Lap2α Expression is Controlled by E2F and Deregulated in Various ...

[Cell Cycle 5:12, 1331-1341, 15 June 2006]; ©2006 Landes Bioscience

Lap2α Expression is Controlled by E2F and Deregulated in Various Human Tumors Report

ABSTRACT Deregulation of the retinoblastoma (pRB) tumor suppressor pathway is frequently observed in human cancer and associated with aberrant activity of E2F transcription factors. We have performed microarray based analysis with the aim of identifying potential downstream mediators of the tumor suppressing activity of pRB. Here we report that the expression of LAP2 (lamina-associated polypeptide 2) is under direct control of E2F transcription factors. Chromatin immunoprecipitation assays show that the LAP2 promoter is bound by endogenous E2F in vivo. The LAP2 promoter is transactivated by ectopically expressed E2F and mutation of E2F binding sites eliminates this effect. We studied the expression level of LAP2α in human tumors by tissue microarray analysis and found LAP2α over expression in a significant percentage of primary larynx, lung, stomach, breast, and colon cancer tissues. In agreement with its regulation by E2F, LAP2α over expression in primary tumors was found to be correlated with tumor proliferation rate.

2Department of Experimental Oncology, European Institute of Oncology; Milan, Italy

*Correspondence to: Heiko Mueller; European Institute of Oncology c/o IFOM; Via Adamello 16; Milano 20139 Italy; Tel.: +39.02.574303263; Fax: +39.02.574303244; Email: [email protected]

INTRODUCTION

ON

Original manuscript submitted: 04/18/06 Manuscript accepted: 04/19/06

OT D

1The FIRC Institute of Molecular Oncology Foundation; Milan, Italy

IST

RIB

UT E

.

Paola Parise1,2 Giacomo Finocchiaro1,2 Barabara Masciadri1,2 Micaela Quarto1,2 Stefanie Francois1,2 Francesco Mancuso1,2 Heiko Muller1,2,*

The process of transforming a normal cell into a cancer cell is characterized by a number of acquired traits, namely self-sufficiency in growth signals, loss of responsiveness to anti-growth signals, evasion of apoptosis, limitless replicative potential, sustained angiogenesis, and tissue invasion/metastasis.1 Deregulated pRB tumor suppressor function has been associated mainly with loss of sensitivity to growth restraining signals. pRB exerts much of its anti-proliferative activity via regulation of E2F transcription factors.2 Expression microarray studies and E2F-specific chromatin immunoprecipitation assays have resulted in the identification of numerous candidate E2F target genes.3-10 Many of them have the potential to interfere with the regulation of traits that are acquired in the course of oncogenesis. However, no single E2F target gene can explain the pleiotropic effects of pRB loss. Therefore, detailed characterization of candidate E2F target genes is actively pursued. Analysis of microarray data has indicated that the expression of the LAP2 locus might be controlled by E2F1, E2F2, E2F3, p16 and pRB.3,8 The LAP2 locus has been found to be differentially expressed in other tumor related high throughput screenings. Specifically, LAP2 was reported to be a RAS transformation target,11 to be regulated by BRCA1,12 in response to DNA damage,13 and in prostate,14 colon15 and central nervous system embryonal tumors.16,17 Despite of these findings, little is known about the regulation of LAP2 expression. The LAP2 locus gives rise to up to six isoforms in mammals that are generated by alternative splicing.18-20 The best characterized isoforms are LAP2α and LAP2β. LAP2β binds to B-type lamins at the nuclear periphery.21,22 LAP2α specifically interacts with A-type lamins in the nuclear interior as part of a nucleoskeletal structure.23,24 Lamins are type V intermediate filament proteins that can be grouped into constitutively expressed B-type lamins and developmentally regulated A-type lamins.25 While B-type lamins are essential for viability, A-type lamins are not and inherited mutations of A-type lamins give rise to laminopathies, a heterogenous group of diseases that affect heart, muscle, adipose, bone and nerve cells.26 Interestingly, CpG island promoter methylation of the LMNA, the gene that encodes all A-type lamins, has recently been described in nodal diffuse large B-cell lymphoma.27 Moreover, a genomic instability phenotype has been detected in ZMPSTE24 knock out mice.28 ZMPSTE24 is a metalloproteinase responsible for the maturation of prelamin A and introduction of mutated prelamin A that cannot be processed by ZMPSTE24 into wild-type mice also results in genomic instability, indicating that the phenotype

KEY WORDS

IEN

LAP2, promoter, E2F, overexpression, cancer, tissue microarray

CE

.D

Previously published online as a Cell Cycle E-publication: http://www.landesbioscience.com/journals/cc/abstract.php?id=2833

SC

ACKNOWLEDGEMENTS

06

NOTE

LA

ND

ES

BIO

We thank Dr. Maria Stella Carro and Dr. Fabio Mario Spiga for helpful comments and support. This work was supported by grants from AIRC (Associazione Italiana per la Ricerca sul Cancro). The sequence-related part of this work has been conducted on a HP rx4640 Itanium2 server granted to IFOM in the framework of the ‘HP Integrity’ program coordinated by Dr. Alessandro Guffanti.

©

20

Supplemental Material can be found at: www. landesbioscience.com/journals/cc/supplement/ pariseCC5-12-sup.pdf.

www.landesbioscience.com

Cell Cycle

1331

Lap2 Regulation by E2F

of ZMPSTE24 knock out mice is caused by lack of mature A-type lamins. Among the binding partners of A-type lamins, LAP2α is the best characterized. It has separate binding sites for A-type lamins, BAF (barrier to autointegration factor), chromatin, and pRB.23,24,29,30 LAP2α binds tightly to A-type lamins in interphase.23 Within minutes after the onset of anaphase, LAP2α accumulates in distinct regions at the tips of lagging chromosome ends and redistributes back to the nuclear interior in late telophase, indicating that LAP2α may play a role in positioning telomeres within the reforming nucleus and in the reestablishment of a higher order chromatin structure at the end of mitosis.31 Furthermore, LAP2α is required for tethering pRB to the nuclear skeleton, protecting it from proteosomal degradation.32 Our previously reported microarray results indicated that the expression of LAP2 might be controlled by E2F, p16, and pRB.8 Therefore, we investigated the expression level of LAP2α in human cancer and the regulation of gene expression from the LAP2 promoter. Here we report that the LAP2 promoter is under direct control of E2F transcription factors. Chromatin immunoprecipitation assays showed that the LAP2 promoter is bound by E2F transcription factors in vivo. The promoter has been isolated and was found to be responsive to E2F mediated transactivation in luciferase reporter assays. We describe the expression of an E2F responsive antisense RNA from the first intron of the LAP2 locus and the isolation of its promoter region whose activity is also stimulated by E2F. We find that the expression levels of sense and antisense transcripts are positively correlated in a panel of human cancer cell lines. In support of LAP2 being an E2F target gene, tissue microarray analysis of primary human tumors indicates that LAP2α is over expressed in a variety of tumors in tight correlation with tumor proliferation rate.

