif or EBNA2-responsive element exist in

abnormalities, including incomplete turning of the body axis, microencephaly, abnormal placental development, anterior neuropore opening and defective somitogenesis, were observed in the mutant mice at 9.5 days of gestation. RBP-Jκ mutant embryos expressed a posterior mesodermal marker FGFR1. Their irregularly shaped somites expressed a somite marker gene Mox 1 but failed to express myogenin. The RBP-Jκ gene was revealed to be essential for postimplantation development of mice. Key words: RBP-Jκ, somite defect, neural tube defect, in situ hybridization, homologous recombination, mouse

the promoter of the CD23 gene, which is upregulated by EBNA2. The RBP-Jκ protein is highly conserved from human to Drosophila (Furukawa et al., 1991; Amakawa et al., 1993). The Drosophila homologue of the RBP-Jκ gene turned out to be the Suppressor of Hairless [Su(H)] gene, which is involved in the peripheral nervous system (PNS) development in Drosophila (Furukawa et al., 1992; Schweisguth and Posakony, 1992). The activity of Su(H) is required at two steps of cell fate decision during the development of the PNS; the sensory organ precursor versus epidermal cell fate and the trichogen (shaft) versus tormogen (socket) cell fate decision (Furukawa et al., 1994; Schweisguth and Posakony, 1994). Su(H) was shown to interact genetically with a number of Drosophila neurogenic genes, including Notch (de la Concha et al., 1988). Recently, Su(H) has been reported to be a key downstream element in the Notch receptor signaling pathway (Fortini and Artavanis-Tsakonas, 1994). The Su(H) protein, which also recognizes the sequence TGTGGGAA, has been shown to stimulate the transcription of another neurogenic gene Enhancer of split m8 [Tun et al., 1994; Furukawa and T. H., unpublished data]. These results indicate that Su(H) plays an essential regulatory role in the process of cell fate determination in Drosophila. To understand the role of RBP-Jκ in vertebrate embryogenesis, mice mutated in the RBP-Jκ gene were produced by homologous recombination. Homozygous RBP-Jκ−/− mutants showed severe developmental delay as compared to their het-

3292 C. Oka and others erozygous littermates as early as day 8.5 of embryogenesis. The allantois of homozygous RBP-Jκ−/− embryos failed to fuse to the chorion at day 8.5 and resulted in abnormal placental development. Histological and molecular analysis of homozygous RBP-Jκ−/− embryos revealed specific defects in neural and somitic development, associated to lethality before day 10.5 of embryogenesis. Although the precise role of this gene was not revealed, the RBP-Jκ protein was found to play essential roles in early phases of mouse development.

