The DNASeqEx Project: Exploring STR Sequencing ...

The DNASeqEx Project: Exploring STR Sequencing and Global Exchange Petra Müller 1, Antonio Alonso 2, Pedro A. Barrio 2, Burkhard Berger 1, Martin Bodner 1, Pablo Martin 2, The DNASEQEX Consortium, Walther Parson 1,3 1Institute

of Legal Medicine, Medical University of Innsbruck, Austria 2National Institute of Toxicology and Forensic Sciences, Madrid Department, Las Rozas de Madrid, Spain 3Forensic Science Program, Penn State University, PA, USA

DNASeqEx - DNA-STR Massive Sequencing & International Information Exchange EU funded 2 years (2016-2018)

Beneficiaries: The Biology Service of the National Institute of Toxicology and Forensic Science, Madrid, Spain Antonio Alonso, Pablo Martin, Pedro A. Barrio Department of Forensic Genetics of the Institute of Legal Medicine and Forensics Science, Berlin, Germany Lutz Roewer, Sascha Willuweit, Steffi Köcher

Institute of Legal Medicine, Medical University of Innsbruck, Austria Walther Parson, Petra Müller, Burkhard Berger, Martin Bodner

Non-Beneficiary: Institute of Applied Genetics at the University of North Texas Health Science Center, Texas, USA Bruce Budowle

Objectives Promote the implementation of MPS technology for improved STR profiling and international data exchange → Inter-laboratory evaluation study

Evaluate the impact of STR sequencing on National DNA databases (EU Prüm, CODIS) → Alonso et al., 2017, FSI Genetics Facilitate and standardize forensic STR sequence allele nomenclature → NOMAUT - lead Berlin (pending)

Madrid

Berlin

Consortium Manager

Bruce Budowle (Consortium Consultant)

Innsbruck

Evaluated MPS-Kits Kit Early Access Applied Biosystems Precision ID Globalfiler Mixture ID™ Panel Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panel for the Ion S5™

Supplier

Laboratory

TFS

Madrid, Innsbruck

TFS

Madrid, Innsbruck

PowerSeq aSTR/mito Kit

Promega

Innsbruck

PowerSeq 46GY Kit

Promega

Innsbruck, Berlin

ForenSeq DNA Signature Prep Kit

Verogen

Innsbruck, Berlin

NGS Prototype

Qiagen

Innsbruck, Berlin

Addressed Studies Concordance (NIST SRM 2391c A–F) Reproducibility (GEDNAP persons) Sensitivity testing (2800M, NIST SRM 2372 A) ♂:♀ Mixtures (ratios: 1:1, 1:5, 1:10, 1:15, 1:20) ♂:♂ Mixtures (1:1, 1:5, 1:10, 1:15, 1:20) Extreme Mixtures ♀:♂ (1:100, 1:500, 1:1000) Mock Casework (GEDNAP stains, GHEP-ISFG) Population Study (Spain/Austria/Germany)

Madrid

Berlin

Concordance Sensitivity Reproducibility Casework

Additional Testing Qiagen Promega aSTR/mito Promega aSTR/Y-STRs

Concordance Sensitivity Reproducibility Mixtures

SEQforSTRs

Innsbruck

Inter-Laboratory Evaluation Study

Interlocus balance Stutter analysis

Madrid (INTCF)

Sensitivity

EA Applied Biosystems Precision ID Globalfiler Mixture IDTM & Globalfiler NGS STR Panels for the Ion S5TM

Innsbruck (GMI)

General Overview Early Access Applied Biosystems Precision ID Globalfiler Mixture ID™

Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panels for the Ion S5™

113 markers 29 aSTRs, 1 Y-STR, 42 SNPs, 2 Y-SNPs, 36 micro-haplotypes, Amelogenin and Y-InDel (rs2032678)

33 markers 29 aSTRs, 1 Y-STR, Amelogenin and Y-InDel (rs2032678)

2 D 1S10 S1 45 A M6 7 7 D1 9 EL D YS 4 3 Y D S 3 D 1 3S4 391 0S 52 12 9 4 D4 F 8 G D 2S24 A S1 08 D 1 D 1 83 3 8 2 S D 1A T A 5 1 D1 3S 63 4S 31 7 D 21 4 3 4 D2 1S D 1S17 11 2S 76 39 1 v D2 W D 5 S4 A S 41 D 72 8 0 D 3 S8 0 S 20 CS135 8 D 5F 1 P O S8 D 8 TP18 D 1S11 O X S 79 D 61 6 5 D 6 S4 6 S1 74 A M0 4 3 D1 6S ELX 53 TH 9 01

