(ENaC) and Interacts with

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 280, NO. 49, pp. 40885–40891, December 9, 2005 © 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

Phosphatidylinositol 3,4,5-Trisphosphate Mediates Aldosterone Stimulation of Epithelial Sodium Channel (ENaC) and Interacts with ␥-ENaC* Received for publication, September 1, 2005, and in revised form, October 4, 2005 Published, JBC Papers in Press, October 4, 2005, DOI 10.1074/jbc.M509646200

My N. Helms‡, Lian Liu‡, You-You Liang§, Otor Al-Khalili‡, Alain Vandewalle¶, Sunil Saxena储, Douglas C. Eaton‡, and He-Ping Ma§1 From the From ‡Department of Physiology, Emory University School of Medicine, Atlanta, Georgia 30322, the §Department of Medicine, Division of Nephrology, University of Alabama at Birmingham, Birmingham, Alabama 35294, ¶INSERM U478, Faculte de Medecine Xavier Bichat, BP 416, 75870, Paris Cedex 18, France, and the 储Department of Chemistry and Chemical Biology, Stevens Institute of Technology, Hoboken, New Jersey 07030

ENaC2 is a member of the ENaC/Deg superfamily of ion channels responsible for sodium transport across the apical membrane of a variety of epithelia including the colon, lung, and kidney (reviewed in Ref. 1). Since 1994, when ENaC was initially cloned from rat colon (2), the biophysical properties and molecular structure of ENaC have been extensively studied. Several lines of evidence suggest that ENaC is composed of three subunits, ␣, ␤, and ␥, and that all three subunits are required to form a functional ␣␤␥-ENaC channel complex (2–9).

* This work was supported by Department of Health and Human Services, National Institutes of Health Grant 1R01-DK067110 (to H.-P. M.), by National Institutes of Health Grant 1R01-DK57717 (to S. S.), and by National Institutes of Health Grant 1R37DK37963 (to D. C. E.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom correspondence should be addressed: Dept. of Medicine, Division of Nephrology, University of Alabama at Birmingham, 1530 Third Ave. S., Sparks Center 865, AL 35294. Tel.: 205-934-5783; Fax: 205-934-1147; E-mail: [email protected]. 2 The abbreviations used are: ENaC, epithelial sodium channel; PIP3, phosphatidylinositol 3,4,5-trisphosphate; PIP2, phosphatidylinositol 4,5-bisphosphate; PI3K, phosphoinositide 3-OH kinase; SGK1, serum and glucocorticoid-inducible kinase; mpkCCDc14, mouse principal kidney cortical collecting duct clone 14; MDCK, Madin-Darby canine kidney; CHO, Chinese hamster ovary; YFP, yellow fluorescent protein; GFP, green fluorescent protein; CFP, cyan fluorescent protein; PH, pleckstrin homology; Dyn, dynamin; TBS, Tris-buffered saline; BSA, bovine serum albumin.

DECEMBER 9, 2005 • VOLUME 280 • NUMBER 49

Studying the mechanisms that regulate ENaC function is important because abnormal channel activity leads to several severe diseases. Constitutive activation of any component of ENaC subunits can cause Liddle’s syndrome, an autosomal dominant inherited disease that causes excessive sodium retention and hypertension. Conversely, loss of function mutations in ␣-, ␤-, or ␥-ENaC causes pseudohypoaldosteronism type I, a hypotensive condition characterized by an inability to retain salt. These syndromes highlight the importance of normal ENaC activity in the kidney to maintain fluid and sodium homeostasis. The proper regulation of ENaC activity is also very important in the lung, because transgenic mice lacking functional channels die within 40 h of birth from fluid filled airways (10). Additionally, increases in intracellular Cl⫺ concentrations that secondarily lead to changes in ENaC activity play an important role in the pathophysiology of cystic fibrosis (11). Anionic phospholipids, such as phosphatidylinositol 4,5-bisphosphate (PIP2) and phosphatidylinositol 3,4,5-trisphosphate (PIP3), are normally located in the inner leaflet of the plasma membrane and are emerging as important regulators of ion transporters and channels. Although basal levels of both anionic phospholipids are generally very low, several models for the regulation of channels and transporters by PIP2 and PIP3 have been proposed. For example, all members of the inward rectifier potassium channel family (KATP, IRK, GIRK, and ROMK) are thought to be positively regulated by PIP2 interaction (reviewed in Ref. 12). Of these, the best characterized PIP2-binding domain is that of the KATP channels. PIP2 binds directly to the C terminus of the KATP channel, which contains multiple positively charged lysine and arginine residues and maintains an open conformation by preventing ATP binding (13–15). Classically, PIP3 is considered to be the lipid product generated when activated phosphoinositide 3-OH kinase (PI3K) phosphorylates PIP2 at the 3⬘ position and is the principle mediator of PI3K effects. Although little is known for its role in regulating the open state of channels, PIP3 does exhibit binding specificity and may be important in ion channel regulation by hormones and growth factors. It has recently been reported that PIP3 binds reversibly to regulators of G protein signaling molecules in cardiac cells to regulate K⫹ channel activity in response to changes in intracellular calcium levels. In a resting (low Ca2⫹) state, the action of regulators of G protein signaling is thought to be allosterically inhibited by PIP3 (16). These studies demonstrate that anionic phospholipids can regulate various ion channels in many different systems and serve as possible analogous models for PIP3 regulation of ENaC activity in Na⫹ transporting epithelia. Although the regulation of ENaC has been extensively studied, the specific regulation of ENaC by phosphoinositides remains largely unexplored. However, we have recently demonstrated that application of