MATERIALS AND METHODS Targeting vector construction The 15 kb EcoRI fragment containing exon 4-11 of the RBP-Jκ gene was cloned from BALB/c and 129/Sv genomic DNA (Kawaichi et al. 1992) (Fig. 1A). The 3′ 7.5 kb BamH-EcoRI fragment of these clones and the neo expression cassette PGKneobpa were utilized to construct pCO3B series of targeting vectors (Soriano et al., 1991). The HindIII site in exon 7 was blunt-ended and SalI linkers were added. The XhoISalI fragment of PGKneobpa was ligated into the SalI site in the opposite transcriptional orientation to the RBP-Jκ gene and this plasmid was named pRBP-Jκ4-11neo. Two kinds of vectors, which contained the thymidine kinase gene of herpes simplex virus (HSVtk) for negative selection, were constructed and designated as pCO3Btk/BALB and pCO3B-tk/129 according to strains of their genomic DNA used (Fig. 1B). To generate the targeting vectors pCO3B-tk’s, the KpnI-EcoRI fragment of pRBP-Jκ4-11neo and the EcoRI-BamHI fragment of PGK-HSVtk cassette were ligated into KpnI-BamHIdigested pBSKS(+). pMC1-DT-A cassette was used for constructing another targeting vector pCO3B-DT/129 for negative selection by using diphtheria toxin A (DT-A) gene without GANC or FIAU (Yagi et al., 1990). The KpnI-SmaI fragment of pRBP-Jκ4-11neo, which had been constructed with 129/sv genomic DNA and the SalI-SmaI fragment of pMC1-DT-A, were ligated into KpnI-SmaI-digested BSKS(+) to generate the targeting vector pCO3B-DT/129. These targeting vectors pCO3B’s contained 290-bp and 7.5-kb homologous sequences at the 5′ and 3′ sides, respectively. Another targeting vector PCO5/129 containing a hygromycin expression cassette from pPGKhygro (kindly provided by Dr R. Mortensen, Simon et al. 1992) was used to produce double knock out of the RBP-Jκ gene in ES cells. The 3′ 7.5-kb BamHI-EcoRI fragment of the RBP-Jκ gene (15 kb EcoRI fragment) derived from 129/sv genomic DNA was partially digested with PvuII. The fragment that was obtained by digestion of only the 3′-most PvuII site was again partially digested with HindIII. The expected fragment was isolated, blunt-ended, ligated with SalI linkers and then digested with SalI. This fragment, the SalI-BamHI fragment of pPGKhygro, and the 5′ 7.5 kb EcoRI-BamHI fragment were ligated into SalI-EcoRI-digested pBSKS(+). The SalI-SmaI fragment of the pENL containing the lacZ gene under the EF1a promoter (Hanaoka et al., 1991) was blunt-ended and ligated into the SmaI site of polylinkers at the upstream of the PGKhygro gene, although β-galactosidase was not used as a cytological marker in this study. PCO5/129 contains 7.5 kb and 7.0 kb homologous sequences at the 5′ and 3′ ends of the hygromycin expression cassette, respectively (Fig. 1E). All vectors (pCO3Btk/Balb, pCO3B-tk/129, pCO3B-DT/129, pCO5/129) were linearized by a unique KpnI site at the 5′ end of the RBP-Jκ gene before electroporation. Electroporation, selection and screening of ES cells D3 cells were electroporated as described (Joyner et al., 1989). Drug selection was done using 400 µg/ml of G418 (Waken, Kyoto), 150 µg/ml of hygromycin (Waken, Kyoto), or 2 µM of GANC (Kindly provided by Syntex). After 9 days selection, halves of individual

