Signal sequence and DNA-mediated ... - Wiley Online Library

Eur. J. Biochem. 165,275-280 (1987) 0FEBS 1987

Signal sequence and DNA-mediated expression of human lysosomal a-galactosidase A Shoji TSUJI Brian M. MARTIN’, David C. KASLOW ’, Barbara R. MIGEON’, Prabhakara V. CHOUDARY Barbara K. STUBBLEFLIED ’,June A. MAYOR’, Gary J. MURRAY4, John A. BARRANGER’ and Edward I. GINNS’ 3,

I,

Molecular Neurogenetics Unit, Clinical Neuroscience Branch, National Institute of Mental Health, Alcohol, Drug Abuse and Mental Health Administration, Bethesda, Maryland Department of Pediatrics, Johns Hopkins University School of Medicine, Baltimore, Maryland Centers for Biotechnology and for Advanced Research in Molecular Genetics, Jawaharlal Nehru University, New Delhi Laboratory of Molecular Genetics, National Institute of Neurological and Communicative Disorders, and Stroke, National Institutes of Health, Bethesda, Maryland Division of Medical Genetics, Children’s Hospital of Los Angeles, California (Received October 27,1986/February 9,1987)

-

EJB 86 1154

Twelve complementary DNA clones for human lysosomal a-galactosidase A were isolated from an OkayamaBerg library constructed from SV40-transformed human fibroblasts. The identity of these clones was confirmed by complete colinearity of the nucleotide-deduced amino acid sequence with that determined by direct chemical sequencing of human placental a-galactosidase A. Hybridization of the a-galactosidase A cDNA to genomic DNA from individuals with varying numbers of X chromosomes as well as from interspecies somatic-cell hybrids showed only a single locus in the genome at Xq 13.1 -Xq 22. One cDNA clone (pcD-AG210) contained the complete coding sequence for both the signal peptide and mature a-galactosidase A. The signal peptide of 31 amino acids contains the expected hydrophobic domains consisting of Leu-Gly-Cys-Ala-Leu-Ala-Leuand PheLeu-Ala-Leu-Val and has Ala at the signal peptidase cleavage site. Twelve out of fifteen G residues flanking the 5’ end of the cDNA in pcD-AG210 were removed and the truncated fragment was ligated into the original vector. This construct, pcD-AG502, encoded enzymatically active human a-galactosidase A in monkey COS cells. a-Galactosidase A is a lysosomal enzyme which hydrolyzes globotriosylceramide and related glycolipids, all of which have galactose at their non-reducing end [l-41. The deficiency of this enzyme activity results in the X-linked sphingolipidosis known as Fabry’s disease. The majority of glycolipid accumulation occurs in the endothelial, perithelial, and smooth muscle cells of blood vessels, and to a lesser degree in histiocytic and reticular cells of connective tissue [4]. Partial cDNA clones for human a-galactosidase A have been reported by Calhoun et al. [5] and the nucleotide sequence has been published by Bishop et al. [6]. Although their longest clone has the nucleotide sequence encoding the entire mature enzyme, it has only part of the signal peptide which is essential for translocation of the protein across the endoplasmic reticulum. In order to understand better the molecular biology of Fabry’s disease and to investigate the usefulness of somatic cell gene therapy for this disorder, we have isolated a cDNA clone containing the complete coding sequence for both the signal peptide and the mature enzyme [7], utilizing the published nucleotide sequence of a partial cDNA clone for agalactosidase A [5]. In this paper we present the complete signal sequence and primary structure of human a-galactosidase A. Using the cDNA for a-galactosidase A as a probe Correspondence to E. I. Ginns, Molecular Neurogenetics Unit, Clinical Neuroscience Branch, Bldg. 10, Rm. 3D16, National Institute of Mental Health, Bethesda, Maryland, USA 20892 Abbreviations. DMEM, Dulbecco’s modified Eagle’s medium; NaCl/P,, phosphate-buffered saline; CNBr, cyanogen bromide. Enzymes. a-Galactosidase (EC 3.2.1.22); glucocerebrosidase (EC 3.2.1.45).