JOURNAL OF BIOLOGICAL CHEMISTRY

40885

Downloaded from http://www.jbc.org/ by guest on December 22, 2015

Whole cell voltage clamp experiments were performed in a mouse cortical collecting duct principal cell line using patch pipettes back-filled with a solution containing phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 significantly increased amiloridesensitive current in control cells but not in the cells prestimulated by aldosterone. Additionally, aldosterone stimulated amiloridesensitive current in control cells, but not in the cells that expressed a PIP3-binding protein (Grp1-PH), which sequestered intracellular PIP3. 12 amino acids from the N-terminal tail (APGEKIKAKIKK) of ␥-epithelial sodium channel (␥-ENaC) were truncated by PCRbased mutagenesis (␥T-ENaC). Whole cell and confocal microscopy experiments were conducted in Madin-Darby canine kidney cells co-expressing ␣- and ␤-ENaC only or with either ␥-ENaC or ␥T-ENaC. The data demonstrated that the N-terminal tail truncation significantly decreased amiloride-sensitive current and that both the N-terminal tail truncation and LY-294002 (a PI3K inhibitor) prevented ENaC translocation to the plasma membrane. These data suggest that PIP3 mediates aldosterone-induced ENaC activity and trafficking and that the N-terminal tail of ␥-ENaC is necessary for channel trafficking, probably channel gating as well. Additionally, we demonstrated a novel interaction between ␥-ENaC and PIP3.

Regulation of ENaC by PIP3 PIP2 as well as PIP3 to the cytoplasmic surface of apical membranes of A6 cells and injected into Xenopus oocytes heterologously expressing ENaC prevented run down of ENaC activity and increased amiloridesensitive channel activity in voltage clamp recordings (17, 18). Additionally, Tong et al. (19) demonstrated that PIP2 and PIP3 increased the open probability of reconstituted ENaC in excised patches of Chinese hamster ovary cells. Blazer-Yost and Nofziger have recently compared and contrasted the multiple effects of phosphoinositide lipids on ENaC in A6 and Chinese hamster ovary cells in a recent review (20). In the present study, we examined the direct influence of PIP3 on ENaC activity in mpkCCDc14 clones, a mouse collecting duct principle cell line, which maintains aldosterone responsiveness and express functional ENaC endogenously (21, 22). We also truncated 12 amino acids from the N-terminal tail of ␥-ENaC subunit, suggesting that full-length expression of this subunit is required for normal ENaC trafficking or stability at the plasma membrane. We also demonstrate a novel interaction between ␥-ENaC and phospholipids, including PIP2 and PIP3.

MATERIALS AND METHODS

40886 JOURNAL OF BIOLOGICAL CHEMISTRY

VOLUME 280 • NUMBER 49 • DECEMBER 9, 2005


Cell Culture—The mouse cortical collecting duct principal cell line (mpkCCDc14) is often employed in the study of aldosterone-induced ENaC activity because of their specific responsive to physiological concentrations of mineralocorticoid hormone (21, 22). The mpkCCDc14 cells were incubated in a 1:1 mix of Dulbecco’s modified Eagle’s medium/Ham’s F-12 medium (Invitrogen) supplemented with 50 nM dexamethasone, 1 nM triiodothyronine, 20 mM HEPES, 2 mM L-glutamine, 0.1% penicillin/streptomycin, and 2% heat-inactivated fetal bovine serum. Madin-Darby canine kidney (MDCK) and Chinese hamster ovary cells (CHO) (obtained from ATCC, Manassas, VA) are also routinely used in investigating the regulation of sodium channel activity by exogenously expressing ␣-, ␤, and ␥-ENaC subunits (19, 23), because these cells do not express a significant amount of endogenous ENaC. MDCK cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) with 10% fetal bovine serum, and CHO cells were cultured in Hain’s F-12-Kaighn medium (Invitrogen) with 10% fetal bovine serum. All of the mammalian cell lines were maintained in plastic tissue culture flasks at 37 °C with 5% CO2 in air. Generation of cDNA Constructs of Tagged ENaCs—Original plasmids containing cDNAs encoding the wild type ␣-, ␤-, and ␥-rENaC in pSport vectors were provided by Dr. Bernard C. Rossier (University of Lausanne, Lausanne, Switzerland). A ␥-rENaC-pDsRed2-N1 construct was created in three steps. First, a 1833-base pair fragment was excised from ␥-rENaC-pSport using EcoRI and ApaI restriction enzymes, which was then subsequently ligated into the corresponding cloning sites of pDsRed2-N1 vector (BD Biosciences, Palo Alto, CA). In the second step, a 242-base pair PCR fragment was synthesized using pcDNA3-␥-rENaC cDNA as a template, with a sense primer (TTGTTGGGCCCGTAGGCAGA) corresponding to nucleotides 1814 –1833 and an antisense primer (ACCGGTCCCAACTCATTGGTCAACT) corresponding to 2048 –2032. This primer pair was chosen because unique ApaI and AgeI restriction sites are located within the primer sequences. The 242-base pair amplicon, lacking stop codons, was then QIAquick purified (Qiagen, Valencia, CA) and subsequently subcloned into the PGEM-TEasy vector (Promega, Madison, WI). In the third step, PGEM-TEasy containing the 237-base pair PCR product was digested with ApaI/AgeI and then ligated into the pDsRed2-␥-rENaC vector described above. In this way, we eliminated endogenous stop codons and cloned ␥-rENaC in frame with pDsRed vector. The ␤-rENaCpEYFP-N1 and ␣-rENaC-pECFP-N1 constructs were generated using similar strategies.