colonies were reseeded and the other halves of colonies were used for screening by PCR or Southern blotting. PCR was carried out for 35 cycles of 94°C for 30 seconds, 64°C for 30 seconds, and 72°C for 1.5 minutes and the product was confirmed by filter hybridization. Primers for PCR were RBP-Jκ-sense, TGGCACTGTTCAATCGCCTT, which was derived from genomic sequence upstream of the KpnI site in exon 7, and neo, GAGGAAATTGCATCGCATTGTCTGAG, which was derived from pPGKneobpa cassette. To analyze the genotype of the RBP-Jκ targeted mice at day 8.5, the third primer RBP-Jκ-reverse, AATCTTGGGAGTGCCATGCCA, was mixed with two above-mentioned primers. RBP-Jκ-reverse primer was derived from the sequence in exon 7 at downstream of the HindIII site. The wild-type allele should give rise to the 376 bp fragment by primers of RBP-Jκ-sense and RBP-Jκ-reverse. In contrast, the disrupted allele should give rise to the 590 bp fragment by primers of RBP-Jκ-sense and neo (Fig. 1C,D). A combination of RBP-Jκ-sense and RBP-Jκ-reverse primers did not make any detectable bands from the disrupted alleles because the amplified band is too large (data not shown). Genotyping ES cell lines and mice by Southern blot analysis DNA was isolated from the mutant ES cell lines and tail clip samples using standard procedures (Sambrook et al., 1989). For genotyping of embryos, DNA was extracted from embryos or yolk sacs isolated at 8.5-12.5 dpc and analyzed by PCR or Southern blot hybridization. DNAs from yolk sacs, embryos, ES cells or adult mouse tail were digested with EcoRI. cDNA probe of exons 4 and 5 (probe 1 in Fig. 1C) was used for genotyping mutant mice. Another probe (probe 2 in Fig. 1F), the PvuII-EcoRI fragment located at the 3′ end of the 15 kb EcoRI fragment of the RBP-Jκ gene was used for analyzing double knock-out ES cell clones. Blastocyst injection and animal breeding Chimeras were generated as described (Bradley, 1987). ES cell clones positive for the homologous recombination were injected into blastocysts of C57BL/6 mice at 3.5 dpc. The midpoint of dark interval of the day that vaginal plug was detected was considered as 0.0 dpc. Male chimeras with extensive ES cell contribution to the coat color were mated with C57BL/6 female to test for germ-line transmission. Western blotting Western blotting analysis was performed as described (Hamaguchi et al., 1992). 600 µg of crude nuclear extract from ES clones were used for electrophoresis. The blot was stained with a primary monoclonal antibody (1:1,000 dilution) against the RBP-Jκ protein (Hamaguchi et al., 1992) and secondary 125I-labeled anti-rat IgG antibodies (Amersham) (1:100 dilution). Morphological and histological analysis Embryos were collected at various times of gestation and staged according to morphological criteria (Kaufman, 1992). For histological analysis, procured embryos were rinsed with PBS and fixed overnight at 4°C in 4% paraformaldehyde or Bouin’s solution, dehydrated through graded alcohols and embedded in paraffin or wax (Kaufman 1992). Embryos were sectioned at 5 µm thickness and stained with hematoxylin and eosin. Embryos were photographed in a Wild Leitz M3 microscope. Sectioned embryos were photographed using a Leitz Orthoplan compound microscope. The somite numbers of 8.5 dpc embryos were counted under a dissection microscope after fixation. RT-PCR Embryos from 7.5 dpc to 10.5 dpc were separated under a dissecting microscope. RNA was prepared with Isogen (Nippon Gene) and samples of 1 µg RNA were used for reverse transcription (Sambrook et al., 1989). Samples without the addition of reverse transcriptase

RBP-Jκ gene knock-out mice 3293 were used to confirm that PCR product is derived from cDNA. PCR was carried out for 25 cycles of 94°C for 1 minute, 55°C for 30 seconds, 72°C for 30 seconds. RBP-Jκ-sense and RBP-Jκ-antisense primers were used to detect the expression of RBP-Jκ mRNA. β-actin mRNA expression was used as a control for the reactions (Weiss et al., 1994). Whole-mount in situ hybridization of mouse embryos Whole-mount in situ hybridization was performed according to the method of Wilkinson and Nieto (1993), with the following modifications. For the 8.5 dpc embryos, the proteinase K (20 µg/ml) treatment was 3 minutes. Embryos were prehybridized for 3.5 hours at 65°C. Ribonuclease treatment was excluded. Embryos were preblocked for 3 hours with goat serum. Anti-digoxigenin antibody was preabsorbed for 3 hours and used at a final concentration of 1:2,000. The hybridization probes used were: A 600-bp fragment corresponding to the 3′ end of the RBP-Jκ gene (Kawaichi et al., 1992); FGFR1 full-length cDNA (Yamaguchi et al., 1994); a 550 bp fragment corresponding to the 3′ end of the mouse Mox 1 cDNA (Candia et al., 1992) and the myogenin poly(A) region (provided by Dr A Schuh). After in situ hybridization, embryos were postfixed overnight in 4% paraformaldehyde, dehydrated through methanol series to intensify the pink-topurple reaction product to dark blue and rehydrated again (Conlon and Hermann, 1993).

