Simple Sequence Repeats Linked with Slow ...

RESEARCH

Simple Sequence Repeats Linked with Slow Darkening Trait in Pinto Bean Discovered by Single Nucleotide Polymorphism Assay and Whole Genome Sequencing Erin Felicetti, Qijian Song, Gaofeng Jia, Perry Cregan, Kirstin E. Bett, and Phillip N. Miklas* ABSTRACT Seed coat darkening in pinto bean (Phaseolus vulgaris L.) primarily occurs during prolonged storage and can result in significant loss in value based on it being a consumer perceived product flaw. Several slow darkening (SD) pintos, conditioned by the presence of the recessive sd gene, exist but are poorly adapted. Breeding for improved SD pintos is complicated by the recessive inheritance and expression of the trait in maternal tissue. We sought to develop capacity for marker-assisted selection (MAS) for the SD trait. Three F2 populations (159 individuals) derived from crosses between SD parents, representing two different sources (1533-15 and SDIP-1) for the trait, and commercial regular darkening (RD) pintos were used to screen for single nucleotide polymorphisms (SNPs) linked with the sd locus. Separate DNA pools from SD and from RD F2 individuals genotyped for the sd locus were used to detect putative sd-linked SNPs using the bulked-segregant analysis strategy. Two of 1536 SNPs differentiated between the SD and RD DNA bulks for all three populations. The whole genome sequence scaffold possessing the two SNPs was canvassed for simple sequence repeats (SSRs). Three of 12 SSRs from the SNP region distinguished between the SD and RD lines. The three SSRs, Pvsd-1157, Pvsd-1158, and Pvsd0028, were observed to be tightly linked with the sd locus at 0.9, 0.4, and 3.1 cM, respectively, across the F2 populations. The SSRs assayed across a recombinant inbred line mapping population (CDC Pintium × 1533-15) placed the sd gene on bean linkage group 7 between framework SSR markers BM210 and PvBR35. A survey of SD and RD advanced lines and cultivars revealed the SSRs will have utility for MAS of the SD trait in pinto bean and perhaps in other dry bean market classes as well.

1600

E. Felicetti and P.N. Miklas, USDA-ARS, Vegetable and Forage Crops Research Unit, 24106 N. Bunn Rd., Prosser, WA 99350; Q. Song, G. Jia, and P. Cregan, USDA-ARS, Soybean Genomics and Improvement Lab., Bldg. 006, Room 100, BARC-West, 10300 Baltimore Ave., Beltsville, MD 20705; K.E. Bett, Dep. of Plant Sciences, Univ. of Saskatchewan, 51 Campus Dr., Saskatoon, SK S7N 5A8, Canada. Received 15 Dec. 2011. *Corresponding author ([email protected]). Abbreviations: BCMV, Bean common mosaic virus; CDC, Crop Development Centre; MAS, marker-assisted selection; PCR, polymerase chain reaction; RD, regular darkening; RIL, recombinant inbred line; SD, slow darkening; SNP, single nucleotide polymorphism; SSR, simple sequence repeat; TBE; Tris-borate-ethylenediaminetetraacetic acid; UV-C, ultraviolet C.

S

eed quality of pinto bean is assessed by visual factors such as size, color, and shape. Postharvest changes in seed coat color, characterized by a gradual darkening of the light cream background, can have a detrimental effect on pinto bean quality. This darkening is exacerbated by certain storage conditions, such as high relative humidity and high temperatures (Park and Maga, 1999) as well as exposure to ultraviolet and cool-white light (Hughes and Sandsted, 1975; Brackmann et al., 2002; Junk-Knievel et al., 2007). Rapid darkening of the seed can also result from delayed harvest due to adverse weather conditions ( Junk-Knievel et al., 2007). The price for darkened pinto beans is discounted because consumers presume them to be older and therefore more difficult to cook. Several pinto bean lines, 1533-15 from the Crop Development Centre (CDC), University of Saskatchewan, SDIP-1 from University of Idaho (Singh et al., 2006), and ‘Saltillo’ released in Mexico (Sanchez-Valdez et al., 2004), maintain a bright background color Published in Crop Sci. 52:1600–1608 (2012). doi: 10.2135/cropsci2011.12.0655 © Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