for hybridization to mouse-human somatic cell hybrid chromosomes, the locus for this enzyme is mapped to Xq 13.1Xq 22. The DNA-mediated expression of active human lysosoma1 a-galactosidase A in monkey COS cells is also demonstrated. MATERIALS AND METHODS Isolation of cDNA clones A human cDNA library [8] constructed from SV40-transformed human fibroblasts was kindly provided by Dr H. Okayama. A 48-mer oligodeoxynucleotide (S’CTGGACAATGGATTGGCAAGGACGCCTACCATGGGCTGGCTGCACTGG3’) was synthesized by the phosphoramidite method [9, 101 utilizing a nucleotide sequence from a partial cDNA clone for a-galactosidase A reported by Calhoun et al. [5]. The oligodeoxynucleotide was 5’-end-labelled by T4 polynucleotide kinase using [y-32P]ATP.This radiolabelled probe was hybridized overnight to colony lifts (8 x lo5 colonies) in 6X NaCl/Cit (1X NaCl/Cit = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) and 0.05% sodium pyrophosphate at 45°C. After hybridization, the filters were washed at 75°C in 3 M tetramethylammonium chloride [l 11. The one positive clone (pcD-AG125) contained a 1.2-kb insert but lacked the 5’ end of the signal sequence. The insert from pcD-AG125 was isolated after BamHI and PstI digestion of the plasmid and truncated by Ba131 to remove the flanking vector sequences. This truncated insert was used as a nick-translated hybridization probe for subsequent screening of the Okayama-Berg library to obtain longer cDNA inserts for human a-

276 QCD-A6202 PCO-AG204 pC0-AG206 pCD-AG209 pcD-AG212 PCD-AG213 pc0-AG214 pc0-AG215 PcD-AG218 PcD-AG219 pcD-AGl2S pcD-AG2lO

SSCI

KpnI

3'

-

200

I

*

600

400 r

I

800

c

-

c

1000

*

1200

c

I

c -

I

I

Fig. 1. Restriction rnup und strategy f o r sequencing a-gulactosidase A clones. The scale is base pairs and begins with the first nucleotide of the pcD-AG210 insert. The solid box indicates the sequence coding for mature a-galactosidase A. The open box indicates the sequence coding for the signal peptidc. The sequencing strategies are shown below the restriction map. DNA sequencing was done using denatured doublestranded templates of either restriction fragments or Bal31-generated deletion fragments in pUC19 [13 - 161. Arrows indicate the direction and the extent of each sequence determination

galactosidase A. Eleven clones were purified from the screening of 3.9 x lo6 additional colonies. One clone (pcDAG210), having the longest insert, was used for DNA sequence analysis and transient expression studies. Analysis of nuclootide sequence

Nucleotide sequences were determined using the inserts of pcD-AG125 and pcD-AG210 clones. pUCl9 subclones having deletions of various lengths were generated by Ba131 using the method of Yoshitake et al. [12]. The nucleotide sequence was analyzed by the dideoxynucleotide chain terminator method [13- 161 using double-stranded plasmid DNA as the template. In regions where ambiguity existed in reading sequences obtained by this technique, the sequence was confirmed by the method of Maxam and Gilbert [17]. Purification und direct chemical sequencing of a-galactosidusr A

Human placental a-galactosidase A was prepared as described by Kusiak et al. [18] with minor modifications [19]. aGalactosidase A was reduced with dithiothreitol and alkylated with 4-vinyl pyridine. Pyridylethyl-a-galactosidase A was digested with trypsin or cleaved with CNBr. A Beckman model 344 HPLC equipped with a Brownlee Labs Aquapore RP 300, 10-pm reverse-phase column was used to separate the tryptic peptides using a gradient of 10-90% acetonitrile employing 0.1 YOtrifluoroacetic acid as the pairing ion. CNBrgenerated peptides were separated by either SDS-PAGE or chromatography on Bio-Gel P30. A Beckman 890M liquidphase sequencer or an Applied Biosystems model 470A gasphase sequencer was used for amino acid sequence analysis. Gene dosage study

Total cellular DNA was prepared from lymphoblasts of individuals with one, two and four X chromomes and from somatic cell hybrids derived from fusing mouse A9 cells and human cells carrying balanced X autosome translocations and

containing an intact human X or partial segments of the human X chromosome [20- 221. The DNA was digested with restriction endonucleases, size-fractionated on 0.9% agarose gels and transferred to nylon filters. The filters were hybridized (D. C. Kaslow, unpublished) with a 32P-labelledinsert of pcD-AG125 [23], washed at 0.1 -0.5 x NaCl/Cit at 65"C, and autoradiographed for 1 - 14 days. Transient expression of a-galactosidase A in COS cells