RESULTS Targeted disruption of the RBP-Jκ gene and germline transmission of the mutated allele There are four RBP-Jκ-related genes whose sequences are identical or highly homologous to that of RBP-Jκ cDNA (Kawaichi et al., 1992). Two of them are apparent pseudogenes of processed type because their sequences contain scattered stop codons in coding regions. The other two genes, however, contain sequences identical to that of RBP-Jκ cDNA. Because one of

them is a processed gene, we assumed that the other one, which consists of 11 exons scattered over 50 kb, is the functional RBPJκ gene and decided to disrupt it (Fig. 1A). To construct the replacement type targeting vectors pCO3B’s, a PGKneobpa cassette was inserted into the HindIII site of exon 7 with the opposite transcriptional orientation. The regions surrounding the integrase motif, which had been shown to be important for the sequence-specific DNA-binding capacity of RBP-Jκ by sitedirected mutagenesis analysis (Chung et al., 1994), should be disrupted by these targeting constructs (Fig. 1B). pCO3B series of targeting vectors contained the HSVtk gene or diphtheria toxin A (DT-A) gene for negative selection. D3 ES cells electroporated with these vectors were selected in the presence of both G418 and GANC, or G418 alone. GANC was used only in the initial experiment because ES cell clones selected by GANC exhibited a slightly differentiated morphology. G418-resistant clones were initially screened by PCR and positive clones were chosen for subsequent confirmation of homologous recombination by Southern blot analysis. EcoRI digests of genomic DNA of homologous recombination-positive clones should give rise to the 9.5 kb band hybridized with probe 1. Such band was confirmed in 10 independent clones (Figs 1C, 2A). All of the clones with the homologous recombination showed a single band with a neo probe (data not shown). Table 1 summarizes targeting efficiencies of the vectors with basically similar strucTable 1. Efficiency of targeting integration with various kinds of vectors in D3 ES cells Vector pCO3B-TK/BALB pCO3B-TK/129 pCO3B-TK/129 pCO3B-DT/129

Selection

Ratio of positive clones

G418 + GANC G418 + GANC G418 G418

1/600 3/120 5/700 1/120

Fig. 1. Gene targeting at the functional RBP-Jκ gene. (A) Genomic organization of the RBP-Jκ gene. Putative nuclear localization signal (NLS) is located in exon 4 and integrase motif is located in exons 6 and 7 as indicated. (B) Structure of targeting vectors pCO3-tk and pCO3-DT. Both targeting vectors contain PGKneobpa cassette in the opposite transcriptional orientation to the RBPJκ gene. pCO3-tk and pCO3-DT have negative selection markers of PGK-HSVtk and nc1-DT-A, respectively, at the 3′ end of the vectors in the same orientation to the RBP-Jκ gene. (C) Structure of the RBP-Jκ locus resulting from homologous recombination between the endogenous locus and pCO3 targeting vectors. (D) PCR for detecting homologous recombination caused by pCO3 targeting vectors. The PCR primers, RBP-Jκ reverse and neo, used for screening are indicated by arrowheads. (E) Structure of pCO5 targeting vector for producing double knock-out ES cells. Hygro and lacZ genes were inserted at the same site of the neo gene of pCO3 targeting vectors and were in the same and opposite transcriptional orientation to the RBP-Jκ gene, respectively. (F) Structure of the RBP-Jκ locus generated by homologous recombination with pCO5. Solid and open rectangles show exons and introns of the RBP-Jκ gene, respectively.

3294 C. Oka and others mice with one disrupted allele showed no obvious abnormality by either macroscopical or microscopical examination (data not shown). Heterozygous animals were crossed into two inbred backgrounds (129/Sv and C57BL/6) and one outbred background (CD1). The phenotype associated with the mutant RBP-Jκ gene was essentially the same in the different backgrounds and remained associated through as many as 4 generations of outcrosses to wild-type mice. Double knock out of the RBP-Jκ gene in ES cells It was essential to confirm that the homologous recombination with the targeting vector resulted in the loss of the functional RBP-Jκ protein because of the presence of the four structurally Fig. 2. Southern blot analysis of DNAs of ES cells and embryos. (A) Southern blot analysis of DNAs of ES cell clones transfected with pCO3B-tk/129 targeting vector. DNA samples from G418 resistant clones were digested with EcoRI and hybridized with probe 1. Arrowheads indicate the bands of pseudogenes. (B) Southern blot analysis to determine the genotype of 10.5 dpc embryos from heterozygous intercrosses of RBP-Jκ−/+ mice. Arrowheads indicate the bands of pseudogenes.

