(This is a sample cover image for this issue. The actual cover is not yet available at this time.)
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the author's institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier's archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/authorsrights
Author's Personal Copy Journal of Virological Methods 234 (2016) 123–131
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a reverse transcription loop-mediated isothermal amplification assay for the detection of vesicular stomatitis New Jersey virus: Use of rapid molecular assays to differentiate between vesicular disease viruses Veronica L. Fowler a,∗ , Emma L.A. Howson a , Mikidache Madi a , Valérie Mioulet a , Chiara Caiusi a , Steven J. Pauszek b , Luis L. Rodriguez b , Donald P. King a a b
The Pirbright Institute, Ash Road, Pirbright, Surrey, GU24 0NF, United Kingdom Plum Island Animal Disease Center, 40550 Main Rd, Orient, NY 11957, United States
a b s t r a c t Article history: Received 20 January 2016 Received in revised form 11 April 2016 Accepted 17 April 2016 Available online 23 April 2016 Keywords: RT-LAMP Vesicular stomatitis Foot-and-mouth disease Swine vesicular disease Rapid molecular diagnostics Multiplex
Vesicular stomatitis (VS) is endemic in Central America and northern regions of South America, where sporadic outbreaks in cattle and pigs can cause clinical signs that are similar to foot-and-mouth disease (FMD). There is therefore a pressing need for rapid, sensitive and specific differential diagnostic assays that are suitable for decision making in the field. RT-LAMP assays have been developed for vesicular diseases such as FMD and swine vesicular disease (SVD) but there is currently no RT-LAMP assay that can detect VS virus (VSV), nor are there any multiplex RT-LAMP assays which permit rapid discrimination between these ‘look-a-like’ diseases in situ. This study describes the development of a novel RT-LAMP assay for the detection of VSV focusing on the New Jersey (VSNJ) serotype, which has caused most of the recent VS cases in the Americas. This RT-LAMP assay was combined in a multiplex format combining molecular lateral-flow devices for the discrimination between FMD and VS. This assay was able to detect representative VSNJV’s and the limit of detection of the singleplex and multiplex VSNJV RT-LAMP assays were equivalent to laboratory based real-time RT-PCR assays. A similar multiplex RT-LAMP assay was developed to discriminate between FMDV and SVDV, showing that FMDV, SVDV and VSNJV could be reliably detected within epithelial suspensions without the need for prior RNA extraction, providing an approach that could be used as the basis for a rapid and low cost assay for differentiation of FMD from other vesicular diseases in the field. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
1. Introduction Vesicular stomatitis New Jersey virus (VSNJV), in the family Rhabdoviridae, genus Vesiculovirus, is endemic in southern Mexico, Central America and northern regions of South America (Colombia, Venezuela, Ecuador and Peru). VSNJV, an arbovirus, can affect humans and causes vesicular stomatitis (VS) in horses, cattle and pigs (Velazquez-Salinas et al., 2014). There have been a number of multiyear outbreaks of VSNJV in the United States (Letchworth et al., 1999; Rainwater-Lovett et al., 2007) which can cause heightened concern when the disease is observed in cattle or pigs due to the similarity in clinical presentation to foot-and-mouth disease (FMD) which is an OIE-listed notifiable disease caused by an RNA virus (FMDV) belonging to the family Picornaviridae, genus Aph-
∗ Corresponding author. E-mail address:
[email protected] (V.L. Fowler).
thovirus. Difficulties in distinguishing the agents responsible for the clinical signs of vesicular disease are not restricted to VSV and FMDV. In pigs, swine vesicular disease (SVD), caused by SVD virus (SVDV: genus Enterovirus, family Picornaviridae) can also cause characteristic vesicular lesions. Therefore, there is a pressing need for rapid, sensitive and specific differential diagnostic assays that are suitable for decision making in the field within Europe (FMD differentiation from SVD) and the Americas (FMD differentiation from VS) when screening animals displaying clinical signs consistent with vesicular disease. Simple pen-side diagnostics which can be deployed on farm to rapidly detect viral antigen have been developed in the form of lateral flow devices (LFD’s) for detection of FMDV (Ferris et al., 2009,2010a; Oem et al., 2009; Yang et al., 2013; Morioka et al., 2015), SVDV (Ferris et al., 2010b) and VSV (Ferris et al., 2012). However the analytical sensitivity of these antibody-based tests is lower than those of molecular based methods and the sample type applicable for use is normally restricted to epithelial tissue. As
http://dx.doi.org/10.1016/j.jviromet.2016.04.012 0166-0934/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Author's Personal Copy 124
V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
such, there has been an impetus to develop and transfer molecular assays for detection of these diseases into field settings. Initially research was focused on solutions to enable real-time RT-PCR (rRTPCR) to be performed in the field (Callahan et al., 2002; King et al., 2008; Wilson et al., 2009; Madi et al., 2012; Howson et al., 2015), but since most of these platforms are expensive and need to be decontaminated when moved between farms, emphasis has shifted to alternative molecular assays such as loop-mediated isothermal amplification (LAMP) (Notomi et al., 2000). LAMP is an isothermal, autocyling, strand-displacement DNA amplification technique which can be performed at a single temperature in a water bath and can be combined with simple, disposable visualisation using molecular LFD’s (James et al., 2010). Singleplex reverse transcription (RT)-LAMP assays have been previously designed and evaluated within laboratory settings for detection of FMDV (Dukes et al., 2006; Shao et al., 2010; Chen et al., 2011a,b; Yamazaki et al., 2013; Ding et al., 2014; Waters et al., 2014) and SVDV (Blomström et al., 2008) and in the case of FMDV these assays have been adapted for field use and validated within endemic settings (Howson et al., 2015). However, currently there is no equivalent LAMP assay for the detection of VSV, nor are there multiplex assay formats available for rapid differentiation between ‘look-a-like’ diseases within a single reaction. This manuscript describes the development of the first RT-LAMP assay for the detection of VSNJV which is the serotype responsible for the majority of the recent clinical cases in North America and Central America (Velazquez-Salinas et al., 2014). This new test was combined in a multiplex (LFD) format to allow differential detection of VSNJV and FMDV. In parallel to this work, the performance of a second multiplex RT-LAMP assay that can detect FMDV and SVDV was also evaluated, providing two assays that can be used for the rapid detection and discrimination of viruses causing vesicular disease of livestock.