The ␥T-ENaC-pDsRed construct, encoding a protein in which the N-terminal tail of ENaC (APGEKIKAKIKK) is truncated, was created in three steps. First, a 36-nucleotide segment from the 5⬘ end of ␥-ENaC was removed by EcoRI and BamHI enzyme digestion. Then a 393-PCR synthesized fragment was generated by using pcDNA3-␥-ENaC as a template and the primer pair 5⬘-ACCATGGCTCTGCCGGTTCGA and 3⬘-GGACGGCATGGATCCTGCTT), to recreate the ATG start site and Kozak sequences in the truncated ␥-ENaC-pDsRed construct. This was achieved by expressing the 393-base pair PCR fragment in pGEM-TEasy construct and subsequently cloning it in frame with pDsRed EcoRI and BamHI sites. DNA Transfections—mpkCCDc14 cells were transfected with GFPfused pleckstrin homology (PH) domains of either Grp1 or dynamin construct (obtained from Dr. Mark A. Lemmon, University of Pennsylvania School of Medicine, Philadelphia, PA); MDCK cells were transfected with fluorescently labeled ␣-, ␤-, and ␥-ENaC constructs (described above), and CHO cells were transfected with either fulllength ␥-ENaC or the N-terminal tail truncated ␥T-ENaC construct or pDsRed vector alone. Each cell line was transfected using Lipofectamine Plus reagent (Invitrogen) in accordance with the manufacturer’s recommended protocol. Briefly, the cells were seeded at subconfluent densities 1 day before the transfection. DNA constructs were diluted with serum-free medium (1 ␮g DNA/50 ␮l medium), mixed with Plus reagent, and incubated at room temperature for 15 min. Then Lipofectamine reagent was diluted with serum-free medium (1 ␮l of Lipofectamine/25 ␮l of medium), mixed with the DNA/Plus solution, and incubated at room temperature for an additional 15 min. Finally, the transfection solution containing DNA, Plus reagent, and Lipofectamine reagent was applied to the cells and allowed to incubate for 4 – 6 h at 37 °C before the transfection solution was replaced with regular growth medium. Patch Clamp Recording and Analysis—For patch clamp experiments, either MDCK cells or mpkCCDc14 were grown to confluent densities on permeable polyester membranes. The permeable support allowed patch pipette access to the apical membrane, as well as a physical separation of the apical and basolateral bath compartments. Immediately before use, the cells were thoroughly washed with NaCl bath solution (145 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 10 mM HEPES, at a pH of 7.4), transferred into the patch recording chamber mounted on a Nikon Eclipse TE200 inverted microscope, and then visualized with Hoffman modulation optics. The whole cell configuration was established with polished patch pipettes with a tip resistance of 2 M⍀. Only patches with a seal resistance above 10 G⍀ were used for the experiments. Pipette solution contained 145 mM KCl, 5 mM NaCl, 50 nM free Ca2⫹ (after titration with 2 mM EGTA), 1 mM MgCl2, 2 mM K2-ATP, and 10 mM HEPES, at a pH of 7.2. A voltage step protocol from ⫺120 mV to ⫹40 mV (in 20-mV intervals) was used to monitor the current using an Axopatch 1-D (Axon Instruments, Union City, CA). The data were acquired using TL-1 acquisition hardware and analyzed with pClamp software (Axon Instruments). Patch clamp recordings were performed at room temperature. Localization of PIP3 and ENaC Subunits with Laser Confocal Microscopy—According to techniques that have been previously established, the localization of PIP3 can be visualized after transfecting cells with a GFP-fused PH domain (24 –27). Therefore, mpkCCDc14 cells were cultured on glass coverslips and then transiently transfected with the GFP-fused Grp1-PH construct to localize endogenous PIP3 in a collecting duct cell line. Fluorescently labeled ENaC subunits (␥-rENaC-pDsRed2-N1, ␤-rENaCpEYFP, and ␣-rENaCpCFP-N1) were also transfected into MDCK cells grown on permeable supports, as

Regulation of ENaC by PIP3

FIGURE 1. PIP3 stimulates amiloride-sensitive sodium current in mpkCCDc14 cells. Representative whole cell current was recorded from either a mpkCCDc14 cell cultured in aldosterone-free medium (A) or a mpkCCDc14 cell treated with 1 ␮M aldosterone (B). The current is derived from voltage steps between ⫺120 mV to ⫹40 mV (in 20-mV intervals). Patch pipettes were filled with pipette solution (see “Methods and Materials”) containing 10 ␮M PIP3. The left traces show the current immediately after forming the whole cell configuration. The middle traces show the current after 10 ␮M PIP3 diffused into cells. The right traces show the current after perfusion of the bath with a solution containing 2 ␮M amiloride. C, mean amiloride-sensitive current of mpkCCDc14 cells at a representative potential of ⫺100 mV before (white bars) or after (black bars) PIP3 diffused into the cells. The dashed lines (in other figures as well) represent the zero current level.


Biosciences Inc.). The protein-bound beads were then thoroughly washed with TBS-T 3% fatty acid-free BSA three times. The protein was eluted from the beads by adding 2⫻ Laemmli sample buffer and heated at 95 °C. Standard PAGE and immunoblot techniques, described above, were used to detect ␥T-ENaC and ␥-ENaC pull-down with PIP3 after transfer to membrane. We subjected CHO cell lysate expressing DsRed only to the same protein pull-down assay as an appropriate negative control. Statistical Analysis—The data are reported as the mean values ⫾ S.E. Statistical analysis was performed with SigmaPlot and SigmaStat software (Jandel Scientific, CA). Paired or unpaired t tests were used to determine statistical significance between two groups. Analysis of variance was used for multiple comparisons. The results were considered significant if p ⬍ 0.05, as we described previously (28).

RESULTS PIP3 Stimulates ENaC in Control mpkCCDc14 Cells but Not in Aldosterone-treated mpkCCDc14 Cells—It is well known that blocking production of PIP3 by inhibiting PI3K blocks the effect of aldosterone on sodium transport in renal cells (29, 30). However, if an aldosteroneinduced increase in PIP3 is the major cause of the initial hormoneinduced increase in ENaC activity, then the addition of PIP3 to the cytosolic surface of renal cells should increase ENaC activity in the absence of aldosterone. Using the inside-out configuration, we recently demonstrated that PIP3 did not elevate but only maintained ENaC activity in aldosterone-treated A6 cells (17). We hypothesized that the stimulatory effect of PIP3 on ENaC activity may be already saturated in A6 cells that are continuously cultured in the presence of a high concentration of aldosterone. To test this hypothesis, in the present study we performed whole cell voltage clamp experiments in mpkCCDc14 cells, which do not require a high dose of aldosterone for growth and differentiation. Whole cell currents in response to a voltage step protocol (see “Methods and Materials”) were recorded from control mpkCCDc14 cells and aldosterone-treated mpkCCDc14 cells. The patch pipettes were back-filled with a solution containing 10 ␮M PIP3. Compared with the current immediately after forming the whole cell configuration, amiloride-sensitive current was significantly increased at 5 min (PIP3 had already diffused into the cells) in an aldosterone-free control cell (Fig. 1A) but was not increased or was increased to a lesser degree in an aldosterone-treated cell (Fig. 1B). Amiloride-sensitive currents at ⫺100 mV in control cells were ⫺0.30 ⫾ 0.06 nA (control) and ⫺1.30 ⫾ 0.27