tures under conditions with or without GANC. The frequencies of homologous recombination by the vector constructed with isogenic genomic DNA (129/Sv) were 15 times more than that with non-isogenic DNA (BALB/c). Negative selection by GANC and DT-A gave threefold and no enrichment, respectively, over G418 selection alone. Two D3 cell clones, named 3B-1 and 3B-6, in which one allele of the gene had been disrupted with targeting vectors pCO3-tk/BALB and pCO3-tk/129, respectively, were injected into C57BL/6 blastocysts. The phenotypes of homozygous mutant mice derived from the two D3 clones were indistinguishable, thus the data from the two have been combined. The

Fig. 3. Southern blot analysis and western blot analysis of doubly targeted ES cells. (A) Southern blot analysis of DNAs of ES cell clones transfected with the targeting vector pCO5. DNA from hygromycin resistant clones were digested with EcoRI and hybridized with probe 2. An arrowhead indicates the pseudogenes. (B) Western blot analysis of RBP-Jκ+/− and RBP-Jκ−/− ES cells. Nuclear extracts from ES cell clones were fractionated in a 7% acrylamide gel and transferred to a membrane filter. The blot was probed with the monoclonal antibody against RBP-Jκ protein. An arrowhead indicates the expected size of the RBP-Jκ protein.

Fig. 4. Phenotypes of RBP-Jκ+/− or RBP-Jκ+/+ and RBP-Jκ−/− embryos at 8.5 dpc. (A, B) Dorsal view of RBP-Jκ−/− mutant (A) and RBP-Jκ+/− or RBP-Jκ+/+ littermate (B). (A) Note the unsegmented mesoderm at either side of the neural tube. (B) The wild-type embryo shows 8 pairs of somites at this stage. (C,D) Histological section (horizontal) of RBP-Jκ−/− embryo (C) and RBP-Jκ+/− or RBPJκ+/+ embryo (D). (C) Somites are loose and irregularly arranged. The neural tube has an irregular shape. (D) Somites are tightly packed and the neural tube shows a normal straight shape. Anterior is to the top. Magnification: −25× in A, B; −90× in C,D.

RBP-Jκ gene knock-out mice 3295 RBP-Jκ-related genes as described above. To produce D3 cell lines in which both alleles of the RBP-Jκ gene were disrupted, another targeting vector pCO5/129 containing the insertion of the hygromycin-resistant gene (Hygro) and the lacZ gene in exon 7 was constructed and electroporated into 3B-6 ES cell clone (Fig. 1E). Both pCO3-tk/129 and pCO5/129 were constructed from isogenic 129/Sv DNA and the locus of the insertion of the drug resistance gene in pCO3-tk/129 was identical to that in pCO5/129. However, the lengths of the 5′ homologous DNA of pCO3-tk/129 and pCO5/129 are 290 bp and 7.5 kb, respectively. Therefore, EcoRI digests of the intact gene, the disrupted gene with pCO3-tk/129 and the disrupted gene with pCO5/129 give rise to 15, 7.5 and 8.7 kb fragments hybridized with probe 2, respectively (Fig. 3A). Consequently, the 7.5 and 8.7 kb recombinant fragments should be detected when both alleles were disrupted, whereas the 15 kb intact and the 8.7 kb recombinant fragments should be found when the allele already disrupted with pCO3-tk/129 was disrupted again with pCO5/129 (Fig. 1C,F). As a whole, the frequency of homologous recombination with pCO5/129 among hygromycinresistant clones was 23/101, which is about 30 times higher than

that with pCO3-tk/129. In the majority (21 of 23) of targeted clones, the Hygro and lacZ genes were integrated in the wildtype RBP-Jκ allele, giving rise to cell lines in which both RBPJκ alleles were disrupted. In the remaining two recombinants, the Hygro and lacZ sequences had replaced the neo gene. The homozygously RBP-Jκ-mutated ES cells were capable of extensive proliferation with no alterations in their growth characteristics. These cells were expanded to provide materials for the protein analysis. Three randomly chosen cell lines were transferred several times without feeder cells and nuclear extracts were prepared for western blotting analysis. As shown in Fig. 3B, the RBP-Jκ protein was completely absent in the ES cell line, both alleles of which had been targeted. But the protein was synthesized in the cells in which one RBP-Jκ allele had been disrupted. Thus the mutation that caused disruption in exon 7 by the gene insertion appeared to be a null mutation of RBP-Jκ in ES cells as expected. Embryonic lethality of the mice homozygous for the disrupted RBP-Jκ allele To investigate the in vivo effect of null mutation of RBP-Jκ,