MATERIALS AND METHODS

Cell culture. Human U-2 OS, T98G, SKBR3, MCF7, T47D, MDA_MB134, MDA_MB231, MDA_MB361, MDA_MB415, MDA_MB453, MDA_MD468, BT549. SK_mel28, RPMLI7951, A375, SW480, DLD1, HCT116, IMR90, MRC5, A549, CALU1 were cultured in DMEM with 10% fetal bovine serum. Human COLO858, HT29 were cultured in RPMI with 10%FBS NA Human C32, G361. MEM with 10%FBS NA Human IGR39, IGR37, DMEM with 15%FBS NA Human LOVO, Ham’sF12 with 10%FBS NA U2OS-HAERE2F3 cells were cultured as previously described in reference 3. Plasmids. The LAP2α promoter fragment was cloned from human genomic DNA (Roche) using Taq PCR core kit (Qiagen). A fragment between nucleotide -817 and +287 was amplified using the following primers: LAP2-promoter-for: 5'-AGGATTCTTGCGGGTGGTGG-3' and LAP2-promoter-rev: 5'-GGCAGCGTCACATTGTTGG-3'. The PCR product was cloned in PGEM T-easy vector, cut with NcoI and SpeI enzymes, filled-in and blunt-end cloned into the HindIII digested pGL3-basic luciferase reporter plasmid (Promega). Point mutations in the two putative E2F binding sites were generated using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions, using the following primers: Mut1fw: 5'-GGGAGCCTCGGCTCCAACCCCAGCGCCTTTTAAACTG-3' Mut1rev: 5'-CAGTTTAAAAGGCGCTGGGGTTGGAGCCGAGGCTCCC-3' 1332

Mut2fw: 5’-GCTAATGGAACCCGAACGAGCCGTCTCGCCAATCACC-3’ Mut2rev: 5’-GGTGATTGGCGAGACGGCTCGTTCGGGTTCCATTAGC-3’ The truncated forms were generated by cloning the different PCR products into pGL3 basic luciferase vector using the following primers: Tr1fw: 5'-GCCTTGAAGCTTTGACACTAAGAAGTGAATG-3' Tr2fw: 5'-GCCTTGAAGCTTCCTTCAGGGCTAGCGTTTG-3' Tr3fw: 5'-GCCTTGAAGCTTCTGCGTTTCTACCTCCTCTC-3' Tr4fw: 5'-GCCTTGAAGCTTCTTGGCCGCAGTTGGTTCG-3' pGL3rev:5'-GCGTCTTCCATGGTGGCTTTACC-3' Chromatin imunoprecipitation. Chromatin immunoprecipitation was performed as described by.33 U-2 OS cells were cross-linked with 1% formaldehyde for 10 min and stopped with 0.125 M glycine for 5 min. Fixed cells were then washed in Tris-buffered saline and harvested in sodium dodecyl sulfate buffer. After centrifugation, cells were resuspended in ice-cold immunoprecipitation buffer and sonicated to obtain fragments of 500–1000 pb. The obtained lysates were precleared with Protein A beads and incubated at 4˚C overnight with 2 µg of polyclonal antibody anti E2F3 (sc-878, Santa Cruz) or 4,6 µg of monoclonal antibody anti FLAG M2 (SIGMA). The immunocomplexes were recovered by incubating the lysates with protein A for 2 additional hours at 4˚C. After extensive washing the immunocomplexes were eluted, reverse cross-linked and DNA was recovered by phenol-chloroform extraction and ethanol precipitation. DNA was resuspended in 200 µl of water and 10 µl were analyzed by quantitative PCR to evaluate the recovery of specific sequences. PCRs were run on an ABI Prism 7700 sequence detection system using SYBR Green reaction mix (Perkin-Elmer). Primers were designed using Primer Express software (Applied Biosystems, Forster City, Calif.) following the manufacturer’s indications. The primers used were the following: cdc6-for: 5'-AAAGGCTCTGTGACTACAGCCA-3'; cdc6-rev : 5'-GATCCTTCTCACGTCTCTCACA-3'; LAP2-ChIP-for: 5'-TTCGCAGATCCCCGAGATG -3'; LAP2-ChIP-rev: 5'-TGCAGGTAGAGCTGGACGTACA -3'. Luciferase reporter assays. U-2 OS cells were plated on 6-well dishes and transfected by the calcium phosphate method using 200 ng of reporter constructs and 500 ng of different E2Fs constructs. In all experiments, 0.5 µg of pCMV b-Gal plasmid was cotransfected for normalization of transfection efficiency. The luciferase activity was measured using the previously described procedure.34 Immunostaining. U-2 OS-HAERE2F3 cells were treated with or without 600 nM 4-hydroxytamoxifen (OHT) for 24 hours and stained using the anti HA.11 antibody (BAbCO) following the previously described procedure.34 Strand specific cDNA synthesis and RT-PCR. Total RNA derived from U-2 OS cells harboring tamoxifen inducible HAERE2F3 was digested with DNAse and reverse transcribed using Superscript II RNaseH reverse transcriptase (Life Technologies) according to the manufacturers instructions. For detection of the LAP2 antisense transcript, the following oligonucleotide was used for strand specific cDNA synthesis: LAP2 forward: 5'-GTTCGTAGTTCGGCTCTGG-3' RT-PCR amplification of the LAP2 antisense transcript was carried out using the following primers pairs under standard conditions for 35 cycles: LAP2 antisense for: 5'-GGCCCCTTGCTGTTGGT-3' LAP2 antisense rev: 5'-GCCGGAGTTCCTGGAAGAC-3'