Plasmid DNA used for transfection was prepared by standard protocols [24]. COS cells were plated 24 h before transfection at 1 x lo5 cells per 75 cm2 in Dulbecco's modified Eagle's medium (DMEM) supplemented with 17% fetal calf serum. After washing the cells with phosphate-buffered saline (NaC1/Pi), 5 ml of DMEM containing supercoiled plasmid DNA (3 pg/ml) complexed to DEAE-dextran (200 pg/ml) was added [25]; 4 h after transfection, the incubation solution was replaced with 20 ml of DMEM supplemented with 17% fetal calf serum. Cells were harvested 48 h and 72 h after the transfection. Measurement of a-galactosidase A activity

a-Galactosidase A activity was measured using 4-methylumbelliferyl a-D-galactopyranoside as substrate [26]. Analysis of proteins by immunoblotting

The COS cell extracts were electrophoretically fractionated in 12.5% polyacrylamide gels transferred to nitrocellulose membranes. The nitrocellulose blot was incubated with rabbit anti-(human a-galactosidase A) serum [18], detected by '251-labelled protein A, and autoradiographed as previously described [26]. RESULTS AND DISCUSSION The insert lengths of all 12 clones, the sequencing strategy, and the relevant restriction sites of the human a-galactosidase

211 MT6CT6TCC66TCACC6T6ACA AT6 CA6 C T 6 A66 AAC CCA 6AA CTA CAT C T 6 6 6 C T 6 C 6 C 6 C T T 6 C 6 CTT C 6 C T T C C T 6 6CC CTC 611 TCC Met 61n Leu Arg Aan ~ r 6o 1 LEU ~ H l a Leu 61y Cys A l e LEU Ale Leu Arg Phe Leu A l e Leu V a l Sar -30 -20 -10

I

92

T66 6AC ATC CCT 666 6 C T A6A BCA C T 6 6AC AAT 66A TT6 6CA A 6 6 AC6 CCT ACC AT6 6 6 C 166 C T 6 CAC 166 6 A 6 C 6 C T T C AT6 T 6 C AAC Trp Aap 110 P r o 61y ~ 1 Aer g ~ 1 ~e e u Aep Aan 61y Leo A h A r g mr Pro mr h t 61y T r p Leu Hla T r p 61u A r g Phe M a t C y 5 Aan -1 1 10 20

182

CTT 6AC T6C CAB 6AA 6A6 CCA 6AT TCC T 6 C ATC A 6 1 6A6 AA6 CTC T I C AT6 6 A 6 AT6 6CA 6A6 CTC AT6 6 T C TCA 6AA 6 6 C 166 AA6 6AT Aap Cya 61n 61u 61u P r o Asp Sar Cya 110 Ssr 6111 Ly5 Leu Phe Met 61u Met A h 6111 Leu M t V a l S a r 61u 61y T r p Lya ADP 30 40 50

272

6CA 661 TAT 616 TAC CTC T 6 C A T T 6AT 6AC 161 166 AT6 6 C T CCC C M A6A 6AT TCA 6AA 6 6 C ABA CTT CA6 6CA 6AC CCT CA6 C6C TTT ~ 1 61y e Tyr 61u Tyr Leu c y a I 1 e u p Aap C y a Trp Met A l e P r o 61n Arg Aap Sar 61u 61y A r g Leu 61n A l e Aap P r o 61n A r g Phe 60 70 80

362

CCT CAT 666 A T 1 C6C CA6 CTA 6 C T M T TAT 611 CAC A6C M A 66A C T 6 AA6 CTA 666 A T T TAT GCA 6AT 6lT 661. AAT AAA ACC T 6 C 6CA RO H i s 61y 110 A r g 61n Leu A l e Aen Tyr V a l H l a Ser Lys 61y Leu L y e Leu 61y 110 T y r A l e Aap V a l 61y ADn Lys mr C y a A l e 90 100 110

452

6 6 C TTC CCT 666 A 6 1 TTT 664, TAC TAC 6AC AT1 6AT 6CC CA6 ACC TTT 6 C T 6AC 166 6 6 A 6TA 6AT C T 6 CTA M A TTT 6AT 661 161 TAC 61y Phe Pro 61y Ser Phe 6 1 y Tyr Tyr Asp I l e Aap A l e 61n Thr Phe A 1 8 Aap T r p 61y V a l Aap Leu Leu Lya Phe Aap 61y C y a T y r 120 130 140