WWW.CROPS.ORG

CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

for longer periods during storage. These pintos are referred to as slow darkening (SD) whereas most other pinto lines and cultivars are referred to as regular darkening (RD). Generally, these three SD pintos have lower yield potential than most RD pinto bean cultivars grown in traditional bean growing regions of North America. For this reason it would be useful to transfer the SD trait into better adapted and higher yielding pinto germplasm. The RD trait has been linked to the presence of polyphenolic compounds in the seed coat (Marles et al., 2008). These compounds are converted to visible pigments during oxidation and dehydration in storage (Stafford, 1990) and are found in higher concentrations in beans that are RD versus SD (Beninger et al., 2005; Marles et al., 2008). The SD trait is controlled by a single gene sd with recessive inheritance. The lack of segregation for RD pintos in allelism tests conducted among the three SD sources (153315, SDIP-1, and Saltillo) revealed they possess the same sd gene (Junk-Knievel et al., 2008; Elsadr et al., 2011). Since the SD trait is expressed in the seed coat, that is, maternal tissue, determining the phenotype of an F2 plant from a segregating population requires phenotyping the selfed seeds at maturity (F2:3 generation seeds). Determining the genotype of an F2 plant requires phenotyping selfed seed from the F2:3 family. This maternal expression, combined with recessive inheritance, delays breeding progress for the SD trait. To facilitate breeding SD pinto beans we sought to generate markers useful for markerassisted selection (MAS) of the sd gene. Marker-assisted selection for sd would expedite breeding for the SD trait by enabling the genotyping of BCnF1 or F2 seedlings instead of waiting for subsequent generations. Markerassisted selection would also facilitate genotypic selection in F1 plants from multiparent crosses.

MATERIALS AND METHODS Plant Material Three F2 populations segregating for the SD trait were generated. Population I, consisting of 54 individuals, was derived from the cross Z0818-23 SD pinto × ’Stampede’ RD pinto. The Z081823 F4 breeding line possesses the sd gene from a four-way cross OT0643-44/OT0635-14//SDIP-1/OT0643-79 involving three advanced RD pinto breeding lines and the sd source SDIP-1. Population II, with 49 individuals, was obtained from the cross ‘Santa Fe’ RD pinto × PS08-108. The PS08-108 F3 SD breeding line was derived from the pedigree PT7-1/4/Z0720-54/3/ PT7-2//1533-15/PT7-2, in which all advanced breeding lines were RD pintos except 1533-15, the source of sd. Population III, with 56 F2 individuals, was generated from the cross Santa Fe × Z0818-25. The Z0818-25 F4 SD breeding line derives sd from SDIP-1 from the pedigree OT0643-79/CO 33309//SDIP-1/ PT0643-126 involving three other RD pinto breeding lines. The above crosses were conducted to transfer the SD trait into commercial pinto bean types with good agronomic traits (upright architecture, uniform harvest maturity, reduced lodging, etc.) CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

and high yield potential. Santa Fe (Kelly et al., 2010a) has large seed with good canning quality and is resistant to anthracnose [Colletotrichum lindemuthianum (SACC. & Magnus) Lams.-Scrib.], rust [Uromyces appendiculatus (Pers.:Pers.) Unger], and Bean common mosaic virus (BCMV). It is resistant to lodging and performs well under moderate white mold (Sclerotinia sclerotiorum Lib de Bary) pressure. The high yielding Stampede (Osorno et al., 2010) is also resistant to anthracnose, rust, and BCMV. It has upright architecture and resistance to lodging. BR-02 is a population of 105 F5–derived recombinant inbred lines (RILs) derived from the cross CDC Pintium × 1533-15. CDC Pintium is an older RD pinto cultivar developed in Saskatchewan while 1533-15 was commercialized in 2009 as CDC WM-1 (Canadian Food Inspection Agency Registration no. 6606 CDC WM-1). The population segregates in a 1 RD to 1 SD manner indicative of single gene control (Junk-Knievel et al., 2008).

Accelerated Seed Coat Darkening Test Three mature seeds harvested from each F2 plant from the three populations and the pinto checks ‘Othello’ (RD) and 1533-15 (SD) were exposed to ultraviolet C (UV-C) light for 72 h. The UV-C exposure represents an accelerated darkening test that simulates prolonged storage conditions and allows for easy separation of SD from RD seed phenotypes (Junk-Knievel et al., 2007). Approximately 50 seeds of each F2:3 progeny line were planted on 31 May 2010 at the Washington State University Research Station in Othello, WA, in individual 3-m rows spaced 0.56 m apart. Fertilization, irrigation, and general field maintenance were followed for optimum plant growth. At harvest maturity, about 100 d after planting, one seed from each F3 plant was collected and bulked across plants for each progeny row. Within 2 wk of harvest, approximately 20 seeds for each bulk from the three populations were exposed to UV-C light for 72 h. Bulks with all RD seed were presumed to come from F2 plants that were homozygous Sd//Sd. Those bulks with all SD seed came from homozygous sd//sd F2 plants, and those segregating for both RD and SD seed came from heterozygous Sd//sd F2 plants. Approximately 25 seeds of each BR-02 RIL grown in 1 by 1 m plots in the field in Saskatoon, SK, were exposed to UV-C light for 72 h to phenotype the darkening reaction and were classified as SD or RD ( Junk-Knievel et al., 2008).