Cell Cycle

2006; Vol. 5 Issue 12

Lap2 Regulation by E2F

with a [35S]UTP-labeled riboprobe designed in the region between nucleotide 622 and 894 starting from the ATG. The following primers containing T7 and Sp6 promoters for synthesis of sense and antisense riboprobes were used to amplify the LAP2α specific fragment: Forward: AATTAACCCTCACTAAAGGGGAACTTGGAACTACTCCCTC Reverse: TAATACGACTCACTATAGGGAGGCTGAGAAGATGACGAAG TMA sections were deparaffinized, digested with Proteinase K (20 µg/ml), postfixed, acetylated and dried. After overnight hybridization at 50˚C, sections were washed in 50% formamide, 2X SSC, 20 mM 2-mercaptoethanol at 60˚, coated with Kodak NTB-2 photographic emulsion and exposed for three weeks. The slides were lightly H&E counterstained and analyzed at the microscope with a darkfield condenser for the silver grains. All TMAs were first analyzed for the expression of the housekeeping gene β-actin, to control the mRNA quality of the samples. Gene expression levels were evaluated by counting the number of grains per cell and were expressed in a semiquantitative scale (ISH score): 0 (no staining), 1 (1–25 grains; weak staining), 2 (26–50 grains; moderate staining), and 3 (>50 grains, strong staining). ISH scores 2 and 3 were considered to represent an unequivocally positive signal. Statistical analysis of TMA Data. χ2 homogeneity test was applied to the 4 x 3 contingency table of Ki67 and LAP2α expression levels shown in Figure 6C.

Figure 1. Lap2α is a direct target of E2F3. (A) Immunofluorescence analysis of U-2 OS-HA ERE2F3 inducible cell line. U-2 OS-HAEREF3 were induced with 600 nM of 4-hydroxytamoxifen (OHT) for 24 hours and subsequently stained with anti-HA antibody (B) real time quantiative PCR assay (SYBRGreen) on RNA isolated from U-2 OS cells expressing inducible HAERE2F3 after 24 hours of treatment with 600 nM of OHT. CCNE1 = Cyclin E1. (C) LAP2α expression upon E2F3 induction is independent of protein synthesis. U-2 OS-HA ERE2F3 were treated for 4,8,16 hours with or without OHT (600 nM) in the absence or in the presence of cycloheximide (10 µg/ml).

Tissue microarray. Tissue microarray analysis (TMA) was performed on 5 TMAs constructed with 460 formalin fixed and paraffin embedded human tumor samples. Samples were provided from Ospedale Maggiore, Novara, Italy; Ospedale Civile, Vimercate, Italy; and the European Institute of Oncology, Milan, Italy. To detect LAP2α mRNA expression, in situ hybridization (ISH) was performed www.landesbioscience.com

N: sum of all samples analyzed (270) ni: sum of all samples with given Ki67 expression level (row sum) nj: sum of all samples with given LAP2α expression level (column sum) nij: sum of all samples with given LAP2α and Ki67 expression level Real-time RT-PCR. Twenty micrograms of RNA were used, primed with 20 ng of random hexamers, in a reverse transcription reaction (SUPERSCRIPT II, Invitrogen). Five nanograms of cDNA was amplified (in triplicate) in a reaction volume of 15 µL containing the following reagents: 7.5 µl of TaqMan PCR Mastermix 2x (Applied Biosystems), 0.75 µl of TaqMan Gene expression assay 20x (Applied Biosystems, Foster City, CA). Real-time PCR was carried out on the ABI/Prism 7900 HT Sequence Detector System (Applied Biosystems), using a pre-PCR step of 10 min at 95˚C, followed by 40 cycles of 15 s at 95˚C and 60 s at 60˚C. Preparations with RNA template without reverse transcriptase were used as negative controls. Samples were amplified with specific primers and ribosomal 18S RNA, GAPDH, and Actin as controls. Q-PCR using SYBR Green reaction mix (Perkin Elmer) was performed on total RNA prepared from U-2 OS-HAERE2F3 cells using RNeasy extraction kit (Qiagen) after 24 hours of induction with OHT and normalized to GAPDH, actin and 18SRNA expression. The following primers and Taqman probes were used: Taqman probe sense Lap2α (assay on demand, Applied Biosystems, Foster City, CA) Taqman probe antisense Lap2 (assay by design, Applied Biosystems, Foster City, CA, 5'-CTCGGTCCTGCAGCACC-3') CCNE1for: 5'-AAATGGCCAAAATCGACAGG-3';

Cell Cycle

1333

Lap2 Regulation by E2F

Figure 2. Sequence alignment of the region between 2000 bp upstream of LAP2 transcription start site and the end of the first intron of human, mouse and rat LAP2α .Two putative E2F binding sites (underlined) conserved among the three species were found in the promoter as well as in the first intron.

CCNE1rev: 5'-GCATTATTGTCCCAAGGCTGG-3' LAP2α for: 5'-CTGGTGGTGGATTTTTTCAGG -3' LAP2α rev: 5'-GACGGGTGGAGATTTCAGGA-3' LAP2 antisense for: 5'-GGCCCCTTGCTGTTGGT-3' LAP2 antisense rev: 5'-GCCGGAGTTCCTGGAAGAC-3' Identification of conserved E2F binding sites. We searched genomic sequences between 2000 bp upstream of the LAP2 transcription start site the and the end of first intron of human (NM_003276), mouse (NM_011605) and rat (NM_012887) RefSeq sequences. Pair wise alignments were generated using blastz35 and then multiply aligned with multiz.36 We select as putative E2F binding sites (TSSCGC) fragments of multiple alignment in which the E2F binding site consensus is conserved in all the three species considered.

1334

RESULTS Previously, we have identified LAP2 as a potential novel target gene of the p16-pRB-E2F pathway. Gene expression data derived from the induction of transcriptional activities of E2F1, E2F2 and E2F3 in a 4-hydroxy-tamoxifen (OHT) dependent manner3 were compared to gene expression data obtained from cells with tetrepressible expression of p16 and pRB.8 Meta-analysis of this dataset revealed the existence of clusters of genes whose expression is induced/repressed by E2Fs and repressed/induced by p16 and pRB. Since expression changes caused by induced expression of p16 and pRB are likely mediated by endogenous E2F proteins, the genes of these two clusters are good candidates for being physiological targets of E2F dependent transcription. This assumption is supported by our finding that E2F binding sites were strongly enriched in the promoters of these genes.8