Fig. 5. Phenotypes of RBPJk−/− embryos at 9.5 dpc. (A) Lateral view of RBP-Jκ−/− mutant embryo (left) and RBP-Jκ+/+ embryo (right). (B) Dorsal view of the cephalic region of the homozygous mutant embryo shown in (A). RBP-Jκ−/− mutant shows severe growth retardation, incomplete rotation, microencephaly, opening of anterior neuropore (arrow), and tortuous neural tube. (C-F) Histological sections of RBP-Jκ−/− embryo (C,E) and RBP-Jκ+/+ embryo (D,F). Neural tube is closed in the RBP-Jκ+/+ embryo while anterior neuropore is persistently open in the RBPJκ−/− embryo (arrow). C, D are transversal and E, F are longitudinal sections. Magnification: ~10× in A; ~40× in B; 860× (C,D) and 330× (E,F).

3296 C. Oka and others Table 2. Genotype frequency of progeny from intercrosses of RBP-Jκ heterozygous mice Numbers of embryos or mice (%) Stages 8.5 days of gestation 9.5 days of gestation 10.5 days of gestation 12.5 days of gestation Newborn or Adult

+/+

+/−

−/−

17 (30) 54 (25) 46 (30) 14 (28) 50 (39)

27 (48) 118 (55) 89 (57) 36 (72) 78 (61)

12 (21) 43 (20) 21 (13) 0 0

Resorbed embryos are not included. Percentages of each viable class are included in parenthesis. Analysis performed by PCR. Data include only those litters where all embryos were analyzed.

RBP-Jκ+/− mice were intercrossed. Genotypes of the resulting offspring were determined at 5 weeks of age by Southern blot analysis of tail DNA using probe 1 (Fig. 2B). No mice homozygous for the null RBP-Jκ mutation were found, suggesting that the mutation may result in embryonic lethality. To determine the time of intrauterine death more precisely, RBP-Jκ+/− animals were intercrossed and pregnant females were killed to examine embryos at different gestation times from 7.5 to 12.5 dpc. We found that 10-25% of embryos began to be resorbed at 8.5 dpc. At 9.5 dpc empty yolk sacs were found in some cases, indicating that some of the mutant embryos were already resorbed. At 10.5 dpc, all of the RBPJκ−/− embryos identified were moribund or dead and in the process of resorption. At 12.5 dpc, no homozygous mutant embryos were found. As summarized in Table 2, these studies demonstrate that the ratio of wild-type, RBP-Jκ+/− and RBPJκ−/− embryos significantly deviated from the expected value (1:2:1) after 10.5 dpc although a slight deviation began at 8.5 dpc. This analysis indicates that the absence of the functional RBP-Jκ expression results in embryonic lethality at around 8.5 dpc. Developmental delay of the RBP-Jκ−/− embryos At 8.5 dpc and 9.5 dpc, RBP-Jκ−/− embryos were always substantially developmentally retarded and had reduced sizes as compared with their RBP-Jκ+/− or RBP-Jκ+/+ littermates. The developmental delay of homozygous RBP-Jκ mutant embryos was determined by counting the number of somite pairs after genotyping embryos by PCR with yolk sac DNA (Table 3). Somites form in the embryo in a craniocaudal direction as condensed blocks of mesoderm flanking on each side of the neural tube. We found 4±1 (mean ± s. d.) somite pairs for the RBP-Jκ−/− embryos and 7±2 somite pairs for the RBP-Jκ+/− or RBP-Jκ+/+ embryos. The difference in the numbers of somites was significant by Student t-test with P value