DNA Extraction For each F2 plant from the three populations, total genomic DNA was isolated from the newly emerged first trifoliolate leaflet using the FastDNA SPIN Kit (MP Biomedicals, LLC) according to manufacturer’s instructions. The DNA for checks, advanced lines, and cultivars was obtained from similar tissue but was extracted from leaf samples bulked across three to four plants. The DNA was quantified with a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific). The DNA was extracted from the RILs and parents using a modified cetyltrimethylammonium bromide procedure (Doyle and Doyle, 1990) and quantified using a FLUOstar Omega microplate reader (BMG Labtech) using Quant-iT PicoGreen dsDNA (double-stranded DNA) reagent (Invitrogen) as a fluorescent reporter dye. For each population two bulk samples of DNA were generated. One RD bulk consisted of DNA pooled from six to eight F2 plants that were homozygous Sd//Sd for the RD genotype.

WWW.CROPS.ORG

1601

The SD bulks consisted of six to eight F2 plants that were homozygous sd//sd for the SD genotype. These DNA pools were used for bulked-segregant analysis (Michelmore et al., 1991) for identification of markers potentially linked with the sd gene.

Single Nucleotide Polymorphism Assay One RD and one SD bulk from each of the three F2 populations and RD parental lines Santa Fe and Stampede as well as the SD source lines 1533-15 and SDIP-1 were analyzed with the 1536 single nucleotide polymorphisms (SNPs) of the PvOPA-1 (Phaseolus vulgaris oligo pool all) Illumina GoldenGate assay (Illumina Inc.) as described by Hyten et al. (2010). The Illumina BeadStation 500G was used to read the 96 Sentrix Array Matrix version 7a containing the products produced from the GoldenGate assay. The resulting data were clustered for purposes of allele calling using Illumina GenomeStudio V2010.3 (Illumina, 2010) and allele calls were visually inspected and errors in allele calling due to improper cluster identification were corrected. The resulting allele call data for the bulks and RD and SD lines were inspected to identify marker loci for which the RD and SD lines were homozygous for alternative alleles.

Generating and Testing Simple Sequence Repeat Markers When the bulked segregant analysis appeared to identify a SNP associated with the SD trait, the SNP-containing DNA sequence that was used in the development of the GoldenGate SNP detection assay was aligned to the 20x assembly of the DNA sequence of common bean using standalone Megablast (Morgulis et al., 2008) at a stringency of W = 50 and p = 95. Megablast was downloaded at http://www.ncbi.nlm.nih.gov/Ftp/. The sequence scaffold to which a SNP-containing sequence aligned was then interrogated for the presence of simple sequence repeats (SSRs) using the Perl script “MISA” (Thiel et al., 2003) as described by Song et al. (2010). Polymerase chain reaction (PCR) primers were designed to the flanking sequence of SSRs using Primer3 (Rozen and Skaletsky, 2000). The PCR product lengths ranged from 120 to 300 bp with annealing temperatures of 58°C. The SSR-containing loci were amplified from genomic DNA of the RD parents Santa Fe and Stampede and the SD source lines 1533-15 and SDIP-1. Polymerase chain reaction mixes contained 80 ng of genomic DNA, 0.20 μM of forward and reverse primers, 200 μM of each nucleotide, and 1x PCR buffer containing 50 mM KCl, 10 mM Tris HCl pH 9.0, 0.1% Triton X 100, and Taq DNA polymerase in a total volume of 10 μL. The thermalcycling was performed in a TECHNE TC-Plus (Bibby Scientific Limited) with 40 cycles of denaturation at 94°C for 60 s, annealing at 58°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 5 min with a hold at 15°C. Polymerase chain reaction products were analyzed on a 3.3% agarose gel (Agarose SFR, Amresco) with 1x Tris-borate-ethylenediaminetetraacetic acid (TBE) buffer and stained with 1 μg mL−1 ethidium bromide. 1602