Cell Cycle

2006; Vol. 5 Issue 12

Lap2 Regulation by E2F

that recognizes the N-terminal HA-tag of the fusion protein (Fig. 1A). As shown in Figure 1B and C, the LAP2α mRNA level increases in response to the induction of E2F3 transcriptional activity as early as 4 h after the addition of OHT and reaches 6 fold induction after 16 h. Importantly, induction of LAP2α expression is not abrogated by the addition of cycloheximide, indicating that protein synthesis is not required for the induction to occur and that LAP2 is a direct E2F target gene. Addition of cycloheximide alone did not cause significant changes in LAP2α expression. Down regulation of LAP2α mRNA upon induction of p16 and pRB expression by Q-PCR had been shown previously.8 Thus, Q-PCR data confirm the microarray prediction that LAP2 expression is induced by E2F and repressed by p16 and pRB. In order to gain further insight into the mechanism of E2F mediated induction of LAP2 expression, we studied alignments of the genomic sequences of human, mouse, and rat LAP2 loci. We identified conserved putative E2F binding sites both upstream as well as downstream of the annotated first exon of the LAP2 transcript (Fig. 2). All four conserved putative E2F binding sites are part of larger conserved blocks of genomic sequence. We used E2F3 specific chromatin immunoprecipitation to answer the question whether the LAP2 promoter was bound by E2F3 in vivo. Recovery of LAP2 promoter specific sequences in the immunoprecipitate was tested using the PCR primers shown in Figure 3A. Although recovery of cdc6 promoter sequences (positive control) was about ten Figure 3. LAP2 promoter activity is controlled by E2F (A) Schematic representation of the genomic times more efficient, we observed highly region corresponding to the LAP2 promoter. The black boxes represent two putative E2F binding sites. significant recovery of LAP2 promoter (B) Chromatin immunoprecipitation (ChIP) assays using an antibody specific for E2F3. cdc6 was used as a positive control. (C) Luciferase reporter assays of LAP2 promoter construct cotransfected with specific sequences if compared to antipCMVE2F1, pCMVE2F2, pCMVE2F3 or pCMVE2F1(E132) DNA binding mutant, in U-2 OS cells. FLAG antibody or no antibody controls (D) Schematic representation of LAP2 promoter construct. Lines (1–4) indicate the four truncated (Fig. 3B). promoters cloned into the pGL3 basic luciferase vector using primers described in Materials and Next, we cloned the genomic region Methods. (E) Luciferase assay of LAP2 truncated promoter constructs (1–4) cotransfected with pCMV indicated in Figure 3A and tested it for E2F empty (basal activity) and pCMV E2F3 (inducible activity) in U-2 OS cells. (F) Luciferase assay of LAP2 inducible promoter activity in luciferase promoter constructs carrying point mutations in either or both potential E2F binding sites. The activity in response to ectopic expression of E2F3 was measured. reporter assays. As shown in Figure 3C, the activity of the LAP2 promoter fragment In order to verify the microarray based prediction for LAP2, we was induced up to 30-fold by cotransfection of E2F1, E2F2, and tested expression levels of LAP2 in response to E2F3 induction by E2F3 expression constructs. Significantly, a DNA binding deficient SYBR-Green quantitative PCR (Q-PCR) in U-2 OS cells harboring mutant of E2F1 (E132) did not transactivate the LAP2 promoter, an OHT inducible allele of E2F3 resulting from the fusion of the indicating that DNA binding of E2F1 to the promoter is required ligand binding domain of the estrogen receptor to the N-terminus for transactivation. Sequential truncation of the promoter fragment of E2F3.3 Because of its role in regulating pRB stability and nuclear from the 5' end indicated that most of the promoter activity is tethering,30,32 the results for the LAP2α isoform are reported. retained in a 442 bp fragment (Fig. 3D and E). This fragment Similar results were obtained for the β/γ isoforms of LAP2 (data not contains the two conserved putative E2F binding sites. Removal of shown). Induction of transcriptional activity in U-2 OS HAERE2F3 these putative E2F binding sites by further truncation of the promoter cells by addition of OHT induces nuclear import of the fusion fragment results in a dramatic loss of basic promoter activity as well protein that can be detected by immunostaining with an antibody as of E2F responsiveness of the promoter (Fig. 3D and E). This finding www.landesbioscience.com

Cell Cycle

1335

Lap2 Regulation by E2F

Figure 4. Promoter activity in the first intron of LAP2. (A) Bioinformatic identification of LAP2 antisense RNA. All the identified RNAs show a polyA, a canonical splice site GT-AG and map on Aceview Gene Lunar.aAug05 (B) A 1017 bp fragment derived from intron1 was cloned upstream of the pGL3basic luciferase reporter vector in both orientations. (C) Basic and E2F inducible promoter activity of the intron derived fragment was determined in U-2 OS cells harboring tamoxifen (OHT) inducible HAERE2F3. (D) Same assay as in (C) except that the intron derived fragment was cloned in reverse orientation. (E) Strand specific cDNA synthesis followed by RT-PCR was used to detect the expression of an E2F inducible anti-sense transcript in U-2 OS cells harboring tamoxifen (OHT) inducible HAERE2F3.

is supported by constructs containing point mutations of either/ both putative E2F binding sites in the context of the untruncated promoter fragment. Mutation of either or both putative E2F binding sites resulted in strongly reduced E2F responsiveness of the LAP2 promoter (Fig. 3F). We conclude that the LAP2 promoter is bound by E2F3 in vivo and transactivated by E2F1, E2F2, and E2F3 in a manner that is dependent on the conserved E2F binding sites in the LAP2 promoter as well as the DNA binding function of E2F. Next, we investigated the role of the conserved putative E2F binding sites located in the first intron of the LAP2 locus. Inspection of cDNA and EST sequences revealed the existence of a spliced antisense transcript that originates from within the first intron (Aceview gene: lunar.aAug05, Fig. 4A), suggesting that the region of intron 1 1336

that is located immediately downstream of exon 1 has promoter activity. Thus, we cloned a 1017 bp fragment immediately downstream of exon 1 into a pGL3Basic-luciferase reporter construct and tested it for the presence of promoter activity (see supplementary material). Since the presence of an antisense transcript suggested promoter activity in the antisense direction, we tested the intron 1 derived fragment in both orientations (Fig. 4B). We observed basic promoter activity for both orientations of the cloned fragment that drove luciferase transcription at least five fold above background levels. When E2F3 was cotransfected, promoter activity was strongly induced, 12-fold in the sense construct and 8-fold in the antisense construct (Fig. 4C and D). These results suggested that the antisense transcript may indeed originate from a promoter located in the first