542

161 6AC A 6 1 TT6 6AA AAT TT6 6CA 6AT 661 TAT AA6 CAC AT6 TCC TT6 6CC C T 6 AAT A 6 6 ACT 6 6 C A6A A6C AT1 616 TAC TCC 161 6 A 6 9 s Aap Ser Leu 61u Aan Leu A l s Aap 61y Tyr Lys H l a Met Ser Leu A l a Leu A n Arg Thr 6 l y Arg Sar 11. V a l T y r Sar C y a 61u 150 160 170

632

166 CCT CTT TAT AT6 166 CCC TTT CAA AA6 CCC AAT TAT ACA 6AA ATC C6A CA6 TAC TBC AAT CAC 166 C6A M T TTT BCT 6 A C AT1 6AT Trp P r o LOU Tyr Met Trp P r o Phe 61n Lya P r o Aan T y r mr 61u 110 A r g 61n T y r C y s Aan Mla Trp Arg Aen Phe A l e Asp I10 Aap 180 190 200

722

6AT TCC 166 AAA A 6 1 ATA AA6 A 6 1 ATC TT6 6AC T66 ACA T C T TTT AAC CA6 6 A 6 A6A A T T 6lT 6AT 6TT 6 C T 6 6 A CCA 666 661 166 M T Aap Sar Trp Lya Sar 110 Lya Sar 110 Leu Aap Trp mr Sar Phe Asn 61n 61u *Pp 11. V a l ADP V a l A l e 61y P r o 61y 61y Trp Aan 210 220 230

612

6AC CCA 6AT AT6 T f A 616 A T T 6 6 C AAC TTT 6 6 C CTC A6C 166 AAT CA6 CAA 6TA ACT CA6 A 1 6 6 C C CTC 166 6 C T ATC A 1 6 6 C T 6 C T CCT Aap Pro Amp M t Leu V a l I l e 61y Aan Phe 6 1 Leu ~ Ser TrD A m 61n 61n V a l mr 61n I(.t A l e Leu T r p ~ 1 1 e1. ht ~ i ~e i per o

902

LEU

+

4

+

240

250

260

T T A TTC AT6 TCT AAT 6AC CTC C6A CAC ATC A6C CCT CU 6CC *I* 6 C T CTC C T T CA6 6AT M 6 6 A C 6 T A A T T 6 C C ATC M T C A 6 6AC CCC 992 Leu Phe M t Ssr Aen Asp Leu A r g H l a 11. Ser P r o 61n A l a Lya A h Leu Leu 61n Aap Lya Aap V a l I10 A l e 1 1. Aan 61n Asp RQ 270

260

290

116 6 6 C AA6 CAA 666 TAC CA6 C T T A6A CA6 66A 6AC AAC TTT 6AA 616 T66 6AA C6A CCT CTC TCA 6 6 C T T A 6 C C 166 6 C T 6TA 6 C T AT6 1082 Lya 61n 61y T y r 61n Leu A r g 61n 61y ADP A m Phe 61u V a l T r p 610 Arg P r o Leu Ser 61y Leu A l e Trp ~ i Vea l ~ i Met e 300 310 320

L ~ U 61Y

ATA AAC C 6 6 CA6 6A6 A T T 661 66A CCT C6C TCT TAT ACC ATC 6CA 611 6 C T TCC C T 6 661 *I* 66A 6T6 6 C C 161 AAT CCT 6CC T 6 C T T C 1172 11. Aan Arg 61n 610 I l e 61y 61y P r o Arg S a r Tyr mr 11. Ale V a l A i m Sat- Leu 61y Lya 61y V a l A l e C y a A m P r o A l e C y a P ~ D

330

350

340

ATC ACA CA6 CTC CTC CCT 616 A M A66 A A 6 C I A 666 T T C TAT 6AA 166 ACT TCA A 6 6 TTA A6A A 6 1 CAC ATA AAT CCC ACA 6 6 C ACT 6TT 1262 11. Thr 61n L ~ ULeu Pro V a l LYDA r g Lya ~ e 61y u Phe T y r 61u T r p mr Ser Arg Leu A r g S.r H l a 110 A m Pro mr 61y Thr Val 360 370 3110

+

TT6 C T T CA6 CTA 6 A A l * r T ] AT6 CA6 AT6 T a r & 6AC TTA C T T Leu Leu 61n Leu 61u Aan Thr Mat 61n Met Ser Leu Lya Aap Leu Leu

TAA AATGTTAAAAAAAW

--

390

Fig. 2. Nucleotide sequence of human a-galactosidase A cDNA and the deduced amino acid sequence. The signal peptidase cleavage site is shown by the arrow. Potential N-linked glycosylation sites are shown by solid diamonds. Putative polyadenylation signals are boxed. Amino acid sequence determined by direct chemical sequencing of tryptic peptides or cyanogen-bromide-generated peptides are underlined

A cDNA are shown in Fig. 1. Of the 12 clones, pcD-AG210 and pcD-AG125 have the longest inserts (1.3 kb and 1.2 kb, respectively). Systematic deletions from either end of these inserts were generated by Bd31 digestion and the truncated inserts were subcloned into pUC19. Overlapping cDNA fragments from both strands were sequenced.