Those SSRs that distinguished the two RD parents from the two SD source lines were further used to analyze the progeny of the RD × SD crosses. The potential sd-linked SSRs were amplified across individuals from the three F2 populations (I, II, and III), which when combined consisted of 159 F2 individuals. For amplification of SSRs, the PCR reaction consisted of 80 ng genomic DNA, 1 μM each forward and reverse primer (Operon), 0.2 mM deoxyribonucleotide triphosphate (Invitrogen), 3 mM MgCl2 (supplied with GoTaq, Promega), 1x reaction buffer (supplied with GoTaq), 0.08 U GoTaq Flexi DNA Polymerase, and nuclease-free water to a final volume of 12.5 μL. The thermalcycling was performed in a MJ Research PTC-0200 DNA Engine (MJ Research, Inc.) with 40 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 5 min with a hold at 15°C. The PCR products were checked on a 3.3% agarose gel with 1x TBE buffer and stained with 1 μg mL−1 ethidium bromide. Chi-square tests were used to determine goodness of fit for the observed to expected phenotypic (3:1 RD:SD) and genotypic (1:2:1 Sd//Sd:Sd//sd:sd//sd) ratios for a single major gene segregating in an F2 population. Linkage between the sd locus and SSRs in each F2 population was determined using JoinMap 4.0 (Van Ooijen, 2006) software. Default settings for the “regression mapping” method were used to define linkage order and distances (cM). Linkage distances (cM) were based on Kosambi map units. The linkage groups from the three populations were then integrated into one linkage group using the “join” command. Advanced SD and RD lines were assayed for the most tightly sd-linked SSRs to examine potential of the markers for MAS. From ARS Prosser, seven RD pinto, 42 SD pinto, four RD pink, and two RD cranberry advanced lines and cultivars were assayed for the SSRs. From the University of Saskatchewan breeding program, three RD pinto, four SD pinto, and four SD carioca advanced lines were surveyed. The DNA was extracted from leaf samples bulked across three to four plants as described above.

Mapping the sd Gene The sd-linked SSRs identified using bulked segregant analysis and validated to co-segregate with the SD traits in the F2 populations were assayed in the BR-02 RIL population. Forward primers were M13-tailed. Polymerase chain reactions were performed according to Schuelke (2000) with HEX, FAM, and NED and the resulting PCR fragments were separated using capillary electrophoresis on a 3130x Genetic Analyzer (Applied Biosystems). Product sizes were determined using GeneScan 500 ROX Size Standard (Applied Biosystems). The sd-linked SSRs were combined with framework SSR markers to develop a partial linkage map in JoinMap 4.0 (Van Ooijen, 2006) as described above. Graphical side-by-side presentation of the integrated F2 linkage group with the partial linkage group from the RIL population was generated in JoinMap 4.0 using the “join” command.

RESULTS AND DISCUSSION The SD and RD pinto bean phenotypes were readily distinguished using the UV-C test (Fig. 1). The three F2 populations and their F3 families were successfully phenotyped and genotyped for the SD trait conditioned by the sd gene (Table

WWW.CROPS.ORG

CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

Figure 1. Changes in seed coat color from light to dark is more pronounced for regular darkening (RD) (right side) than slow darkening (SD) (left side) pinto beans after 72 h exposure to ultraviolet C (UV-C) light. Table 1. Phenotypic and genotypic segregation for the slow darkening (SD) seed trait, as conditioned by the sd gene, in three F2 populations derived from crosses between SD pinto lines × regular darkening (RD) pinto cultivars. F2 phenotype

Phenotype for heterozygous F2:3 lines

F2 genotype

RD RD (Sd//Sd (Sd//Sd and SD χ2 RD Segregating SD χ2 and SD χ2 SD F2 (sd//sd) (probability) Sd//sd) (sd//sd) (probability) Population source individuals Sd//sd) (sd//sd) (probability) (Sd//Sd) (Sd//sd) I

SDIP-1

54

36

18

2.00 (0.15)

13

23

18

1.77 (0.41)

329

131

2.97 (0.08)

II

1533-15

49

40

9

1.10 (0.29)

9

31

9

3.44 (0.18)

438

182

6.27 (0.04)

III

SDIP-1

56

37

19

2.37 (0.12)

18

19

19

5.17 (0.07)

295

115

2.03 (0.15)