Cell Cycle

2006; Vol. 5 Issue 12

Lap2 Regulation by E2F

Figure 5. Lap2α expression in serum stimulated cells and cancer cell lines. (A) Scheme indicating the splice junction used to design Taqman probes. (B) T98G cells were serum starved for 48 h and stimulated to enter the cell cycle by the addition of 10% serum. LAP2α sense and LAP2 antisense RNA expression was measured by Taqman Q-PCR. Relative expression levels normalized to 18S RNA are shown. (C) Q-PCR with Taqman probes for LAP2α sense and LAP2 antisense RNA, 10 breast cancer cell lines, 7 melanoma cell lines, 6 colon cancer cell lines, 2 lung cancer cell lines and 2 diploid fibroblast cell lines were tested. Relative expression levels normalized to 18S RNA are shown. Global Spearman rank correlation was calculated for the expression levels of sense and anisense RNAs.

intron of LAP2 and that this transcript may be E2F inducible. We tested this possibility by strand specific reverse transcription followed by PCR amplification of the antisense transcript in the absence or presence of OHT in U-2 OS HAERE2F3 cells. As shown in Figure 4E, we observed barely detectable levels of the antisense transcript in the www.landesbioscience.com

absence of OHT. However, when transcriptional activity of E2F3 was induced by the addition of OHT, the expression level of the antisense transcript was strongly induced. Thus, an E2F inducible antisense transcript is expressed from the first intron of the LAP2 locus.

Cell Cycle

1337

Lap2 Regulation by E2F

Figure 6. LAP2α is over expressed in primary human cancer in correlation with tumor proliferation rate. (A) A representative example of in situ hybridization (ISH) for LAP2α of a colon and a larynx tumor sample. The level of LAP2α mRNA was determined by ISH on TMA. For each TMA sample, tumor (T) and surrounding normal (N) tissue was analyzed. The bright field panels show the tissue sample stained with hematoxylin and eosin to illustrate tissue morphology. The dark field panels show the LAP2α specific signal. (B) Summary table of LAP2α expression on the TMA tested. (C) 4 x 3 contingency table of Ki67 and LAP2α expression levels for the TMAs tested. (D) Visual representation of contingency table data.

In order to gain further insight into the regulation of LAP2 expression, we tested the expression levels of LAP2α sense and LAP2 antisense transcripts in serum starved and restimulated T98G cells as well as in a panel of cancer cell lines. Again, the α isoform of LAP2 was chosen for this analysis. The expression level of both the sense 1338

and the antisense transcripts was measured using Taqman probes that were designed on splice junctions to eliminate the possibility of false positive results due to the presence of DNA contamination (Fig. 5A). Furthermore, the use of Taqman probes allowed measuring the level of the sense and antisense transcripts in the same sample

Cell Cycle

2006; Vol. 5 Issue 12

Lap2 Regulation by E2F

without the need for strand specific reverse transcription. As shown in Figure 5B, the expression level of both the sense and the antisense transcripts was significantly induced as cells reentered the cell cycle, a behavior that is often seen in E2F target genes. Interestingly, the expression levels of the sense and antisense transcripts appear to be positively correlated (global Spearman rank correlation 0.54). We conclude that both sense and antisense transcripts expressed from the LAP2 locus are controlled by E2F and are expressed in a growth dependent manner. Since E2F activity is deregulated in many human cancers as a consequence of mutations in the tumor suppressors pRB or p16, we tested whether LAP2 expression might be deregulated in cancer cell lines. A panel of cancer cell lines and diploid fibroblasts was investigated for the expression levels of the LAP2α messenger RNA and the level of antisense RNA expression by Taqman quantitative PCR (Fig. 5C). Both the sense and the antisense transcripts were found strongly over expressed in a number of cell lines as compared to diploid fibroblasts (IMR90, MRC5). Correlation analysis revealed that the expression level of sense and antisense transcripts is strongly correlated in colon cancer cell lines, weakly correlated in melanoma cell lines, and nearly uncorrelated in breast cancer cell lines. In no case were the expression levels found to be anti correlated. The role of the antisense transcript in the regulation of LAP2 expression is unclear at the moment and requires further investigation. Finally, we studied the expression level of the LAP2α sense transcript in primary human tumors by tissue microarray analysis. Since the LAP2 antisense RNA is expressed at about 1/10th of the level of the LAP2α sense RNA, testing the expression level of the LAP2 antisense RNA on tissue microarrays was not feasible. We designed a probe that specifically recognizes the LAP2α isoform by in situ hybridization. As shown in Figure 6A and B, LAP2α was found over expressed in a significant percentage of larynx, lung, stomach, breast and colon cancer tissues as well as in lymphomas. Representative images showing LAP2α over expression in colon and larynx cancer are shown in Figure 6A. As an E2F target gene, LAP2α over expression in primary human tumors might be correlated with tumor proliferation rate. To test this hypothesis, the expression levels for both genes were divided into categories: not detected, weak, medium, and strong in the case of Ki67, and not detected, medium, and strong in the case of LAP2α. The data were arranged in a 4 x 3 contingency table (Fig. 6C). A total of 270 samples were analyzed. A χ2 homogeneity test was performed to test the null hypothesis that the expression levels of the two genes are independent of each other. A χ2 value of 49.37 was obtained from the analysis of the contingency table (see Materials and Methods for details of the calculation). Given the degree of freedom of (4 - 1) * (3 - 1) = 6, this χ2 value is associated with a p-value of 6.28 * 10-9. Thus, the null hypothesis is rejected and we conclude that the expression levels of Ki67 and LAP2α are not independent of each other. Visual representation of the contingency table data shown in Figure 6D shows that stronger expression levels of LAP2α are associated with a larger fraction of samples with high Ki67 expression levels. These results indicate that LAP2α over expression in primary human tumors is correlated with tumor proliferation rate and support our finding that LAP2 expression is controlled by E2F transcription factors. www.landesbioscience.com