The complete nucleotide sequence of the cDNA is shown in Fig.2 and contains only one open reading frame adequate to encode human a-galactosidase A. Beginning with the first ATG at position 24 and terminated by TAA at position 1311, this reading frame codes for 429 amino acids. In this open reading frame, an adenine occurs three residues before the

278 Table 1. 3’-Nucleotide sequence of 12 human a-galactosidase A cDNA clones In the sequence the in-frame termination codon (TAA) is underlined Clones pcD-AGx x = x =

3‘ Sequence

210.202, 204. 213,214, 215

TTACTTTAAAAAAAAAAA.. .

125,201,203, 205,206. 2 17

TTACTTTAAAATGTTAAA.. . __

~~

ATG codon, and a pyrimidine follows the ATG, one of the most common functional initiator codon patterns in eukaryotic mRNA [27]. Although there is another ATG 22 nucleotides upstream of the functional ATG, it is followed by an in-frame terminator codon at position 110. As shown in Table 1, all 12 cDNA clones have a very short 3’ untranslated sequence and lack the consensus polyadenylation signal (AATAAA). Two non-consensus polyadenylation signals [28, 291, ATTAAA and AATACA, are located 16 and 33 nucleotides, respectively, upstream of the termination codon. Similar findings have been reported on partial cDNA clones obtained from two other cDNA libraries [5, 61. Interestingly, these two polyadenylation sequences were within the coding region and if either were functional, the 3’ untranslated sequences would be very short. The length of 5‘ or 3’ untranslated sequence cannot be greater than 130 bp, because the size of mRNA for human a-galactosidase A is 1.45 kb [6] (S. Tsuji, unpublished). Although there is the possibility that mRNA for x-galactosidase A may have a longer 3’ untranslated end separated from the termination codon (at 1311) by a poly(A) stretch, the above results suggest that the short 3’ untranslated region is not the result of such a cloning artifact. Recently mouse thymidylate synthase mRNA was reported to lack a 3’ untranslated region [30]. Sequencing of genomic DNA demonstrated that the mouse thymidylate synthase gene does not have a poly(dA) stretch, suggesting that the poly(dA) stretch in cDNA was the result of a posttranscriptional addition. Sequencing of the a-galactosidase A gene will elucidate whether the poly(dA) stretch in the cDNA clones is also the result of a post-transcriptional addition. The amino acid sequence deduced from the nucleotide sequence as well as chemically determined amino acid sequences (underlined in Fig.2) of human placental agalactosidase A are presented in Fig.2. The sequence of nucleotides 100- 1315 is identical to that of a partial cDNA clone for a-galactosidase A reported by Bishop et al. [6]. The amino acid sequence of seven tryptic peptides and two cyanogen bromide fragments from human placental agalactosidase A was identical to that encoded by human agalactosidase A cDNA from human fibroblasts. In the amino acid sequence, four potential N-linked glycosylation sites were identified (Fig.2). The amino acid sequence of the amino terminus of human placental a-galactosidase A determined by direct chemical sequencing is Leu-Asp-Asn-Gly-Leu-AlaArg-Thr-. This result indicates that the reading frame of the cDNA codes for a 31-amino-acid signal peptide and for 398 amino acids in the mature enzyme. This signal peptide contains hydrophobic domains consisting of Leu-Gly-CysAla-Leu-Ala-Leu and Phe-Leu-Ala-Leu-Val, and as shown in Fig. 3, this segment constitutes one of the most hydrophobic regions of a-galactosidase A. This signal peptide has the following necessary characteristics: (a) there is a positively

-41

’