1). The F2 phenotypic segregation fit the expected 3 RD (Sd//Sd, Sd//sd) to 1 SD (sd//sd) ratio for each population. The confirmed segregation of a single gene trait with recessive inheritance verified that we could use these populations to tag the target gene sd with tightly linked markers. The three F2 populations fit expected 1 (Sd//Sd) to 2 (Sd//sd) to 1 (sd//sd) genotypic segregation ratios for each F2:3 family (Table 1). The segregation for RD to SD phenotype among those 23, 31, and 19 respective F2:3 individuals that were heterozygous (Sd//sd) from each population fit expected 3 RD to 1 SD phenotypic segregation ratios, except for Population II, which was slightly skewed toward more SD seeds. With genotypes in hand we were then able to develop contrasting DNA bulks from “true-breeding” F2 plants homozygous for each allele, Sd//Sd being RD and sd//sd being SD, for use in bulked segregant analysis to identify sd-linked markers. Two SNPs, BARC-PV-0000692 and BARC-PV-0004888, from the first generation SNP chip for common bean that possessed 1536 SNPs (Hyten et al., 2010) produced allele calls that distinguished the SD source CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

lines and bulks from the RD parents and bulks. In the case of BARC-PV-0000692, the two SD sources (153315 and SDIP-1) and each of the three SD bulks carried one allele while the two RD parents (Stampede and Santa Fe) and the three RD bulks carried the alternative (Fig. 2). The results were similar for the BARC-PV-0004888 SNP. The two SD sources and each of the three SD bulks carried one allele while the RD parents and two of the three RD bulks carried the alternative (Fig. 3). Apparently, the heterozygous RD bulk from one population possessed DNA from one or more F2 plants that were heterozygous for the BARC-PV-0004888 SNP. The two SNP-containing DNA sequences were used in a Megablast analysis (Morgulis et al., 2008) of the developing Phaseolus vulgaris whole genome sequence. The analysis determined that the SNP-containing sequences were located on Scaffold00022 of the 20x build of the Phaseolus vulgaris DNA sequence. The sequence in the vicinity of the SNPs was mined for SSRs leading to the design of PCR primers for 17 SSRs. These primer sets were used to amplify genomic DNA of the cultivar Stampede.

WWW.CROPS.ORG

1603

Figure 2. Single nucleotide polymorphism marker BARC-PV-0000692 analyzed on two slow darkening (SD) sources (1533-15 and SDIP1), three SD bulks, two regular darkening (RD) parents (Stampede and Santa Fe), and three RD bulks.

Figure 3. Single nucleotide polymorphism marker BARC-PV-0004888 analyzed on two slow darkening (SD) sources (1533-15 and SDIP1), three SD bulks, two regular darkening (RD) parents (Stampede and Santa Fe), and three RD bulks.

Optimization of the PCR reaction conditions resulted in the production of single amplicons for 12 of the primer sets. These 12 primer sets were then used to amplify genomic 1604

DNA of the RD parents Stampede and Santa Fe and the SD sources 1533-15 and SDIP-1. Analysis of the resulting amplicons via 3.3% agarose gel electrophoresis indicated

WWW.CROPS.ORG

CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

Table 2. Three sd-linked simple sequence repeats (SSRs) discovered by single nucleotide polymorphism assay and whole genome sequence. SSR name

Primer sequence (5′–3′)

Expected size upper; Tm† lower band (bp) (°C)

Linkage distance (cM) from sd locus Population I Population II Population III

Pvsd-1157

forward AATGGGGAAGATGGTTGGTT reverse GTGAGGGTTGAAAATTGCGT

170-sd; 160-Sd

57

0.9

0.0

1.9

Pvsd-1158

forward GCAATTGACAAAAAGCTTCG reverse TTGTCATGCGGTTTT

140- and 130-Sd; 120sd

57

0.0

0.0

2.1

Pvsd-0028

forward TGAAACGCCTAGATAAAATTTAAAAC reverse TGGTACAATTTTATGAATGATGCC

160-Sd; 140-sd

57

1.9

1.1

5.5

†

Tm, DNA melting temperature.