DISCUSSION We have shown that: 1. Gene expression from the LAP2 promoter is controlled by E2F transcription factors. 2. An E2F regulated antisense transcript is expressed from the first intron of the LAP2 locus. 3. LAP2α, the LAP2 isoform that binds A-type lamins, is over expressed in a variety of primary human tumors (particularly larynx-, lung-, stomach-, breast-, colon-cancers and lymphoma) and tumor cell lines. 4. LAP2α over expression in primary human tumors is correlated with tumor proliferation rate. Our results support previously published data that reported deregulated LAP2 expression in prostate, colon, and central nervous system embryonal tumors. In particular,15 identified LAP2 as one out of 339 genes whose expression increases with advancing colon cancer stage,14 found LAP2 expression up regulated in metastatic prostate cancer as compared to the expression level in primary prostate tissue,16 and17 found LAP2 expression up regulated in medulloblastomas. Other microarray screenings reported differential expression of LAP2 in response to BRCA1 expression,12 ultraviolet and ionizing radiation13 and RAS transformation.11 Our own microarray experiments predicted that LAP2 expression is up regulated by E2Fs and down regulated by p16 and pRB.3,8 Our finding that the LAP2 promoter activity is directly regulated by E2F is in agreement with these findings. In medulloblastoma, CCND2 as a target gene of the sonic hedgehog pathway transcription factor GLI is often found upregulated,17,37,38 leading to phosphorylation of the pRB tumor suppressor with consequent activation of E2F activity. Loss of p16 function by CpG island methylation in medulloblastoma has also been observed.39-42 Moreover, medulloblastoma can be generated in p53-/- mice carrying a mutant pRB gene in the external granular layer cells of the cerebellum.43 Deregulation of the pRB pathway in prostate44-46 and colon cancer is well documented.47,48 E2F 1 is known to be upregulated under conditions of DNA damage,49,50 potentially explaining the findings by13 who reported LAP2 induction following exposure to UV and ionizing radiation. However, due to the design of microarrays, the previously cited data that reported over expression of LAP2 in cancer measured the levels of the β/γ isoforms of LAP2, not the expression of LAP2α. With the exception of the study by reference 17 that reported LAP2α overexpression in medulloblastoma, to our knowledge this is the first report of over expression of LAP2α in human cancer other than medulloblastoma. LAP2α and LAP2β have previously been linked directly to the pRB pathway. LAP2β has been shown to interact with a transcriptional repressor (mGCL) that seems to anchor and repress E2F/DP hetrodimers at the nuclear envelope.51,52 Furthermore, over expression of LAP2β was found to repress E2F/DP transcriptional activity. Thus, up regulation of the LAP2 promoter by E2F leads to the induction of a repressor of E2F activity, resulting in a negative feedback loop. LAP2α interacts with developmentally regulated A-type lamins,20,23 which are known to bind to the retinoblastoma tumor suppressor.53-55 LAP2α was shown to bind directly to pRB and to be necessary for its nuclear tethering.30 In A-type lamin deficient cells, pRB is exposed to proteosomal degradation.32 Thus, LAP2α seems to play a direct role in the regulation of pRB stability, potentially restricting cellular E2F activity in a second negative feedback loop. Our observation of over expressed

Cell Cycle

1339

Lap2 Regulation by E2F

LAP2α in human cancer seems at odds with these findings but may be a reflection of increased E2F activity in tumor cells with deregulated pRB pathway. Given the apparently contradictory functions of LAP2α (restricting cell proliferation by stabilization of pRB on the one hand and its function in telomere positioning of cycling cells on the other hand),31 its expression level may need to be tightly controlled. We identified an E2F responsive antisense transcript that may play a role in fine-tuning LAP2 expression. Antisense transcription has been detected throughout the human genome in a number of studies employing genomic tiling arrays as well as by the analysis of ESTs in silico.56-61 The LAP2 antisense transcript overlaps with the first exon of the LAP2 mRNA and has the potential of forming double-stranded RNA hybrids. These may give rise to endogenously generated small interfering RNAs with a wide range of possible regulatory functions.62 Explicit testing of the regulatory role of mammalian antisense transcripts has revealed that their expression may be positively, negatively or not correlated with the expression of the sense message.58 We have observed strongly positive correlation of sense and antisense LAP2 RNA in colon cancer cell lines, weakly positive correlation in melanoma cell lines, and lack of correlation in breast cancer cell lines. Thus, the potential regulatory function of LAP2 antisense RNA may be tissue dependent. The conservation of two putative E2F binding sites in the first intron of the LAP2 locus in human, mouse, and rat suggests that antisense LAP2 RNA may indeed be functionally important. The precise role of the LAP2 antisense transcript in regulating LAP2 expression levels will be investigated in future studies.

ADDENDUM

While this paper was under review, an article published by Dorner et al. (J Cell Biol 2006;173:83-93) described a direct role of LAP2α in the regulation of cell cycle progression by binding of LAP2α to pRB and E2F target gene promoters in vivo. These findings suggest that LAP2α expression in addition to being controlled by E2F transcription factors (this study) also regulates the expression of other E2F target genes, possibly including its own promoter. References 1. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000; 100:57-70. 2. Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev 1998; 12:2245-62. 3. Muller H, Bracken AP, Vernell R, Moroni MC, Christians F, Grassilli E, Prosperini E, Vigo E, Oliner JD, Helin K. E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev 2001; 15:267-85. 4. Ishida S, Huang E, Zuzan H, Spang R, Leone G, West M, Nevins JR. Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol Cell Biol 2001; 21:4684-99. 5. Markey MP, Angus SP, Strobeck MW, Williams SL, Gunawardena RW, Aronow BJ, Knudsen ES. Unbiased analysis of RB-mediated transcriptional repression identifies novel targets and distinctions from E2F action. Cancer Res 2002; 62:6587-97. 6. Polager S, Kalma Y, Berkovich E, Ginsberg D. E2Fs upregulate expression of genes involved in DNA replication, DNA repair and mitosis. Oncogene 2002; 21:437-46. 7. Weinmann AS, Yan PS, Oberley MJ, Huang TH, Farnham PJ. Isolating human transcription factor targets by coupling chromatin immunoprecipitation and CpG island microarray analysis. Genes Dev 2002; 16:235-44. 8. Vernell R, Helin K, Muller H. Identification of target genes of the p16INK4A-pRB-E2F pathway. J Biol Chem 2003; 278:46124-37. 9. Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA, Dynlacht BD. E2F integrates cell cycle progression with DNA repair, replication, and G2/M checkpoints. Genes Dev 2002; 16:245-56. 10. Wells J, Yan PS, Cechvala M, Huang T, Farnham PJ. Identification of novel pRb binding sites using CpG microarrays suggests that E2F recruits pRb to specific genomic sites during S phase. Oncogene 2003; 22:1445-60. 11. Zuber J, Tchernitsa OI, Hinzmann B, Schmitz AC, Grips M, Hellriegel M, Sers C, Rosenthal A, Schafer R. A genome-wide survey of RAS transformation targets. Nat Genet 2000; 24:144-52.