40887


described above. Cells transfected with either the GFP-fused Grp1-PH construct or fluorescent vectors containing ENaC subunits were visualized using Zeiss LSM 510 NLO META confocal microscope (Zeiss, Thornwood, NY). Protein-Lipid Overlay—To test the binding properties of ␥T-ENaC and wild type ␥-ENaC, a protein-lipid overlay was performed using PIP MicroStrips, commercially available from Echelon Biosciences Inc. (Salt Lake City, UT). These strips contain 100 pmol of various phospholipids (listed in Fig. 7), spotted and immobilized on a nitrocellulose membrane. Cell lysate from CHO cells that were transiently transfected with full-length ␥-ENaC or N-terminal tail truncated ␥T-ENaC subunits (in the presence of ␣- and ␤-ENaC) were overlaid onto the PIP MicroStrips. As a negative control, we also transfected cells with the pDsRed construct only and proceeded with the same experimental protocol. CHO cells were thoroughly rinsed with phosphate-buffered saline before lysing with hypotonic gentle lysis buffer containing: 10 mM Tris HCl (pH 7.5), 10 mM NaCl, 2 mM EDTA, 0.5%Triton X-100, and freshly prepared 1⫻ protease inhibitor mixture. The nitrocellulose strips were blocked in TBS-T 3% fatty acid-free BSA (Sigma) for 1 h at room temperature. Then ⬃26 ␮g/ml protein from CHO cell lysate (expressing either ␣,␤,␥T-ENaC or ␣,␤,␥-ENaC) was incubated with the strips in TBS-T 3% fatty acid-free BSA at 4 °C overnight. The strips were then washed with TBS-T/BSA three times with gentle agitation, for 10 min each wash, at room temperature. ␥T-ENaC and ␥-ENaC interaction with spotted phospholipids were detected by subsequently blocking the strips in TBS-T buffer (10 mM Tris, pH 7.5, 70 mM NaCl, and 0.1% Tween) with 5% dry milk and then incubating the strips in a 1:10,000 dilution of polyclonal rabbit anti-DsRed-antibody (BD Bioscience, Palo Alto, CA) in blocking buffer for 1 h. IgG-alkaline phosphatase-labeled secondary antibody (KPL, Gathersburg, MD) was added (1:5,000 in blocking buffer) and incubated for an additional hour at room temperature. After thorough washes, alkaline phosphatase signal was detected using Nitroblock chemiluminescence enhancer (Tropix, Bedford, MA) and CDP-Star substrate (Tropix) in combination with Kodak Image Station 200MM and Kodak 1D software (Kodak, New Haven, CT). Protein Pull-down Assay—To demonstrate effective ␥T-ENaC and ␥-ENaC expression and interaction with PIP3 in our cell model, we performed additional protein pull-down assays. CHO cells expressing ␣,␤,␥ T-ENaC or ␣,␤,␥-ENaC were lysed as described above in gentle lysis buffer. 2 mg of CHO cell lysate incubated overnight, at 4 °C, with 75 ␮l of phosphatidylinositol 3,4,5-triphosphate bound beads (Echelon


FIGURE 2. Expression of Grp1-PH domain, which can sequester PIP3, reduces amiloride-sensitive current. Representative whole cell current was recorded from either mpkCCDc14 cells cultured in aldosterone-free medium (A) or mpkCCDc14 cells treated with 1 ␮M aldosterone (B). The current was recorded from control cells (left traces) and cells transfected with Grp1-PH (middle traces) and Dyn-PH (right traces). C, mean amiloride-sensitive current at ⫺100 mV in cells cultured without (white bars) or with (black bars) 1 ␮M aldosterone.


Aldosterone Elevates Membrane PIP3 Concentration via PI3K—As we have described above, the Grp1-PH domain binds strongly and specifically to PIP3 and is therefore commonly employed in the study of PIP3 in vivo. By fusing Grp1-PH to GFP, we were able to localize PIP3 expression in mpkCCDc14 cells. In the absence of serum and aldosterone, we expect GFP-Grp1-PH expression to be evenly distributed across the cytoplasm with low fluorescence intensity, because PIP3 levels under resting conditions are very low. However, aldosterone-induced activation of PI3K should enhance PIP3 levels at the plasma membrane. To test our hypothesis that aldosterone elevates membrane PIP3 concentrations via PI3K, we first transfected mpkCCDc14 cells with the GFP-fused Grp1-PH domain (Fig. 3). The cells that were deprived of serum and hormone did not contain significant amounts of PIP3. In this basal state, the expressed GFP-fused Grp1-PH domain was distributed with an even intensity across the whole cytoplasm of mpkCCDc14 cells as expected (left panel). Cells treated with 1 ␮M aldosterone for 30 min (middle panel) displayed predominant GFP-fluorescence intensity at the plasma membrane. This effect was prevented by pretreating the cells with 5 ␮M LY294002, a specific PI3K inhibitor (right panel), indicating that aldosterone can elevate the concentration of PIP3 in the plasma membrane (where functional ENaC resides) by stimulating PI3K. These data suggest that PIP3 is an important regulator of aldosterone-induced sodium channel activity. Truncation of ␥-ENaC N-terminal Tail Decreases Amiloride-sensitive Sodium Current—The N termini of ENaC subunits are very important in normal ENaC function. It has been shown that deletion of positively charged motifs in the cytoplasmic N termini of ␤-(⌬2– 49) and ␥-ENaC (⌬2–53) dramatically reduces ENaC activity (34). We determined whether removal of 12 amino acids (⌬2–13), which include several conserved lysine residues (shown in Fig. 4D) from the N-terminal tail of ␥-ENaC, would lead to a reduction in amiloride-sensitive current and alter subunit translocation in MDCK cells. The N-terminal truncated form of ␥-ENaC was subcloned into pDsRed2 vector (␥T-ENaC). ENaC was then reconstituted in MDCK cells by co-transfection of either full-length ␣␤␥-ENaC or ␣␤␥T-ENaC. Transfected cells were pretreated with 1 ␮M aldosterone for 2 h before obtaining the whole cell configuration. The data demonstrated that the current in cells expressing full-length ␣␤␥-ENaC (Fig. 4A) was 10 times higher than cells expressing ␣␤␥T-ENaC (Fig. 4B). The mean amiloridesensitive current at ⫺100 mV was ⫺2.25 ⫾ 0.39 nA (n ⫽ 5) in ␣␤␥-