Figure 4. Amplicons of regular darkening (RD) parental lines Stampede and Santa Fe and slow darkening (SD) lines 1533-15 and SDIP-1 of three simple sequence repeats generated from the sd-linked single nucleotide polymorphism genomic region on Scaffold00022 that distinguished the RD and SD lines.

clear allele size differences between the RD and SD lines for SSR markers Pvsd-1157, Pvsd-1158, and Pvsd-0028 (Table 2; Fig. 4). The Sd-linked allele associated with the RD genotypes Stampede and Santa Fe carried different alleles at the Pvsd-1158 locus both of which were higher in molecular weight than the allele carried by the SD lines. The three SSRs were all tightly linked with the sd locus across the three F2 populations as well as in the BR-02 RIL population (Fig. 5). Pvsd-1158 had the tightest linkage with sd in both the F2 (0.4 cM) and RIL (0.0 cM) CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

populations. Pvsd-0028, on the same side as Pvsd-1158 in the F2 populations, was less tightly linked with sd in all populations (3.1 to 3.5 cM). Pvsd-1157 was located on the opposite side of the locus, thus potentially providing a useful flanking marker. The sd gene and linked SSR markers map to linkage group Pv07 in the RIL population based on the flanking framework markers BM210 (Blair et al., 2003) and PvBR35 (Grisi et al., 2007). In preliminary work (K Bett, unpublished data, 2011), extensive screening of parents and contrasting bulks with

WWW.CROPS.ORG

1605

250 published SSR markers (Blair et al., 2003; Gaitán-Solís et al., 2002; Grisi et al., 2007) only led to two SSRs (BM210 and PvBR35) loosely linked with sd in the BR-02 RIL population. Similarly, screening of the parents and contrasting bulks for the three F2 populations with 170 sequence-related amplified polymorphism primer combinations and numerous amplified fragment-length polymorphism runs failed to yield any markers tightly linked with the sd locus (E. Felicetti and P. Miklas, unpublished data, 2011). These marker assays represented months of work whereas the SNP analysis in this study was performed in just a few days. As SNP technology for dry bean evolves to provide greater genome coverage with higher levels of polymorphism among related materials (e.g., within market classes) it will become even more useful for targeting specific traits in dry bean with tightly linked markers as shown in this study. The close proximity of the SSRs with the sd locus in multiple and diverse pinto populations (three F2 and one RIL) indicated potential utility of the SSRs for MAS. The SSR markers Pvsd-1157, Pvsd-1158, or both were surveyed across a broader range of germplasm to further examine potential utility for MAS (Table 3). The lines and cultivars surveyed were primarily from the pinto bean market class but also included other dry bean market classes (carioca, cranberry, and pink) that suffer from “postharvest darkening.” All the RD lines and cultivars tested across pinto and pink market classes possessed the SSR band associated with postharvest darkening (Sd allele). The cranberry market class was an exception. For cranberry bean, two RD cultivars were tested: ‘Krimson’ (Miklas and Riley, 2012) and ‘Bellagio’ (Kelly et al., 2010b). Krimson possessed the sd-linked allele for both SSRs tested, indicating these markers may be useful for MAS in some but not all cranberry beans. For carioca, no RD lines were tested for the marker. For the 42 advanced SD pinto lines from ARS Prosser, four lines were observed to carry both SSR alleles suggesting recombination had occurred between the gene and markers. These four recombination events involved

Figure 5. Partial linkage group (Pv07) for the sd-linked simple sequence repeats (SSRs) and sd locus in a recombinant inbred line (RIL) population (pop) (CDC Pintium × 1533-15) and as integrated across three F2 populations (described in text). The RIL population also consists of framework SSR markers from Pv07 linkage group for common bean.

both Pvsd-1157 and Pvsd-1158 suggesting the markers may not flank the sd locus as estimated by the mapping results (Fig. 5). Conversely, one recombinant SD pinto line carried both SSR alleles for only the Pvsd-1158 marker, which supports the mapping results depicting Pvsd-1157 and Pvsd1158 as markers flanking the sd locus. Three of the four recombinant SD pintos lines were sister lines, indicating that a recombination event between sd and the markers took place in a common ancestor from an earlier generation for those materials. The seed from these recombinant

Table 3. Survey of two simple sequence repeat markers tightly linked with sd gene across slow darkening (SD) and regular darkening (RD) germplasm lines and cultivars representing pinto and other common bean market classes prone to postharvest darkening.

Trait

Program

Lines

160 bp Sd//Sd

Pinto

SD

Pinto

RD

Pink Cranberry Carioca

RD RD SD

ARS U. Sask.† ARS U. Sask. ARS ARS U. Sask.

no. 42 4‡ 7 3 4 2 4

no. 0 0 7 3 4 1 0

Market class

†

Pvsd-1157 170 bp sd//sd

both Sd//sd

120 bp sd//sd

Pvsd-1158 130–140 bp Sd//Sd

both Sd//sd

no. 38 3 0 0 0 1 4

no. 4 0 0 0 0 0 0

no. 37

no. 0

no. 5

0 0 0 1

7 3 4 1

0 0 0 0

U. Sask., University of Saskatchewan.

‡

The fourth pinto had a third allele for Pvsd-1157 that was intermediate in size between the 160 and 170 bp alleles.