1

I

I

100

200

300

Fig. 3. Hydropathy plot of human a-galactosidase A . The hydropathy indices of nine consecutive amino acids were calculated

charged Arg preceding the hydrophobic domains; (b) there is a signal peptidase recognition sequence (Ala-Xaa-Ala) at the peptidase cleavage site; and (c) the secondary-structure disrupting residues Gly and Pro are found in positions - 4 and - 5, respectively. All these features are consistent with those reported for signal peptides of other translocated proteins 131 - 331, including those of other lysosomal hydrolases [34 361. Based on expression of human a-galactosidase A activity in human-hamster somatic cell hybrids, the locus for human a-galactosidase A has been mapped to Xq 21 -Xq 22 [20]. Using the cDNA insert of pcD-AG125 as probe, we localized all the homologous sequences in human genomic DNA to the X chromosome. The expected dosage effect was present for each hybridizing fragment in BumHI-, HindIII- or EcoRIdigested DNA from individuals with one, two and four X chromosomes (Fig. 4 shows the EcoRI digest). Furthermore, when the probe was hybridized to mouse-human hybrid cells, the hybridizing sequences were mapped to the human Xq 13.1-Xq 22, consistent with the previous assignment based on enzyme activity [20]. Using the cDNA clone, pcD-AG2 10, that contains the sequence coding for both the signal peptide and mature enzyme, we investigated the cDNA-mediated expression of human a-galactosidase A activity. Because the cDNA was originally isolated in the pcD shuttle vector having an SV40 early promoter, we first tried to obtain transient expression in COS cells by transfection with the plasmid (pcD-AG210) DNA. We did not detect a significant increase of enzyme activity above that of the host cells. Because the 5‘ untranslated sequence of the cDNA is very short, we thought that the oligo(G-C) sequence of the vector that was close to the initiator ATG in pcD-AG210 might be preventing the efficient transcription of the cDNA insert. By BaZ31 digestion we removed 12 of the 15 G residues upstream to the cDNA and then the truncated fragment was religated into the original vector at the 5’ PstI site (pcD-AG502) (Fig.5). The cDNA insert of pcD-AG502 was also placed into another expression vector, pSVL, having an SV40 late promoter [37], giving the construct pSVL-AG502. COS cells were transfected with plasmid DNA (pcD-AG502 and pSVL-AG502) using the DEAE-dextran method. As a control, COS cells were also transfected with pcD-GC8 having a full-length cDNA coding for active human lysosomal glucocerebrosidase [38, 391. Only

279

* I 2 3

A

*v

q

__

4 5 6 7 8 9 1 0 1112

l

y promoter

SV40 o r l

kb 26-

7.06.0

-

*

B P

v

Fig. 5. Schematic representation of pcD-AGSOZ. The 5' oligo(G-C) sequence in pcD-AG210 was deleted by digestion with Bal31. After a PstI linker was attached, the modified fragment was reinserted into the larger fragment of KpnI and partially Pst I-digested pcD-AG210. 12 of the 15 G residues were removed

q13.I-qter

Table 2. Human a-galactosidase A activity in COS cells 48 h after transfection Values are mean SEM (n = 3)

13.11

q

X SEGMENT PRESENT q 2 2 - q t e r

a

G A L A SIGNAL

-

+

Fig.4. Localization of a-galactosidase A D N A on human X chromosome. (A) Autoradiogram of Southern blot showing X linkage of sequences homologous to human a-galactosidase A cDNA and regional localization on the human X chromosome. DNA was digested with EcoRI, fractionated on 0.9% agarose and transferred to nylon filters. The filters were hybridized overnight with 32P-labelled insert of pcD-AG125, and washed in 0.5 x NaCl/Cit (lanes 1-7) or in 0.1 xNaCl/Cit (lanes 8-12) at 65°C. Lanes: 1, 48 XXXX lymphoblasts; 2 and 9, 46 XX placenta; 3 and 8, 46 XY placenta; 4, hybrid with one X human chromosome; 5, hybrid with two human X chromosomes; 7, A9 mouse cells (parental cells); 6 and 10, hybrid with Xq 22-Xqter [21]; 11, hybrid containing Xq13.1-Xqter 120, 221; 12, same hybrid as in lane 11 but back-selected in 6-thioguanine to lose relevant X segment [22]. (B) Schematic diagram showing localization of DNA homologous to probe pcD-AG125 between Xq 13.1 and Xq 22. The human X chromosome segment present in selected somatic cell hybrids is shown by the asterisk (in lanes 6 and 10) and triangle (in lane 11)

pcD-AG502 showed a significant (40% increase) increase in a-galactosidase A activity 48 h after transfection (Table 2). The enzyme activity was decreased to background levels 72 h after transfection. Transfection with pSVL-AG502 did not result in any significant increase in a-galactosidase A activity at either 48 h or 72 h. Western blots of extracts of cells transfected with pcDAG502 or pSVL-AG502 (Fig. 6) showed cross-reacting material to human a-galactosidase A of 48 kDa and 47.6 kDa, but the signals from pcD-AG502 cell extracts were more intense than those from pSVL-AG502 transfected cells. The COS cells having a significant increase of a-galactosidase A activity 48 h after transfection with pcD-AG502 have a prominent band of cross-reacting material of 48 kDa, while at 72 h, a prominent band of 47.6 kDa was present. The decrease in apparent molecular mass of the cross-reacting material is probably due to