nA (after PIP3) (p ⬍ 0.01; n ⫽ 5). In contrast, amiloride-sensitive currents at ⫺100 mV in aldosterone-treated cells were ⫺1.56 ⫾ 0.33 nA (control) and ⫺1.69 ⫾ 0.28 nA (after PIP3) (p ⬎ 0.05; n ⫽ 6), as shown in Fig. 1C. These data suggest that exogenous PIP3 significantly increases amiloride-sensitive sodium current in mpkCCDc14 cells and may mediate the aldosterone-induced increase in ENaC activity. Sequestering PIP3 Reduces Aldosterone-stimulated ENaC Current— PH domains are small stretches of 100 –120-amino acid sequences found in many cell signaling and cytoskeletol proteins. PH domains bind with high specificity and affinity to phosphoinositides. In this way, the PH domain directly targets the “host” signaling or cytoskeletol protein to the cellular membrane. Also, the specific binding characteristics of PH domains are utilized in studying PIP2 and PIP3 activity in vivo. For example, the PH domain of Grp1 (Grp1-PH) binds to PIP3 with high specificity and affinity (Kd ⫽ 32 nM), (26, 31) and can be used to greatly reduce endogenous PIP3 levels of activity. However, the PH domain of dynamin (Dyn-PH) only weakly associates with PIP3 (Kd ⫽ 1.4 – 4 ␮M) (32, 33). Therefore, Dyn-PH is an appropriate negative control for experiments sequestering PIP3 with the Grp1-PH expression. The effects of Grp1-PH and Dyn-PH expression in mpkCCDc14 cells on whole cell current are shown in Fig. 2. Very low basal levels of current were recorded from cells before aldosterone treatment, as expected, whether they were untransfected, expressed Grp1-PH domain, or expressed Dyn-PH domain (Fig. 2A). However, after 1 ␮M aldosterone treatment, whole cell current increased in the untransfected and Dyn-PH control cells but not in mpkCCDc14, in which endogenous PIP3 activity had been sequestered by Grp1-PH domain. The mean amiloride-sensitive current at ⫺100 mV in the presence (black bars) and absence of aldosterone (white bars) is shown in Fig. 2C. PIP3 significantly increased amiloride-sensitive current 5.6- and 8.0-fold in control (⫺0.26 ⫾ 0.04 nA versus ⫺1.48 ⫾ 0.34 nA, n ⫽ 5; p ⬍ 0.01) and DynPH-transfected cells (⫺0.21 ⫾ 0.04 nA versus ⫺1.68 ⫾ 0.30 nA, n ⫽ 4; p ⬍ 0.01), respectively. Aldosterone, however, did not significantly increase the current in Grp1-PH expressing mpkCCDc14 cells (⫺0.34 ⫾ 0.07 nA versus ⫺0.50 ⫾ 0.14 nA, n ⫽ 6; p ⬎ 0.05). In our studies, aldosterone failed to increase ENaC activity in cells that expressed the Grp1-PH domain (which has high binding specificity and affinity to PIP3) compared with cells transfected with another type of PH domain, Dyn-PH, which has low binding affinity for PIP3. This is strong evidence that the PI3-K product, PIP3, specifically mediates the stimulation of ENaC by aldosterone.


FIGURE 3. Aldosterone elevates membrane concentrations of PIP3 in mpkCCDc14. Confocal microscopy images of mpkCCDc14 cells transfected with GFP-fused Grp1-PH domain to indirectly map cellular PIP3 because of its high affinity binding to PIP3. Experiments were performed under control conditions (left panel) and after pretreatment with either 1 ␮M aldosterone alone (middle panel) or 1 ␮M aldosterone in the presence of 5 ␮M LY294002 (right panel). The data represent three independent experiments.

ENaC-transfected MDCK cells, which was 10 times higher than in cells expressing ␣␤␥T-ENaC (⫺0.24 ⫾ 0.064 nA, n ⫽ 5) (p ⬍ 0.001). Truncation of ␥-ENaC N-terminal Tail and Inhibition of PI3K Impede ENaC Translocation to the Plasma Membrane—Because ␣-, ␤-, ␥-, and ␥T-ENaC subunits were cloned into pECFP, pEYFP, pDsRed, and pDsRed vector, respectively, we were able to perform confocal microscopy experiments to determine the effect of the N-terminal tail truncation and ␥-ENaC deletion on sodium channel translocation to the plasma membrane in MDCK cells. The localization of ␣-ENaC (blue), ␤-ENaC (yellow), or ␥-ENaC (red) subunit in the cells is shown separately in the first three panels of Fig. 5 and is then superimposed in the last panel. Compared with that under control conditions (Fig. 5A), wild type ␣␤␥-ENaC subunits all translocated to the plasma membrane at 2 h after 1 ␮M aldosterone treatment at 37 °C (Fig. 5B). Aldosteroneinduced trafficking of wild type ENaC subunits to the plasma membrane was abolished by 5 ␮M LY294002 (Fig. 5C), strongly suggesting that PI3K-generated lipids (such as PIP3) provide a recruitment mechanism