1606

WWW.CROPS.ORG

CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

lines was phenotyped again for SD trait, sampled again for DNA, and assayed with the SSR markers. Recombination was confirmed. The occurrence of recombination events between the SSR markers and target locus (sd) reinforces the need for conducting several crosses and maintaining separate lineages in a MAS program. One recombinant SD pinto from the Saskatchewan breeding program was homozygous for a Pvsd-1157 marker allele of intermediate size (165 bp) to the original alleles (160 and 170 bp) amplified in the pinto F2 and RIL populations. Interestingly, this allele was amplified in a set of eight SD yellow beans from a separate ongoing study. The SD pinto with this intermediate third allele for Pvsd1157 was derived from a cross between a yellow breeding line × 1533-15 pinto. The source and genetics of the SD trait in yellow beans is currently under investigation, including possible association with SSR marker Pvsd1157. The four advanced carioca lines tested derive their SD phenotype from 1533-15 pinto bean. Compared to the vast number of materials that make up these market classes, our survey was relatively small. Nonetheless, the results suggest the sd-linked SSRs can be used to transfer the sd gene conditioning SD into pinto, pink, carioca, and cranberry market classes. The effect of sd in the cranberry and pink market classes is uncertain; however, the gene does appear to condition SD in the carioca market class based on the preliminary work conducted at the University of Saskatchewan. For now, we expect the markers closely linked to the sd gene to facilitate introgression of this important quality trait into better adapted pinto bean cultivars for deployment across expanded acreages. Acknowledgments The preliminary assembly of the Phaseolus vulgaris whole genome sequence was made available by Dr. Jeremy Schmutz (HudsonAlpha Institute of Biotechnology, Huntsville, AL). Access to this resource is greatly appreciated. This research was partially supported by the BeanCAP funded by the USDA National Institute of Food and Agriculture, project number 2009-01929.

References Beninger, C.W., L. Gu, R.L. Prior, D.C. Junk, A. Vandenberg, and K.E. Bett. 2005. Changes in polyphenols of the seed coat during the after-darkening process in pinto beans (Phaseolus vulgaris L.). J. Agric. Food Chem. 53:7777–7782. doi:10.1021/ jf050051l Blair, M.W., F. Pedraza, H.F. Buendia, E. Gaitán-Solís, S.E. Beebe, P. Gepts, and J. Tohme. 2003. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). Theor. Appl. Genet. 107:1362–1374. doi:10.1007/s00122-003-1398-6 Brackmann, A., D.A. Neuwald, N.D. Ribeiro, and S.T. de Freitas. 2002. Conservation of three bean genotypes (Phaseolus vulgaris L.) of the carioca group in cold storage and controlled CROP SCIENCE, VOL. 52, JULY– AUGUST 2012