D2

R e la t iv e m a r k e r c o v e r a g e ( % ) 150

100

50

0

% h ig h e r

250

% lo w e r

Interlocus Balance

Globalfiler Mixture ID™ Panel GMI INTCF

200

Interlocus balance varies from 4.7 % (D22S1045) to 241.4 % (TH01) compared to the calculated expected value (100 %)

e x p e c te d v a lu e

Müller et al., manuscript in preparation

2S 10

45 D1 FG 8 A D Y S5 S 1 A M3 9 1 E D 1 v WL Y D 49S4 A S2 33 D2 40 D3 1S 8 1 D 1S45 1 2 D 23S3 9 D 1 S1 17 0S 33 12 8 D1 D7S 48 2A 82 D5 TA 0 6 D 1S28 3 0 S1 0 D6 67 S4 7 D 1D 5 S 7 4 4S 81 1 8 CS 43 D1 F1 4 P D 1S16 O 5 D 62S3 6 S1 91 D2 04 D 3 S4 3 S1 41 35 D8 TP 8 O D 1S11 X 7 6S 9 A M5 3 9 E TH LX 01

D2

R e la t iv e m a r k e r c o v e r a g e ( % ) 50

% lo w e r

150

% h ig h e r

Interlocus Balance

Globalfiler NGS STR Panel™ 250

GMI INTCF

200

100

0

Interlocus balance varies from 22.3 % (D22S1045) to 182.7 % (TH01) compared to the calculated expected value (100 %)

e x p e c te d v a lu e

Müller et al., manuscript in preparation

TH D TP 01 5 D S2 O X 3 8 D S4 00 4S 5 2 D 24 9 2 0 D S4 8 Y 4 D S3 1 D 7S 91 2S 8 2 C 17 0 S 7 D F1P 6 D 6S O 13 4 7 D S3 4 D 5S 17 1 8 D 6S 18 D 6S 53 14 1 9 S104 4 3 D F 34 8S G D 11 A 1 7 D 8S 9 D 21 51 3 S D S1 11 1 3 D S1 58 2 6 D S1 56 1S 3 1638 D 10 v 77 W D S1 A D 19 24 12 S 8 4 D AT 33 D 12 A6 22 S 3 S139 041 5

R e la t iv e s t u t t e r h e ig h t (% )

Stutter Analysis

Globalfiler Mixture ID™ Panel 100

60

40

GMI INTCF

Stutter ratios range from 6.5 % (TH01) to 24.1 % (D22S1045)

80

Dataset includes single person samples (1 ng DNA input), homo- and heterozygous genotypes as well as isometric allele calls.

20

0

Müller et al., manuscript in preparation

D TH 4 D S2 01 5 4 D S2 08 3S 80 45 0 T 2 D PO 9 2 D S4 X 6 4 D S4 1 D YS 74 13 39 C S3 1 S 1 D F1P 7 D 7S O 6 8 D S1 20 1 0 D 6S 43 D 8S 53 14 11 9 S 7 D 14 9 D 21 34 1S S1 D 16 1 D 5S 77 D 3S 81 10 13 8 S1 58 2 D v 48 1 W D 9S A 2 4 D S1 33 1 3 D S1 38 12 65 S 6 D D1 39 2 8 1 D 2S S5 12 1 1 A 04 TA 5 6 FG 3 A

R e la t iv e s t u t t e r h e ig h t (% )

Stutter Analysis

Globalfiler NGS STR Panel™ 100

60

40

GMI INTCF

Stutter ratios range from 5.6 % (TH01) to 18.9 % (D12ATA63)

80

Dataset includes single person samples (1 ng DNA input), homo- and heterozygous genotypes as well as isometric allele calls.

20

0

Müller et al., manuscript in preparation

Sensitivity Study 24 PCR cycles, NIST 2372A run in duplicate using Globalfiler NGS STR Panel™

T o ta l N u m b e r o f R e a d s

6 0 ,0 0 0

Standard PCR conditions display the expected decrease in reads/marker relative to DNA input

4 0 ,0 0 0 *

2 0 ,0 0 0

0 500 pg

250 pg

125 pg

G e n o m ic D N A in p u t / a s s a y (p g )

62 pg

Müller et al., manuscript in preparation

Sensitivity Study 28 PCR cycles, NIST 2372A run in duplicate using Globalfiler NGS STR Panel™

T o ta l N u m b e r o f R e a d s

6 0 ,0 0 0

Changed cycling conditions affect marker balance

4 0 ,0 0 0

*

2 0 ,0 0 0

0 125 pg

62 pg

31 pg

G e n o m ic D N A in p u t / a s s a y (p g )