for ENaC to the apical membrane. Importantly, expression of an N-terminal truncated ␥-ENaC (␥T-ENaC) with full-length ␣- and ␤-ENaC subunits prevented ENaC trafficking to the plasma membrane (Fig. 5D) and is consistent with our finding that ␣␤␥T-ENaC expression in MDCK cells leads to decreased amiloride-sensitive current. We performed additional experiments in which only ␣- and ␤-ENaC subunits were expressed in MDCK cells. Fig. 6 shows that the ␣,␤-ENaC subunits can be efficiently expressed in the absence of ␥-subunit. Using the same excitation wavelengths and gain settings in confocal analysis, it appears that ␣- and ␤-ENaC expression levels are similar to the levels reached by transfecting all three ENaC subunits in MDCK cells, shown in Fig. 5. However, no detectable amiloride-sensitive current was observed in ␣,␤-ENaC only, co-transfected cells (data not shown). Furthermore, Fig. 6 shows that the ␣ and ␤ subunits do not effectively traffic to the plasma membrane in response to 1 ␮M aldosterone treatment in the absence of ␥-ENaC expression. Although ENaC trafficking is greatly limited in these cells, there is still some membrane localization of the ␣and ␤-subunits. Our findings show that complete, full-length expression of the ␣-, ␤-, and ␥-ENaC subunits are requisite for the formation as well as effective translocation of functional sodium transporting channels at the apical membrane of kidney cells.


40889


FIGURE 4. Reduction of amiloride-sensitive current in MDCK expressing ␣␤␥TENaC. Representative whole cell current was recorded from MDCK cells transfected with either ␣␤␥-ENaC (A) or ␣␤␥T-ENaC (B) and cultured in the presence 1 ␮M aldosterone. The current was recorded under control conditions (left traces), after perfusion of cells with 2 ␮M amiloride (middle traces), and after washing the bath (right traces). C, mean amiloride-sensitive current at ⫺100 mV in MDCK cells transfected with either ␣␤␥-ENaC or ␣␤␥T-ENaC and in the presence 1 ␮M aldosterone. D, truncated amino acid sequence of rat ␥-ENaC subunit at the N-terminal end.

FIGURE 5. Abolishment of aldosterone-induced ENaC trafficking to the plasma membrane in MDCK cells expressing ␣␤␥T-ENaC. Wild type ␣- and ␤-ENaC were coexpressed with either wild type ␥-ENaC (A–C) or N-terminal tail-truncated ␥-ENaC (D) in MDCK cells. ␣-, ␤-, or ␥-ENaC was tagged with fluorescent proteins CFP, YFP, and pDsRed, which are shown in blue, yellow, and red, respectively. Confocal microscopy experiments were performed in serum- and hormone-deprived control cells (A) and cells treated with either 1 ␮M aldosterone alone (B and D) or 1 ␮M aldosterone in the presence of 5 ␮M LY294002 (C) for 2 h. The data represent five independent experiments showing similar results.


Phospholipid Binding Specificity of ␥-ENaC—Because our data show that anionic phospholipids can mediate ENaC activity, we next tested the ability of ␥-ENaC to bind to various phospholipids using a proteinlipid overlay method. Phospholipids, including phosphoinositides, were spotted onto a membrane (Echelon Bioscience Inc.) and incubated with either cell lysate from ␣,␤,␥-ENaC- or ␣,␤,␥T-ENaC-transfected CHO cells. The membranes were then washed and immunoblotted using anti-DsRed antibody to detect ␥-rENaC-pDsRed2-N1 binding to the membrane, via direct interactions with the lipids. As shown in Fig. 7A, both ␥T-ENaC and ␥-ENaC interacted with 100 pmol of PI(3,4)P2, PI(3,5)P2, PI(4,5)P2, PI(3,4,5)P3, phosphatic acid, phosphatidylserine, PI, PI(3)P, PI(4)P, and PI(5)P. The ENaC subunits did not bind to sphingosine-1-phosphate, lysophosphatidic acid, lysophosphocholine, phosphatidylethanolamine, phosphatidylcholine, nor the control in which no lipid was spotted onto the membrane (position 8 on the strips). As an additional control, we also demonstrated that DsRed protein alone did not bind nonspecifically to membrane that had only been incubated with protein lysate from pDsRed-transfected CHO cells. Fig. 7B (left panel) also confirms effective ␥- and ␥T-rENaC-pDsRed2-N1 expression in CHO cells and that these ENaC subunits can pull down with 1.5 nmol of PIP3 bound beads. We show in the right panel, as a negative control, that the DsRed label alone does not contribute to PIP3 protein pull-down. Together, these data show that both the full-length and N-terminal tail truncated forms of ␥-ENaC bind to phospholipids spotted on a nitrocellulose membrane and can pull-down with PIP3 immobilized on beads.

DISCUSSION We previously demonstrated that anionic phospholipids including PIP3 maintained ENaC activity in inside-out patches excised from aldosterone-conditioned A6 cells (17). Although results from this previous publication convincingly showed that PIP3 increases the likelihood that ENaC would be open, these single channel studies could not discern whether an increase in the number of channels trafficked to the apical membrane could also be responsible for maintaining ENaC activity in PIP3-treated cells. Our current study coupled with our previous observations suggest that PIP3 serves as an effective regulator of ENaC trafficking (from the cytoplasmic pool to the surface membrane), promotes an open state of the channel, or maintains channel stability through direct interactions with the ENaC subunit at the plasma membrane.


