reduction was assessed by qRT/PCR for RAF1 (filled bars), PTEN (striped bars), or SMN2 (hatched bars) as detailed in Materials and Methods. B) In order to ...
U1 ADAPTORS RESULT IN REDUCTION OF MULTIPLE PRE-MRNA SPECIES PRINCIPALLY BY SEQUESTERING U1SNRNP
Supplementary Figures Figure S1. U1 adaptor activity in HUVEC and 293T cells. A) Primary human umbilical vein endothelial cells (HUVEC) were transfected with U1A-RAF1 or with ASO 194166 at 25 nM using 3 ul/ml Lipofectamine 2000 in OptiMEM media for 4 hours. After incubating over night, cells were harvested and total RNA purified. Target and off-target mRNA reduction was assessed by qRT/PCR for RAF1 (filled bars), PTEN (striped bars), or SMN2 (hatched bars) as detailed in Materials and Methods. B) In order to evaluate the general effects of U1 snRNA reduction on gene expression, 293T cells were treated with anti U1 ASO 469508 or with U1A-RAF1 or U1A-SMN2 at concentrations ranging from 12.5 to 200 nM. After 16 hours levels of targeted and non-target mRNA were evaluated by qRT/PCR. Treatment with the RAF1 U1A resulted in reduction of target mRNA with an IC50 ~ 50 nM (top panel). SMN2 (middle panel) and PTEN (lower panel) were also effectively reduced by this U1A, albeit with a slightly higher IC50. The U1A targeted to SMN2 was also non-specific, reducing SMN2 and non-targeted mRNA with IC50’s between 25 and 100 nM. Levels of each mRNA were also decreased as a result of U1 snRNA reduction with ISIS 469508. 469508 had a similar effect on PTEN expression, with an IC50 of ~50 nM. Targeting U1 snRNA also reduced expression of RAF1 and SMN2 at higher concentrations. Figure S2. Evaluation off off-target activity using PCR Arrays. HeLa cells were plated in 10 cm dishes at 50% confluence. The following day cells were transfected with ASO/U1 adaptor at 50 nM using Lipofectamine 2000 reagent as detailed above. Cells were incubated overnight, then RNA purified using RNeasy mini columns (Qiagen). An on-column DNAseI digestion step was included according to the manufacturer’s protocol. RAF1 reduction was confirmed by qRT/PCR.
For 96-well human apoptosis PCR Arrays (PAHS-012), cDNA was generated in 20 ul reactions from 500 ng of total RNA using an RT2 First Strand kit following the manufacturer’s protocol (SABiosciences). The finished first strand cDNA was diluted with 91 ul H2O, then amplified using RT2 qPCR Master Mix following the manufacturer’s protocol (SABiosciences). Two PCR arrays were run for each treatment group. Data was analyzed using the ∆∆Ct method comparing ASO/U1 adaptor treated to mock treated control. (A) In cells treated with the U1A 48/84 genes were found to be reduced by more than 4 fold (panel 1). In cells treated with the anti-U1 ASO 32/84 genes were reduced by more than 4 fold (panel 2). (B) Of these 32 genes, 29 were found to be in common with those down-regulated by the U1 adaptor In contrast, treatment with the RNaseH-dependent ASO 194166 resulted in >4 fold down-regulation of only 2/84 genes. Figure S3. Effects of snRNA reduction on SMN2 mini-gene pre-mRNA processing. SMN2/TO-293 cells were transfected with anti-U1 (ASO 469508), -U4 (ASO 479333), or -U6 (ASO 479338) ASOs at a concentration of 50 nM. The following day SMN/TO expression was induced by the addition of at 0.25 ug/ml tetracycline to the growth media. After 4 hours, total RNA was purified and expression of the SMN/TO mini-gene RNA analyzed by qRT/PCR using the pre-mRNA, skipped, and full-length specific primer/probe sets described in Figure 6B and Methods. mRNA levels were normalized to the total amount of RNA present in each reaction as determined by Ribogreen then plotted as % control relative to mock treated cells. A) Reduction each snRNA lead to an increase in the amount of pre-mRNA relative to the UTC. Expression of both skipped and full-length forms of the spliced mRNA were significantly reduced to approximately the same levels by anti-U4 or anti-U6 ASOs. In contrast treatment with the anti-U1 ASO, lead to an increase in the levels of skipped and decrease in the levels of full-length SMN/TO mRNA. B) Ratio of skipped to full-length spliced SMN/TO mRNA is shown for control and snRNA reduced cells. (ISIS 479333, GGTATTGGGAAAAGTTTTCA; ISIS 479338 CCATGCTAATCTTCTCTGTA)
Figure S4. U1 adaptor treatment alters the ratio of endogenous SMN2 skipped to full-length transcript. A) 50 ng of total RNA prepared as in Figure 6D from U1 adaptor or ASO treated cells was subject to qRT/PCR using primer/probe sets designed to specifically amplify exon7-included or exon 7-excluded endogenous SMN2 mRNA . The sequence for the Exon 7-excluded primer/probe set is TGGACCACCAATAATTCCCC for the forward primer, ATGCCAGCATTTCCATATAATAGCC for the reverse primer and TCCAGATTCTCTTGATGATG for the probe. The sequence for the Exon 7included primer/probe set is GCTGATGCTTTGGGAAGTATGTTA for the forward primer, CACCTTCCTTCTTTTTGATTTTGTC for the reverse primer and TACATGAGTGGCTATCATACT for the probe. Probe Chemistry: 5'FAM, 3'MGB. B) Percent control RAF1 mRNA evaluated by qRT/PCR for samples above. Figure S5. Analysis and confirmation of Affymetrix exon array hits. HeLa cells were transfected with U1A-RAF, anti-U1 ASO 469508, or RAF1 ASO 194166 at 50 nM. A) Total RNA was purified the following day, and mRNA reduction evaluated by qRT/PCR. Percent mocktreated control (UTC) expression for RAF1, PTEN, PIK3CB, and PCSK9 mRNAs was determined by qRT/PCR. B) Intron probes. Affymetrix exon arrays were performed using total RNA. Intron probes were mapped back to gene using X:Map, then ANOVA used to detect probes that show significant changes among the groups. P-values were corrected for multiple testing and probes having adjusted p-values < 0.01 were selected. C) Exon probes. D) Confirmation of Affymetrix identified off-target activity. Cells in 10 cm dishes were transfected at 50 nM with U1A-RAF1. Nuclear and cytoplasmic RNA fractions were purified the following day using a PARIS kit according to the manufacturer’s protocol (Ambion). Integrity of the nuclear fraction was confirmed by assaying for MALAT RNA by qRT/PCR (data not shown). Primer probe sets from genes identified as regulated by U1A treatment were used to amplify 20
ng of total RNA/reaction. Change in expression relative to untreated control was computed by the ΔΔCt based fold-change method.
A
Figure S1
B RAF1
SMN2
PTEN
Figure S1
A
B U1A-RAF1
469508 (U1 ASO)
194166 (RAF1 ASO)
Figure S2
A
B
Figure S3
A
B
Figure S4
A
Figure S5
B
UTC
194166
U1A-RAF 469508
C
Figure S5
UTC
194166
U1A-RAF 469508
D
Figure S5