atmosphere. Cienc. Rural. 32:911–915. doi:10.1590/S010384782002000600001 Doyle, J.J., and J.L. Doyle. 1990. Isolation of plant DNA from fresh tissue. Focus 12:13–15. Elsadr, H.T., L.C. Wright, K.P. Pauls, and K.E. Bett. 2011. Characterization of seed coat post harvest darkening in common bean (Phaseolus vulgaris). Theor. Appl. Genet. 123:1467–1472 doi:10.1007/s00122-011-1683-8 Gaitán-Solís, M.C. Duque, K.J. Edwards, and J. Tohme. 2002. Microsatellite repeats in common bean (Phaseolus vulgaris): Isolation, characterization, and cross-species amplification in Phaseolus ssp. Crop Sci. 42:2128–2136. doi:10.2135/ cropsci2002.2128 Grisi, M.C.M., M.W. Blair, P. Gepts, C. Brondani, P.A.A. Pereira, and R.P.V. Brondani. 2007. Genetic mapping of a new set of microsatellite markers in a reference common bean (Phaseolus vulgaris) population BAT93 × Jalo EEP558 L.). Genet. Mol. Res. 6:691–706. Hughes, P.A., and R.F. Sandsted. 1975. Effect of temperature, relative humidity, and light on the color of ‘Califormia Light Red Kidney’ bean seed during storage. HortScience 10:421–423. Hyten, D.L., Q. Song, E.W. Fickus, C.V. Quigley, J.-S. Lim, I.-Y. Choi, E.-Y. Hwang, M. Pastor-Corrales, and P.B. Cregan. 2010. High through-put SNP discovery and assay development in common bean. BMC Genomics 11:475–483. doi:10.1186/1471-2164-11-475 Illumina. 2010. GenomeStudio genotyping module v.2010.3. Illumina, Inc., San Diego, CA. http://www.illumina.com/ software/genomestudio_software.ilmn (accessed 10 July 2011). Junk-Knievel, D.C., A. Vanderberg, and K.E. Bett. 2007. An accelerated post-harvest seed-coat darkening protocol for pinto beans grown across different environments. Crop Sci. 47:694–702. doi:10.2135/cropsci2006.05.0325 Junk-Knievel, D.C., A. Vanderberg, and K.E. Bett. 2008. Slow darkening in pinto bean (Phaseolus vulgaris L.) seed coats is controlled by a single major gene. Crop Sci. 48:189–193. doi:10.2135/cropsci2007.04.0227 Kelly, J.D., G.V. Varner, and B. Long. 2010a. Registration of ‘Santa Fe’ pinto bean. J. Plant Reg. 4:12–16. doi:10.3198/ jpr2008.12.0732crc Kelly, J.D., G.V. Varner, and E.M. Wright. 2010b. Registration of ‘Bellagio’ cranberry bean. J. Plant Reg. 4:171–174. doi:10.3198/jpr2010.02.0069crc Marles, M.A.S., A. Vandenberg, and K.E. Bett. 2008. Polyphenol oxidase activity and differential accumulation of polyphenolics in seed coats of pinto bean (Phaseolus vulgaris L.) characterize post-harvest colour changes. J. Agric. Food Chem. 56:7049– 7056. doi:10.1021/jf8004367 Michelmore, R.W., I. Paran, and R.V. Kesseli. 1991. Identification of markers linked to disease resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genome regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88:9828–9832. doi:10.1073/pnas.88.21.9828 Miklas, P.N., and R. Riley. 2012. Registration of ‘Krimson’ cranberry bean. J. Plant Reg. 6:11–14. doi:10.3198/ jpr2011.05.0251crc Morgulis, A., G. Coulouris, Y. Raytselis, T.L. Madden, R. Agarwala, and A.A. Schaffer. 2008. Database indexing for production MegaBLAST searches. Bioinformatics 24:1757– 1764. doi:10.1093/bioinformatics/btn322 Osorno, J.M., K.F. Grafton, G.A. Rojas-Cifuentes, R. Gelin, and A.J. VanderWal. 2010. Registration of ‘Lariat’ and

WWW.CROPS.ORG

1607

‘Stampede’ pinto beans. J. Plant Reg. 4:5–11. doi:10.3198/ jpr2009.03.0143crc Park, D., and J.A. Maga. 1999. Dry bean (Phaseolus vulgaris L.) color stability as influenced by time and moisture content. J. Food Process. Preserv. 23:515–522. doi:10.1111/j.1745-4549.1999. tb00401.x Rozen, S.H., and H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132:365–368. Sanchez-Valdez, I., J.A. Acosta-Gallegos, F.J. Ibarra-Perez, R. Rosales-Serna, and S.P. Singh. 2004. Registration of ‘Pinto Saltillo’ common bean. Crop Sci. 44:1865–1866. doi:10.2135/ cropsci2004.1865a Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 18:233–234. doi:10.1038/72708 Singh, S.P., H. Terán, M. Lema, M.F. Dennis, and R. Hayes. 2006. Registration of slow darkening pinto bean germplasm

1608

line SDIP-1. Crop Sci. 46:2726–2727. doi:10.2135/ cropsci2006.04.0247 Song, Q.J., G. Jia, Y. Zhu, D. Grant, R.T. Nelson, E.-Y. Hwang, D.L. Hyten, and P.B. Cregan. 2010. Abundance of SSR motifs and development of candidate polymorphic SSR markers (BARCSOYSSR_1.0) in soybean. Crop Sci. 50:1950–1960. doi:10.2135/cropsci2009.10.0607 Stafford, H.A. 1990. Flavonoid metabolism. CRC Press, Boca Raton, FL. Thiel, T., W. Michalek, R.K. Varshney, and A. Graner. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 106:411–422. Van Ooijen, J.W. 2006. JoinMap 4, Software for the calculation of genetic linkage maps in experimental populations. Kyazma B.V., Wageningen, the Netherlands.

WWW.CROPS.ORG

CROP SCIENCE, VOL. 52, JULY– AUGUST 2012