FIGURE 7. Interaction of ␥-ENaCs with phospholipids. A, the ability of ␥-ENaC and ␥T-ENaC was assayed using a protein-lipid overlay. 100 pmol of the indicated phospholipid is on a micro-strip of nitrocellulose membrane (PIP Strips, Echelon, Bioscience Inc.). The lipids are identified by the positions of the encircled numbers at the top of A. 1, sphingosine-1-phosphate; 2, PI(3,4)P2; 3, PI(3,5)P2; 4, PI(4,5)P2; 5, PI(3,4,5)P3; 6, phosphatic acid; 7, phosphatidylserine; 8, blank; 9, lysophosphatidic acid; 10, lysophosphocholine; 11, phosphatidylinositol; 12, PI(3)P; 13, PI(4)P; 14, PI(5)P; 15, phosphatidylethanolamine; 16, phosphatidylcholine. The micro-strip was incubated overnight with lysate from ␣,␤,␥-ENaC- or ␣,␤,␥T-ENaC-transfected CHO cells and ␥- or ␥T-ENaC protein binding to lipids was detected using anti-DsRed antibody. In A, an experiment representative of three is shown. The left panel in B shows effective ␥- and ␥T-ENaC expression in CHO cells and that the subunits can pull down specifically with PIP3 bound beads. The right panel shows DsRed protein alone did not pull down with beads.

Using the mouse mpkCCD cell line, which does not require aldosterone for growth and differentiation, we demonstrated that PIP3 stimulated ENaC activity in the absence of aldosterone but could not further increase ENaC activity in the presence of aldosterone. We also showed that aldosterone elevated the concentration of PIP3 in the plasma membrane and that sequestering PIP3 with Grp1-PH domain prevented aldosterone activation of ENaC. Although the ␣- and ␤-subunits were expressed at high levels in MDCK cells, ␣/␤-ENaC complexes could not completely traffic to the plasma membrane in the absence of ␥-ENaC expression, because we could measure no amiloride-sensitive current (data not shown). Truncation of lysine-rich residues in the N-terminal end of ␥-ENaC similarly inhibited aldosterone-induced increases in current and prevented appropriate channel translocation to the plasma membrane after aldosterone treatment. We originally thought that this might be due to a failure of ␥T to bind PIP3, but our lipid overlay assays revealed that the ␥T-ENaC binds to phospholipids, including PIP3. It appears that the binding ability of the N-terminally truncated form of ␥-ENaC was slightly higher than that of wild type. Therefore, it is possible that the N-terminal tail is required for channel gating or trafficking for reasons other than lipid binding. A report just came out suggesting that the region immediately following the second transmembrane spanning domain of ␥-ENaC acts as part of a functional PIP3-binding site (35). We are currently investigating additional arginine- and lysine-rich domains in ENaC subunits, which may directly interact with anionic phospholipids, as hypothesized in our recent review article (36). However, our current model for the regulation of ENaC by anionic phospholipids does not exclude a role for the serum and glucocorticoidinducible kinase (SGK1), an immediate aldosterone induced kinase that increases the activity of ENaC (37– 43). The upstream regulators of SGK1 enzyme activity are 3-phosphoinositide-dependent kinase-1 and ⫺2 (PDK1 and PDK2, respectively); thus SGK1 is also inhibited by PI3K inhibitors such as LY294002 and is dependent upon PIP3 for complete activation (44, 45). PIP3 may enhance ENaC function by associating with



FIGURE 6. ␣,␤-ENaC subunit co-expression in MDCK cells. (A) ␣ and ␤ subunits are expressed at high levels in the cytoplasm of MDCK cells when incubated in medium devoid of serum and aldosterone. (B) Absent ␥-ENaC expression, ␣ and ␤ subunits cannot effectively traffic to the plasma membrane in response to 1 ␮M aldosterone treatment.

Regulation of ENaC by PIP3 SGK1 and recruit this kinase to the inner leaflet of the plasma membrane. Once at the appropriate site of PDK1 and PDK2 activation, SGK1 could then inhibit ubiquitin ligase Nedd4 –2 activity (as we currently understand it to). Because normal ENaC function is so important in maintaining fluid and ion homeostasis, it makes sense that tight epithelial cells would utilize multiple pathways to ensure net Na⫹ re-uptake. Acknowledgments—We thank B. J. Duke for maintaining cell cultures and Dr. Mark A. Lemmon at University of Pennsylvania for providing us with GFP-PH domain DNA constructs.

REFERENCES



40891


1. Alvarez de la Rosa, D., Canessa, C.M., Fyfe G.K., and Zhang, P. (2000) Annu. Rev. Physiol. 62, 573–594 2. Canessa, C. M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J. D., and Rossier, B. C. (1994) Nature 367, 463– 467 3. Fyfe, G. K., Quinn, A., and Canessa, C. M. (1998) Semin. Nephrol. 18, 138 –151 4. Horisberger, J. D. (1998) Curr. Opin. Cell Biol. 10, 443– 449 5. Lingueglia, E., Voilley, N., Waldmann, R., Lazdunski, M., and Barbry, P. (1993) FEBS Lett. 318, 95–99 6. Fyfe, G. K., and Canessa, C. M. (1998) J. Gen. Physiol. 112, 423– 432 7. Firsov, D., Gautschi, I., Merillat, A. M., Rossier, B. C., and Schild, L. (1998) EMBO J. 17, 344 –352 8. McDonald, F. J., Price, M. P., Snyder, P. M., and Welsh, M. J. (1995) Am. J. Physiol. 268, C1157–C1163 9. McDonald, F. J., Snyder, P. M., McCray, P. B., Jr., and Welsh, M. J. (1994) Am. J. Physiol. 266, L728 –L734 10. Hummler, E., Barker, P., Gatzy, J., Beermann, F., Verdumo, C., Schmidt, A., Boucher, R., and Rossier, B. C. (1996) Nat. Genet. 12, 325–328 11. Konig, J., Schreiber, R., Voelcker, T., Mall, M., and Kunzelmann, K. (2001) EMBO Rep. 11, 1047–1051 12. Hilgemann, D. W., Feng, S., and Nasuhoglu, C. (2001) Sci. STKE 2001, RE19 13. Baukrowitz, T., Schulte, U., Oliver, D., Herlitze, S., Krauter, T., Tucker, S. J., Ruppersberg, J. P., and Fakler, B. (1998) Science 282, 1141–1144 14. Krauter, T., Ruppersberg, J. P., and Baukrowitz, T. (2001) Mol. Pharmacol. 59, 1086 –1093 15. Schulze, D., Krauter, T., Fritzenschaft, H., Soom, M., and Baukrowitz, T. (2003) J. Biol. Chem. 278, 10500 –10505 16. Ishii, M., Inanobe, A., and Kurachi, Y. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 4325– 4330 17. Ma, H. P., Saxena, S., and Warnock, D. G. (2002) J. Biol. Chem. 277, 7641–7644 18. Yue, G., Malik B., Yue G., and Eaton D.C. (2001) J. Biol. Chem. 277, 11965–11969 19. Tong, Q., Gamper, N., Medina, J. L., Shapiro, M. S., and Stockand, J. D. (2004) J. Biol. Chem. 279, 22654 –22663 20. Blazer-Yost, B. L., and Nofziger, C. (2005) Pflugers Arch. Eur. J. Physiol. 450, 75– 82

