Additional File 3 Table S3: BRCA2 mutation

Recommend Documents

Additional file 3: Table S3 - BioMed Central

Page 1. Additional file 3: Table S3.

Additional File 3 Table S3. Experimental Binding ... - BioMed Central

Additional File 3. Table S3. Experimental Binding affinity for immune complexes. PDB ID. Antibody ... Fab of anti-hen egg white lysozyme antibody HyHEL-63.

Additional file 3, Table S2

1 siRNA C si.TRAF1.4. ATCGTTAGGGTTGCTTCTATA. Fig. 1 siRNA A. siPLK1.7: CGCGGGCAAGATTGTGCCTAA. CAPS8AP2/FLASH. NUP62. NTRK1. WDR3.

1 Additional file 3: Table S3 Single Cell #1 #2 #3 #4 ... - BioMed Central

Additional file 3: Table S3. Single Cell. #1. #2. #3. #4. #5. #6. #7. #8. #9. #10. #1. 1.000 0.603 0.602 0.637 0.627 0.588 0.555 0.505 0.526 0.561. #2. 0.603 1.000 ...

see Additional Table S3.xls Table S4

1. Additional files: Turner et al., Genome organization and characteristic of soybean miRNAs. Table of content: Table S1: see Additional Table S1.xls. Table S2:.

Additional file 4 - Table S3. Percentage similarity ... - BioMed Central

3. 4. 5. 6. 7. 8. 9. 10. 11. 1. Tammar. 2. DunnartSF. 81.8. 3. DunnartFT. 81.8. 100.0. 4. Koala. 63.6. 77.3. 77.3. 5. Opossum. 59.1. 72.7. 72.7. 59.1. 6. Possum. 86.4.

Additional file 3

Ð¡Ð¢ÐCGCCATCATGTGAAGCAGCTITAAATTGGGGTTGCTGCÑÑÑÐ¡Ð¢ÐÐÐ¡ÐGTCÑÑÑÑÑGGTGGGACAATT. Russula puellaris. Russula violeipes. Amanita citrina.

Additional file 3

GAGAAGATGACTCAGATCATGTTCG. CCAGCCAGGTCCAGACGG. 154. 91. 0.999. Elongation factor 2 (Eef2). EB173938. ATGGAGTCATTTGGTTTCACAGC.

Additional File 3

MYH10. 2.6 3.0 3.4. 2800 JUND:95. NM_005964. MY H10. 2.0 2.2 2.4 2.6. 2801 JUND:194. NM_005964. ÐÒ®Ð10. 3.5. 3.5. 2804 MYH 10:174. 1000 2000 30000.

Additional file 3

1.40 (0.85-. 2.31). 0.72 (0.58-. 0.90). 1.17 (0.83-. 1.64). 0.62 (0.41-. 0.94). 1.35 (0.71-. 2.60) average (ref.) 1.00. 1.00. 1.00. 1.00. 1.00. 1.00. Boys. (Much) too thin ...

Additional file 3

0.07. 0.15. SNP311_198. 0.49. 0.34. 0.42. 0.32. SNP317_155. 0.34. 0.31. 0.24. 0.45. SNP325_65. 0.28. 0.26. 0.20. 0.19. SNP341_196. 0.45. 0.43. 0.35. 0.40.

Additional file 3

Gene Ontology: biological process (multilevel). GO description. Features. Response to stress. Organ development. Proteolysis. Negative regulation of cellular ...

Additional file 3 - PLOS

1. 1. 1. 1. Yes 8.25 (3.49-19.53) 5.94 (2.74-12.87). 5.53 (2.55-12.02). 4.47 (2.18-9.19). 6.33 (2.9-13.83). 4.99 (2.39-10.41) 5.41 (2.4-12.21). Matchbox- test â¤17 1.

Additional file 3

test tubes. Now, MRI machines are being used in conjunction with computers to provide detailed pictures of the body's interior including exposing tumours and.