DNA

Enzyme activity

None pSVL pcD-GC8 pcD-AG502 pSVL-AG502

nmol h-' (mg protein)-' 452.0 27.3 544.5 5 95.0 514.3 & 68.2 755.5 129.5" 540.3 & 58.5

a

Significant at P < 0.02.

i

67

-

43

-

94

2

3

4

5

6

7

8

9 10

Fig.6. Western blot of human a-galactosidase A in COS cells after transfection with plasmid DNA. Lanes 1 - 5, 48 h; lanes 6 - 10, 72 h. Lanes 1 and 10, no DNA; lanes 2 and 9, pSVL; lanes 3 and 8, pcDGC8; lanes 4 and 7, pSVL-AG502; amd lanes 5 and 6, pcD-AG502. Number on left indicate molecular mass in kDa

280 Table 3. Human p-glucosidase activities 48 h after transfection Values are mean & SEM (n = 3) DNA

fi-Glucosidase activity

None pSVL pcD-GC8 pcD-AG502 pSVL-AG502

nmol h-' (mg protein)-' 113.0f 4.0 119.0 k 7.2 513.0 k 62.2 a 123.7 f 10.6 117.3 If: 8.7

a

Significant at P < 0.001.

post-translational processing (and/or degradation) and may account for the reduction in human a-galactosidase A enzyme activity by 72 h. Despite the lack of human a-galactosidase A activity at 72 h, the COS cells transfected with the 'control' construct (pcD-GC8) containing a full-length cDNA for glucocerebrosidase had the expected increase in human glucocerebrosidase activity at both 48 h and 72 h (Table 3), [38, 391. Although the duration and magnitude of expression of human a-galactosidase A activity in monkey COS cells is less dramatic than that seen for glucocerebrosidase (Table 3), [38, 391, the results presented here indicate that the cDNA insert of pcD-AG210 does have the necessary nucleotide sequence for expression of the human enzyme activity in heterologous host cell lines. The availability of this cDNA encoding active human a-galactosidase A should enable us to approach somatic cell gene transfer experiments using Fabry's disease cell lines. We acknowledge the technical assistance of Ms Suzanne L. Winfield, Ms Mary E. LaMarca and Mr George Mook. This study was supported in part by grants-in-aid (HD05465) from the National Institute of Child Health and Human Development.

REFERENCES 1. Brady, R. O., Gal, A. E.. Bradley, R. M. & Mirtensson, E. (1967) J . Biol. ('hem. 242, 1021 - 1026. 2. Brady, R . 0.. Gal, A. E., Bradley, R. M., Mirtensson, E., Warshaw. A. L. & Laster, L. (1967) New Engl. J. Med. 276, 1163- 1167. 3. Kint, J. A. (1970) Science (Wash. D C ) 167, 1268-1269. 4. Desnick, R. J. & Sweeley, C. C. (1983) in The metabolic basis of inherited diseases, 5th edn (Stanbury, J. S., Wyngaarden, J. S., Fredrickson, D. S., Goldstein, J. L. & Brown, M. S., eds) pp. 906 - 944, MacGraw-Hill, New York. 5. Calhoun, D. H., Bishop, D. F., Bernstein, H. S., Quinn, M., Hantzopoulos, P. & Desnick, R. J. (1985) Proc. Nut1 Acad. Sci. USA 82, 7364- 7368. 6. Bishop, D. F., Calhoun, D. H., Bernstein, H. S., Hantzopoulos, P., Quinn, M. & Desnick, R. J. (1986) Proc. Natl Acad. Sci. USA 83,4859 -4863. 7. Tsuji, S., Martin, B. M., Choudary, P. V., Stubblefield, B., Mayor, J., Merkle-Lehman, D., Murray, G. J., Barranger, J. A. & Ginns, E. I . (1986) Fed. Proc. 45, 1621.

