Additional file 3. Genes in over-represented GO terms ...

Recommend Documents

Additional file 6. Genes and their shared GO terms ...

Additional file 6. Genes and their shared GO terms under Cellular Component. GO:0005654 nucleoplasm. ATXN3|NCOA6|SMARCA2. GO:0005667 transcription ...

Additional file 6. Genes and their shared GO terms ...

Additional file 6. Genes and their shared GO terms under Cellular Component. GO:0005654 nucleoplasm. ATXN3|NCOA6|SMARCA2. GO:0005667 transcription ...

Additional File 3: Differentially expressed genes (3.25

Additional File 3: Differentially expressed genes (3.25 fold) in double HAT mutants. Down-regulated. âgcn5âelp3. âgcn5âmst2. âmst2âelp3. Gene. Log2.

Additional file 3

Ð¡Ð¢ÐCGCCATCATGTGAAGCAGCTITAAATTGGGGTTGCTGCÑÑÑÐ¡Ð¢ÐÐÐ¡ÐGTCÑÑÑÑÑGGTGGGACAATT. Russula puellaris. Russula violeipes. Amanita citrina.

Additional file 3

GAGAAGATGACTCAGATCATGTTCG. CCAGCCAGGTCCAGACGG. 154. 91. 0.999. Elongation factor 2 (Eef2). EB173938. ATGGAGTCATTTGGTTTCACAGC.

Additional File 3

MYH10. 2.6 3.0 3.4. 2800 JUND:95. NM_005964. MY H10. 2.0 2.2 2.4 2.6. 2801 JUND:194. NM_005964. ÐÒ®Ð10. 3.5. 3.5. 2804 MYH 10:174. 1000 2000 30000.

Additional file 3

1.40 (0.85-. 2.31). 0.72 (0.58-. 0.90). 1.17 (0.83-. 1.64). 0.62 (0.41-. 0.94). 1.35 (0.71-. 2.60) average (ref.) 1.00. 1.00. 1.00. 1.00. 1.00. 1.00. Boys. (Much) too thin ...

Additional file 3

0.07. 0.15. SNP311_198. 0.49. 0.34. 0.42. 0.32. SNP317_155. 0.34. 0.31. 0.24. 0.45. SNP325_65. 0.28. 0.26. 0.20. 0.19. SNP341_196. 0.45. 0.43. 0.35. 0.40.

Additional file 3

Gene Ontology: biological process (multilevel). GO description. Features. Response to stress. Organ development. Proteolysis. Negative regulation of cellular ...

Additional file 3 - PLOS

1. 1. 1. 1. Yes 8.25 (3.49-19.53) 5.94 (2.74-12.87). 5.53 (2.55-12.02). 4.47 (2.18-9.19). 6.33 (2.9-13.83). 4.99 (2.39-10.41) 5.41 (2.4-12.21). Matchbox- test â¤17 1.

Additional file 3

test tubes. Now, MRI machines are being used in conjunction with computers to provide detailed pictures of the body's interior including exposing tumours and.

Additional File 3

-125 539. OOF2 Sense. A. RAB1A ; GID: 41350195. -122 640. OOF2 Sense. A. RAB1A ; GID: 41350195. -122 640. OOF2 Sense. A. RAB1A ; GID: 41350195.

Additional file 3

thiolase enoyl-coenzyme a hydratase. (trifunctional protein) alpha subunit hadha. 1.3 -0.6 -0.9 -1.8 2.4 0.8. AW116229 Similar to hydroxy-delta-5-steroid3 beta-.

Additional file 3

Hook. f. ex Franch. cv Hercules. LN869218.1. Lloyd Evans, D. (submitter). Miscanthus sinensis. Andersson cv Andante. ERS2073004. Lloyd Evans, D. (submitter).

Additional file 3

0.12. 0.06. 0.08. 0.06 0.10. 0.09. 0. 12 0.05. 0.09 0.27 0.17. 0.05. 0.20. 0.08. 0.17 ... 0.02. 0.11. 0.09. 0.02. 0.03. 0.08. 0.04. 0.30. 0.05. 0.07. 0.13. 0.07. 0.07. 0.14.

Additional Data File 3 - 785 genes GeneID Symbol ...

golgi autoantigen, golgin subfamily a, 5. 1594. CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1. 84823. LMNB2 lamin B2. 26128. KIAA1279.

Additional file 3 Questionnaire

Chicken/Duck. â Never âSometimes â Often. â¡ Fish. â Never ... Cured/smoked/fermented â Never âSometimes â Often. â¡ Bbq. â Never âSometimes â Often.

3. Additional file 1_BC&WBC_EPP_20180625

The PCRs were carried out on a GeneAmp 2700 PCR System (Applied ... Germany) with the following conditions: 5 minutes of initial denaturation at ... This did not happen for male black coucals or both sexes in white-browed ... analyses by using the mi

Additional File 3 - BioMed Central

Homo sapiens transmembrane 4 L six family member 1 (TM4SF1), mRNA. [NM_014220]. 1.486. SCAMP5. Homo sapiens secretory carrier membrane protein 5 ...

Additional file 3. Fast track

Triage category 4 ... Triage category 3 .... of stay; LWBS = left without being seen; CTAS = Canadian Emergency Department Triage and Acuity Scale; ATS =.

additional file 3 2018 revised

54,79%. 102044-KK. CG7250, Toll-6. 46,77%. 27103-GD. CG7250, Toll-6. 42,69%. 928-GD. CG6531, wgn. 41,70%. 9152-GD. CG5490, Tl. 38,64%. 100078-KK.

ABCD Additional data file 3

electron transport membrane organization/biogenesis cellular respiration precursor metabolites and energy. RNA metabolism protein biosynthesis transcription.

Additional file 3 - BioMed Central

One input file with the extension 'snpe' for p-values is required. ... In the above file, column 1 is the marker name, column 2 is the chromosome number, column 3.

Additional file 3 - HAL-Inserm

4Data Science Laboratory, Institute for Scientific Interchange (ISI) Foundation, Torino, Italy. 5 INSERM, U707, Paris F-75012, France. 6 UPMC UniversitÃ© Paris ...