15 pg

Müller et al., manuscript in preparation

GEDNAP 44_S1: Discordance between CE & MPS

14

15

14

15

CE result (GF-PCR kit) D19S433 13.2, 15

Globalfiler Mixture ID™

Globalfiler NGS STR Panel™

GEDNAP 44_S1 CAGGTGGTGTTGGTTACATGAATAAGTTCTTTAGCAGTGATTTCTGATATTTTGGTG CACCCATTACCCGAATAAAAATCTTCTCTCTTTCTTCCTCTCT[CCTT][CCTT][CCTT] [CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT]CCTA[CCTT]CTTT [CCTT]CAACAGAATCTTATTCTGTTGCCCAGGCTGGAGTGCAGTGGTACAATTATAG CTTTTTGCAGCCTCAACCTCCTGGGCTCAAGTGATCTTCCTGCCCCAG

Reference String [Phillips et al., 2018]

Software

Sample

Panel

Marker

Repeat Structure

Reads

[King et al., 2017]

44_S1

Sequence String

[CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CC TT]CCTA[CCTT]CTTT[CCTT]CAACAGAATCTTATTCTGTTGCCCAGGCTG GF-Mix CT[CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][ [CCTT]a ccta 140 CCTT][CCTT]CCTA[CCTT]CTTT[CCTT]CAACAGAATCTTATTCTGTTGCCCAGGCTG D19S433 [CCTT]b cttt [CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CC [CCTT]c 2139 TT]CCTA[CCTT]CTTT[CCTT]CAACAGAATCTTATTCTGTTGCCCAGGCTG GF-STR CT[CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][CCTT][ 2494 CCTT][CCTT]CCTA[CCTT]CTTT[CCTT]CAACAGAATCTTATTCTGTTGCCCAGGCTG 529

STRait Razor v2

Sequence- Lengthbased Data based (MPS) Data (CE)

STRait Razor v2s (King et al., 2017). Analytical Threshold: 11 reads (defaul settings).

14

13.2

15

15

14

13.2

15

15

Müller et al., manuscript in preparation

GEDNAP 44_S1 Bam files were aligned to GRCh37 (hg 19) using IGV. 2 bp deletion located in the 5’ flanking region of D19S433 (rs745607776).

Integrative Genomics Viewer (IGV), version 2.3.88 (Robinson et al., 2011 & Thorvaldsdottir et al., 2013)

K.B.Gettings et al., 2016

Müller et al., manuscript in preparation

Conclusion Inter-Laboratory Evaluation Study Comparable results between INTCF and GMI in terms of: Interlocus balance Stutter ratios Sensitivity: Fully automated sensitivity testing yielded 98.6 % alleles down to 125 pg (Globalfiler NGS STR Panel™) Concordance: 367/376 alleles (97.6 %) concordant to known reference (Globalfiler Mixture ID™ Panel) 376/376 alleles (100 %) concordant to known reference (Globalfiler NGS STR Panel™)

Additional Remarks o Fully automated workflow requires low hands-on time in the lab and is easy to handle o Mixing high and low quality DNA samples in one automated library preparation causes decreased sensitivity o Software improvements desirable → see alignment according to ISFG recommendations

Ongoing Task: Population Study

Madrid

Innsbruck

Berlin

Applied Biosystems Precision ID Globalfiler NGS STR for the Ion S5TM (Thermo Fisher Sientific)

PowerSeq GY46 Kit (Promega)

PowerSeq GY46 Kit (Promega)

500 anonymous donors from Spain

250 anonymous donors from Austria

150 anonymous donors from Germany

Alonso et al., 2017, FSI Genetics (published) Alonso et al., 2018, Electrophoresis (manuscript accepted) Köcher*, Müller* et al., 2018, FSI Genetics (under review) Müller et al., 2018, FSI Genetics (in preparation)

Poster Presentations: Müller et al., ISFG Seoul 2017

Barrio et al., ISFG Seoul 2017

Acknowledgements DNA-STR Massive Sequencing & International Information Exchange Home/2014/ISFP/AG/LAWX/4000007135

Christina Strobl

Robert Lagacé Sharon Wootton Matt Phipps Joseph Chang Speaker was provided travel and hotel support by Thermo Fisher Scientific for this presentation, but no remuneration When used for purposes other than Human Identification or Paternity Testing the instruments and software modules cited are for Research Use Only. Not for use in diagnostic procedures. Thermo Fisher Scientific and its affiliates are not endorsing, recommending, or promoting any use or application of Thermo Fisher Scientific products presented by third parties during this seminar. Information and materials presented or provided by third parties are provided as-is and without warranty of any kind, including regarding intellectual property rights and reported results. Parties presenting images, text and material represent they have the rights.

https://www.researchgate.net/project/DNASEQEX