8. Okayama, H. & Berg, P. (1983) Mol. Cell. Biol. 3, 280-289. 9. Beaucage, S. L. & Caruthers, M. H. (1981) Tetrahedron Lett. 22, 1859- 1862. 10. Matteucci, M. D. & Caruthers, M. H. (1981) J . Am. Chem. SOC. 103, 3185-3189. 11. Wood, W. I., Gitschier, J., Lasky, L. A. & Lawn, R. M. (1985) Proc. Nut1 Acad. Sci. USA 82, 1585- 1588. 12. Yoshitake, S., Schach, B. G., Foster, D. C., Davie, E. W. & Kurachi, K. (1985) Biochemistry 24, 3736- 3750. 13. Sanger, F., Nicklen, S. & Coulson, A. R . (1977) Proc. Nut1 Acad. Sci. USA 74, 5463 - 5467. 14. Biggin, M. D., Gibson, T. J. & Hong, G. F. (1983) Proc. Natl Acad. Sci. USA 80,3963 - 3965. 15. Chen, E. Y. & Seeburg, P. H. (1985) DNA 4, 165-170. 16. Mizusawa, S., Nishimura, S. & Seela, F. (1986) Nucleic Acids Res. 14,1319-1324. 17. Maxam, A. M. &Gilbert, W. (1980) Methods Enzymol. 65,499560. 18. Kusiak, J. W., Quirk, J. M. & Brady, R. 0. (1978) J . Biol. Chem. 253,184-190. 19. Murray, G. J., Martin, B. M., Ginns, E. I., Zirzow, G. C., Brady, R. 0. & Barranger, J. A. (1984) Fed. Proc. 43, 1869. 20. Fox, M. F., DuToit, D. L., Warnich, L. & Retief, A. E. (1984) Cytogenet. Cell Genet. 38, 45-49. 21. Carpenter, N. J., Say, B. & Browning, D. (1980) J . Med. Genet. 17, 226-221. 22. Pai, G . S., Sprenkle, J. A,, Do, T. T., Mareni, C. E. & Migeon, B. R. (1980) Proc. Natl Acad. Sci. USA 77,2810-2813. 23. Feinberg, A. P. & Vogelstein, B. (1983) Nature (Lond.) 301,8992. 24. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 25. McCutchan, J. H. & Pagano, J. S. (1968) J . Natl Cancer Inst. 41, 351 -357. 26. Ginns, E. I., Brady, R. O., Pirruccello, S., Moore, C., Sorrell, S., Furbish, F. S., Murray, G. J., Tager, J. & Barranger, J. A. (1982) Proc. Natl Acad. Sci. USA 79, 5607- 5610. 27. Kozak, M. (1983) Microbiol. Rev. 47, 1-45. 28. Mason, P. J., Jones, M. B., Elkington, J. A. & Williams, J. G. (1985) EMBO J. 4,205-211. 29. Wickens, M. & Stephenson, P. (1984) Science (Wash. DC) 226, 1045- 1051. 30. Jenh, C.-H., Deng, T., Li, D., DeWille, J. &Johnson, L. F. (1986) Proc. Natl Acad. Sci. U S A 83,8482 - 8486. 31. Perlman, D. & Halvorson, H. 0. (1983) J . Mol. Biol. 167, 391 409. 32. von Heijne, G. (1983) Eur. J. Biochem. 133, 17-21. 33. Watson, M. E. E. (1984) Nucleic Acids Res. 12, 5145-5164. 34. Myerowitz, R., Piekarz, R., Neufeld, E. F., Shows, T. B. & Suzuki, K. (1985) Proc. Natl Acad. Sci. USA 82,7830-7834. 35. Faust, P. L., Kornfeld, S. & Chirgwin, J. M. (1985) Proc. Natl Acad. Sci. USA 82,4910-4914. 36. Tsuji, S., Choudary, P. V., Martin, B. M., Winfield, S., Barranger, J. A. & Ginns, E. I. (1986) J. B i d . Chem. 261, 50-53. 37. Sprague, J., Condra, J. H., Arnheiter, H. & Lazzarini, R. A. (1983) J. Virol. 45, 773-781. 38. Choudary, P. V., Horowitz, M., Barranger, J. A. & Ginns, E. I. (1986) DNA 5 , 78. 39. Choudary, P. V., Tsuji, S., Martin, B., Guild, B. C., Mulligan, R. C., Murray, G. J., Barranger, J. A. & Ginns, E. I. (1986) Cold Spring Harbor Symp. Quant. Biol51 (2), 1047- 1052.