1340

12. Welcsh PL, Lee MK, Gonzalez-Hernandez RM, Black DJ, Mahadevappa M, Swisher EM, Warrington JA, King MC. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis. Proc Natl Acad Sci USA 2002; 99:7560-5. 13. Rieger KE, Hong WJ, Tusher VG, Tang J, Tibshirani R, Chu G. Toxicity from radiation therapy associated with abnormal transcriptional responses to DNA damage. Proc Natl Acad Sci USA 2004; 101:6635-40. 14. LaTulippe E, Satagopan J, Smith A, Scher H, Scardino P, Reuter V, Gerald WL. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res 2002; 62:4499-506. 15. Agrawal D, Chen T, Irby R, Quackenbush J, Chambers AF, Szabo M, Cantor A, Coppola D, Yeatman TJ. Osteopontin identified as lead marker of colon cancer progression, using pooled sample expression profiling. J Natl Cancer Inst 2002; 94:513-21. 16. Pomeroy SL, Tamayo P, Gaasenbeek M, Sturla LM, Angelo M, McLaughlin ME, Kim JY, Goumnerova LC, Black PM, Lau C, Allen JC, Zagzag D, Olson JM, Curran T, Wetmore C, Biegel JA, Poggio T, Mukherjee S, Rifkin R, Califano A, Stolovitzky G, Louis DN, Mesirov JP, Lander ES, Golub TR. Prediction of central nervous system embryonal tumour outcome based on gene expression. Nature 2002; 415:436-42. 17. Yokota N, Mainprize TG, Taylor MD, Kohata T, Loreto M, Ueda S, Dura W, Grajkowska W, Kuo JS, Rutka JT. Identification of differentially expressed and developmentally regulated genes in medulloblastoma using suppression subtraction hybridization. Oncogene 2004; 23:3444-53. 18. Harris CA, Andryuk PJ, Cline S, Chan HK, Natarajan A, Siekierka JJ, Goldstein G. Three distinct human thymopoietins are derived from alternatively spliced mRNAs. Proc Natl Acad Sci USA 1994; 91:6283-7. 19. Berger R, Theodor L, Shoham J, Gokkel E, Brok-Simoni F, Avraham KB, Copeland NG, Jenkins NA, Rechavi G, Simon AJ. The characterization and localization of the mouse thymopoietin/lamina-associated polypeptide 2 gene and its alternatively spliced products. Genome Res 1996; 6:361-70. 20. Dechat T, Vlcek S, Foisner R. Review: Lamina-associated polypeptide 2 isoforms and related proteins in cell cycle-dependent nuclear structure dynamics. J Struct Biol 2000; 129:335-45. 21. Foisner R, Gerace L. Integral membrane proteins of the nuclear envelope interact with lamins and chromosomes, and binding is modulated by mitotic phosphorylation. Cell 1993; 73:1267-79. 22. Furukawa K, Fritze CE, Gerace L. The major nuclear envelope targeting domain of LAP2 coincides with its lamin binding region but is distinct from its chromatin interaction domain. J Biol Chem 1998; 273:4213-9. 23. Dechat T, Korbei B, Vaughan OA, Vlcek S, Hutchison CJ, Foisner R. Lamina-associated polypeptide 2alpha binds intranuclear A-type lamins. J Cell Sci 2000; 113(Pt 19):3473-84. 24. Dechat T, Gotzmann J, Stockinger A, Harris CA, Talle MA, Siekierka JJ, Foisner R. Detergent-salt resistance of LAP2alpha in interphase nuclei and phosphorylation-dependent association with chromosomes early in nuclear assembly implies functions in nuclear structure dynamics. Embo J 1998; 17:4887-902. 25. Stuurman N, Heins S, Aebi U. Nuclear lamins: Their structure, assembly, and interactions. J Struct Biol 1998; 122:42-66. 26. Zastrow MS, Vlcek S, Wilson KL. Proteins that bind A-type lamins: Integrating isolated clues. J Cell Sci 2004; 117:979-87. 27. Agrelo R, Setien F, Espada J, Artiga MJ, Rodriguez M, Perez-Rosado A, Sanchez-Aguilera A, Fraga MF, Piris MA, Esteller M. Inactivation of the lamin A/C gene by CpG island promoter hypermethylation in hematologic malignancies, and its association with poor survival in nodal diffuse large B-cell lymphoma. J Clin Oncol 2005; 23:3940-7. 28. Liu B, Wang J, Chan KM, Tjia WM, Deng W, Guan X, Huang JD, Li KM, Chau PY, Chen DJ, Pei D, Pendas AM, Cadinanos J, Lopez-Otin C, Tse HF, Hutchison C, Chen J, Cao Y, Cheah KS, Tryggvason K, Zhou Z. Genomic instability in laminopathy-based premature aging. Nat Med 2005; 11:780-5. 29. Vlcek S, Just H, Dechat T, Foisner R. Functional diversity of LAP2alpha and LAP2beta in postmitotic chromosome association is caused by an alpha-specific nuclear targeting domain. EMBO J 1999; 18:6370-84. 30. Markiewicz E, Dechat T, Foisner R, Quinlan RA, Hutchison CJ. Lamin A/C binding protein LAP2alpha is required for nuclear anchorage of retinoblastoma protein. Mol Biol Cell 2002; 13:4401-13. 31. Dechat T, Gajewski A, Korbei B, Gerlich D, Daigle N, Haraguchi T, Furukawa K, Ellenberg J, Foisner R. LAP2{alpha} and BAF transiently localize to telomeres and specific regions on chromatin during nuclear assembly. J Cell Sci 2004; 117:6117-28. 32. Johnson BR, Nitta RT, Frock RL, Mounkes L, Barbie DA, Stewart CL, Harlow E, Kennedy BK. A-type lamins regulate retinoblastoma protein function by promoting subnuclear localization and preventing proteasomal degradation. Proc Natl Acad Sci USA 2004; 101:9677-82. 33. Frank SR, Schroeder M, Fernandez P, Taubert S, Amati B. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev 2001; 15:2069-82. 34. Muller H, Moroni MC, Vigo E, Petersen BO, Bartek J, Helin K. Induction of S-phase entry by E2F transcription factors depends on their nuclear localization. Mol Cell Biol 1997; 17:5508-20. 35. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res 2003; 13:103-7. 36. Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res 2004; 14:708-15.