Additional File 3

-125 539. OOF2 Sense. A. RAB1A ; GID: 41350195. -122 640. OOF2 Sense. A. RAB1A ; GID: 41350195. -122 640. OOF2 Sense. A. RAB1A ; GID: 41350195.

Additional file 3

thiolase enoyl-coenzyme a hydratase. (trifunctional protein) alpha subunit hadha. 1.3 -0.6 -0.9 -1.8 2.4 0.8. AW116229 Similar to hydroxy-delta-5-steroid3 beta-.

Additional file 3

Hook. f. ex Franch. cv Hercules. LN869218.1. Lloyd Evans, D. (submitter). Miscanthus sinensis. Andersson cv Andante. ERS2073004. Lloyd Evans, D. (submitter).

Additional file 3

0.12. 0.06. 0.08. 0.06 0.10. 0.09. 0. 12 0.05. 0.09 0.27 0.17. 0.05. 0.20. 0.08. 0.17 ... 0.02. 0.11. 0.09. 0.02. 0.03. 0.08. 0.04. 0.30. 0.05. 0.07. 0.13. 0.07. 0.07. 0.14.

Additional file 3: Supplementary figures S1, S2, S3 ... - BioMed Central

Additional file 3: Supplementary figures S1, S2, S3 and S4. T. Lipniacki et al. Fig. S1. Pulse and persistent stimulation by a high TNFa dose (10ng/ml). Amplitude ...

Additional file 3 Table S2. Genotypes of the

DIFFUSE GASTRIC CANCER. Sample. D16S3025. D16S496. D16S3067. LOH. 2D-C. 97/101. 218/222. 148/150. No. 2D-T. 97/101. 218/222. 148/150. 3D-C.

Additional File 3 Table S3. List of other small RNAs ... - BioMed Central

Additional File 3. Table S3. List of other small RNAs with significantly different (nominal P < 0.05) expression in AAA (n = 5) compared to controls (n = 5).

Page | 1 Additional file 3 Table S3. Genes altered significantly in liver ...

4.38. 2.43. ABu. (P06238) Alpha-2-macroglobulin precursor (Alpha-2-M) .... (Q8BK64) Activator of 90 kDa heat shock protein ATPase homolog 1 (AHA1).

Additional file 3. Table S3. List of KEGG pathways and ... - PLOS

gga:422345 ACSL4; acyl-CoA synthetase long-chain family member 4 gga:422660 UGT2A3; UDP glucuronosyltransferase 2 family, polypeptide A3 gga:422827 ...

Additional File 3 Table S2: List of top ten significantly

Additional File 3 Table S2: List of top ten significantly modified pathways as identified in MetaCore. Rank Pathway Name. pValue. 1. Cytoskeleton ...

Additional File 3 Table S3: BRCA2 mutation

Download PDF

1 downloads 0 Views 35KB Size Report

Comment

Study Group. Samples rs1799943 rs11571579 rs9534174 rs206070 rs144848 rs4942440 rs9567576. EMBRACE. 836. Yes. Yes. Yes. Yes. Yes. Yes. Yes.

Additional File 3 Table S3: BRCA2 mutation carriersgenotyped by study for seven tag SNPs. Study Group EMBRACE FCCC GEMO GEORGETOWN HEBCS ILUH KCONFAB MAYO PBCS SWE-BRCA UPENN

Samples 836 54 644 16 103 132 481 117 56 169 146

rs1799943 Yes Yes Yes Yes Yes No Yes Yes Yes Yes Yes

rs11571579 Yes Yes No Yes No No Yes Yes Yes Yes Yes

rs9534174 Yes Yes No Yes Yes Yes Yes Yes Yes Yes No

rs206070 Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes

rs144848 Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes

rs4942440 Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes

rs9567576 Yes Yes Yes Yes Yes No Yes Yes Yes Yes Yes