21. Bens, M., Vallet, V., Cluzeaud, F., Pascual-Letallec, L., Kahn, A., Rafestin-Oblin, M. E., Rossier, B. C., and Vandewalle, A. (1999) J. Am. Soc. Nephrol. 10, 923–934 22. Vuagniaux, G., Vallet, V., Jaeger, N. F., Pfister, C., Bens, M., Farman, N., CourtoisCoutry, N., Vandewalle, A., Rossier, B. C., and Hummler, E. (2000) J. Am. Soc. Nephrol. 11, 828 – 834 23. Stutts, M. J., Canessa, C. M., Olsen, J. C., Hamrick, M., Cohn, J. A., Rossier, B. C., and Boucher, R. C. (1995) Science 269, 847– 850 24. Gray, A., Van Der, K. J., and Downes, C. P. (1999) Biochem. J. 344, 929 –936 25. Oatey, P. B., Venkateswarlu, K., Williams, A. G., Fletcher, L. M., Foulstone, E. J., Cullen, P. J., and Tavare, J. M. (1999) Biochem. J. 344, 511–518 26. Venkateswarlu, K., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Curr. Biol. 8, 463– 466 27. Venkateswarlu, K., Gunn-Moore, F., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Biochem. J. 335, 139 –146 28. Ma, H., and Ling, B. N. (1996) Am. J. Physiol. 270, F798 –F805 29. Blazer-Yost, B. L., Paunescu, T. G., Helman, S. I., Lee, K. D., and Vlahos, C. J. (1999) Am. J. Physiol. 277, C531–C536 30. Wang, J., Barbry, P., Maiyar, A. C., Rozansky, D. J., Bhargava, A., Leong, M., Firestone, G. L., and Pearce, D. (2001) Am. J. Physiol. 280, F303–F313 31. Klarlund, J. K., Tsiaras, W., Holik, J. J., Chawla, A., and Czech, M. P. (2000) J. Biol. Chem. 275, 32816 –32821 32. Salim, K., Bottomley, M. J., Querfurth, E., Zvelebil, M. J., Gout, I., Scaife, R., Margolis, R. L., Gigg, R., Smith, C. I., Driscoll, P. C., Waterfield, M. D., and Panayotou, G. (1996) EMBO J. 15, 6241– 6250 33. Zheng, J., Cahill, S. M., Lemmon, M. A., Fushman, D., Schlessinger, J., and Cowburn, D. (1996) J. Mol. Biol. 255, 14 –21 34. Chalfant, M. L., Denton, J. S., Langloh, A. L., Karlson, K. H., Loffing, J., Benos, D. J., and Stanton, B. A. (1999) J. Biol. Chem. 274, 32889 –32896 35. Pochynyuk, O., Staruschenko, A., Tong, Q., Medina, J., and Stockand, J. D. (2005) J. Biol. Chem. 280, 37565–37571 36. Ma, H.-P., and Eaton, D. C. (2005) J. Am. Soc. Nephrol. 16, 3182–3187 37. Alvarez de la Rosa, D., and Canessa, C. M. (2003) Am. J. Physiol. 284, C404 –C414 38. Chen, S. Y., Bhargava, A., Mastroberardino, L., Meijer, O. C., Wang, J., Buse, P., Firestone, G. L., Verrey, F., and Pearce, D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2514 –2519 39. Helms, M. N., Fejes-Toth, G., and Naray-Fejes-Toth, A. (2003) Am. J. Physiol. 284, F480 –F487 40. Naray-Fejes-Toth, A., and Fejes-Toth, G. (2000) Kidney Int. 57, 1290 –1294 41. Naray-Fejes-Toth, A., Helms, M. N., Stokes, J. B., and Fejes-Toth, G. (2004) Mol. Cell. Endocrinol. 217, 197–202 42. Pearce, D., Verrey, F., Chen, S. Y., Mastroberardino, L., Meijer, O. C., Wang, J., and Bhargava, A. (2000) Kidney Int. 57, 1283–1289 43. Shigaev, A., Asher, C., Latter, H., Garty, H., and Reuveny, E. (2000) Am. J. Physiol. 278, F613–F619 44. Kobayashi, T., and Cohen, P. (1999) Biochem. J. 339, 319 –328 45. Park, J., Leong, M. L., Buse, P., Maiyar, A. C., Firestone, G. L., and Hemmings, B. A. (1999) EMBO J. 18, 3024 –3033

Membrane Transport, Structure, Function, and Biogenesis: Phosphatidylinositol 3,4,5-Trisphosphate Mediates Aldosterone Stimulation of Epithelial Sodium Channel (ENaC) and Interacts with γ-ENaC My N. Helms, Lian Liu, You-You Liang, Otor Al-Khalili, Alain Vandewalle, Sunil Saxena, Douglas C. Eaton and He-Ping Ma

Access the most updated version of this article at doi: 10.1074/jbc.M509646200 Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 45 references, 21 of which can be accessed free at http://www.jbc.org/content/280/49/40885.full.html#ref-list-1


J. Biol. Chem. 2005, 280:40885-40891. doi: 10.1074/jbc.M509646200 originally published online October 4, 2005