Cell Cycle

2006; Vol. 5 Issue 12

Lap2 Regulation by E2F

37. Kenney AM, Rowitch DH. Sonic hedgehog promotes G1 cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol Cell Biol 2000; 20:9055-67. 38. Yoon JW, Kita Y, Frank DJ, Majewski RR, Konicek BA, Nobrega MA, Jacob H, Walterhouse D, Iannaccone P. Gene expression profiling leads to identification of GLI1-binding elements in target genes and a role for multiple downstream pathways in GLI1-induced cell transformation. J Biol Chem 2002; 277:5548-55. 39. Lindsey JC, Lusher ME, Anderton JA, Bailey S, Gilbertson RJ, Pearson AD, Ellison DW, Clifford SC. Identification of tumour-specific epigenetic events in medulloblastoma development by hypermethylation profiling. Carcinogenesis 2004; 25:661-8. 40. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N, Markowitz S, Willson JK, Kinzler KW, Vogelstein B. Deletion of p16 and p15 genes in brain tumors. Cancer Res 1994; 54:6353-8. 41. Frank AJ, Hernan R, Hollander A, Lindsey JC, Lusher ME, Fuller CE, Clifford SC, Gilbertson RJ. The TP53-ARF tumor suppressor pathway is frequently disrupted in large/cell anaplastic medulloblastoma. Brain Res Mol Brain Res 2004; 121:137-40. 42. Ebinger M, Senf L, Wachowski O, Scheurlen W. Promoter methylation pattern of caspase-8, P16INK4A, MGMT, TIMP-3, and E-cadherin in medulloblastoma. Pathol Oncol Res 2004; 10:17-21. 43. Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev 2000; 14:994-1004. 44. Lalani el N, Laniado ME, Abel PD. Molecular and cellular biology of prostate cancer. Cancer Metastasis Rev 1997; 16:29-66. 45. Hughes C, Murphy A, Martin C, Sheils O, O’Leary J. Molecular pathology of prostate cancer. J Clin Pathol 2005; 58:673-84. 46. Tricoli JV, Gumerlock PH, Yao JL, Chi SG, D’Souza SA, Nestok BR, deVere White RW. Alterations of the retinoblastoma gene in human prostate adenocarcinoma. Genes Chromosomes Cancer 1996; 15:108-14. 47. Mermelshtein A, Gerson A, Walfisch S, Delgado B, Shechter-Maor G, Delgado J, Fich A, Gheber L. Expression of D-type cyclins in colon cancer and in cell lines from colon carcinomas. Br J Cancer 2005; 93:338-45. 48. Bartkova J, Thullberg M, Slezak P, Jaramillo E, Rubio C, Thomassen LH, Bartek J. Aberrant expression of G1-phase cell cycle regulators in flat and exophytic adenomas of the human colon. Gastroenterology 2001; 120:1680-8. 49. Huang Y, Ishiko T, Nakada S, Utsugisawa T, Kato T, Yuan ZM. Role for E2F in DNA damage-induced entry of cells into S phase. Cancer Res 1997; 57:3640-3. 50. Blattner C, Sparks A, Lane D. Transcription factor E2F-1 is upregulated in response to DNA damage in a manner analogous to that of p53. Mol Cell Biol 1999; 19:3704-13. 51. Nili E, Cojocaru GS, Kalma Y, Ginsberg D, Copeland NG, Gilbert DJ, Jenkins NA, Berger R, Shaklai S, Amariglio N, Brok-Simoni F, Simon AJ, Rechavi G. Nuclear membrane protein LAP2beta mediates transcriptional repression alone and together with its binding partner GCL (germ-cell-less). J Cell Sci 2001; 114:3297-307. 52. de la Luna S, Allen KE, Mason SL, La Thangue NB. Integration of a growth-suppressing BTB/POZ domain protein with the DP component of the E2F transcription factor. Embo J 1999; 18:212-28. 53. Mancini MA, Shan B, Nickerson JA, Penman S, Lee WH. The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein. Proc Natl Acad Sci USA 1994; 91:418-22. 54. Shan B, Zhu X, Chen PL, Durfee T, Yang Y, Sharp D, Lee WH. Molecular cloning of cellular genes encoding retinoblastoma-associated proteins: Identification of a gene with properties of the transcription factor E2F. Mol Cell Biol 1992; 12:5620-31. 55. Ozaki T, Saijo M, Murakami K, Enomoto H, Taya Y, Sakiyama S. Complex formation between lamin A and the retinoblastoma gene product: Identification of the domain on lamin A required for its interaction. Oncogene 1994; 9:2649-53. 56. Kampa D, Cheng J, Kapranov P, Yamanaka M, Brubaker S, Cawley S, Drenkow J, Piccolboni A, Bekiranov S, Helt G, Tammana H, Gingeras TR. Novel RNAs identified from an in-depth analysis of the transcriptome of human chromosomes 21 and 22. Genome Res 2004; 14:331-42. 57. Kapranov P, Cawley SE, Drenkow J, Bekiranov S, Strausberg RL, Fodor SP, Gingeras TR. Large-scale transcriptional activity in chromosomes 21 and 22. Science 2002; 296:916-9. 58. Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick J, Hume DA, Lipovich L, Batalov S, Engstrom PG, Mizuno Y, Faghihi MA, Sandelin A, Chalk AM, Mottagui-Tabar S, Liang Z, Lenhard B, Wahlestedt C. Antisense transcription in the mammalian transcriptome. Science 2005; 309:1564-6. 59. Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y. Antisense transcripts with FANTOM2 clone set and their implications for gene regulation. Genome Res 2003; 13:1324-34. 60. Shendure J, Church GM. Computational discovery of sense-antisense transcription in the human and mouse genomes. Genome Biol 2002; 3, (RESEARCH0044). 61. Yelin R, Dahary D, Sorek R, Levanon EY, Goldstein O, Shoshan A, Diber A, Biton S, Tamir Y, Khosravi R, Nemzer S, Pinner E, Walach S, Bernstein J, Savitsky K, Rotman G. Widespread occurrence of antisense transcription in the human genome. Nat Biotechnol 2003; 21:379-86. 62. Sontheimer EJ, Carthew RW. Silence from within: Endogenous siRNAs and miRNAs. Cell 2005; 122:9-12.

www.landesbioscience.com

Cell Cycle

1341