2. Methods 2.1. Ethics All animal samples utilised in this project were archival samples from previous experimental studies approved by The Pirbright Institute ethical review committee under the auspices of the Animal Scientific Procedures Act (ASPA) 1986 (as amended), or comprised samples collected and submitted by endemic country authorities or NCFAD-Canadian Food Inspection Agency (Winnipeg, Canada) to The World Reference Laboratory for FMD (WRLFMD) at The Pirbright Laboratory.
2.2. Virus isolates Archival epithelial suspensions (10% (w/v) in M25 phosphate buffer: 35 mM Na2 HPO4 , 5.7 mM KH2 PO4 , pH 7.6) for FMDV (n = 5), SVDV (n = 5), VSNJV (n = 6) and VS Indiana virus (VSIV) (n = 2) used within this study were obtained from the WRLFMD archive at The Pirbright Institute (Table 1). Archival VSNJV cell culture supernatants from clade I (n = 3), clade II (n = 1), clade III (n = 4) and clade IV (n = 1) were obtained from the WRLFMD, in addition to cell culture supernatant for FMDV O UAE 2/2003 (n = 1). Archival RNA extracted from VSNJV clade IV (n = 1) and clade V (n = 1) isolates were supplied by Central Veterinary Institute (CVI), Netherlands (Table 1). Four RNA samples were supplied by Agence nationale de sécurité sanitaire de l’alimentation (ANSES, France) comprising VSNJV clade I Hazlehurst (n = 2; 10−1 and 10−3 from a decimal dilution series) and Indiana 1 Mudd-Summers (n = 2; 10−2 and 10−4 from a decimal dilution series).
2.3. RNA extraction Total RNA was extracted by an automated procedure on a MagNA Pure LC robot using total nucleic acid kit reagents following manufacturer’s guidelines or extracted using QIAcube and the QIAamp viral extraction kit (Qiagen). 2.4. RT-LAMP and RT-LAMP-LFD For detection of VSNJV, a new singleplex RT-LAMP assay was designed. Sixteen VSNJV full-length genomes (Accession numbers: KU296051-KU296057, JX122220, JX12112, JX121111, JX121109, JX121108, JX121104, JX121105, JX121106, JX121107) representing the six clades of VSNJV were obtained from GenBank. Sequences were aligned in BioEdit (Version 7.0.5.3) from which a region spanning nucleotides 1376–1598 (junction between nucleocapsid (N) and phopshoprotein (P)) was selected for LAMP primer design (Table 2) using Primer Explorer V4. The RT-LAMP mastermix and cycling parameters for the VSNJV RT-LAMP assay were as per the wet reagents described by Howson et al. (2015) and the primer ratio in a 25 l reaction as reported by Blomström et al. (2008); F3/B3 (External primers: EP’s): 5 pmol, FIP/BIP (Internal primers: IP’s): 40 pmol and Floop/Bloop (loop primers: Loops): 20 pmol. The singleplex FMDV and SVDV RT-LAMP assays used primers and primer concentrations from published assays (Dukes et al., 2006 and Blomström et al., 2008; respectively), the RT-LAMP mastermix for both assays were as per the wet reagents described by Howson et al. (2015). In all cases, 5 l of template (RNA or clinical sample) was added to the assay formats. For clinical samples epithelial suspensions were diluted 1:5 in nuclease free water as described previously (Waters et al., 2014; Howson et al., 2015). RT-LAMP reactions were performed using the Genie® II (OptiGene Ltd.) or a standard laboratory based real-time PCR machine (Stratagene, Mx5000p). Visualisation of RT-LAMP products was achieved by real-time fluorescence (TP : Time to positivity, rounded to the nearest minute) and/or end point molecular LFD’s. In all cases, assays were run at 65 ◦ C for 60 min followed by 85 ◦ C for 5 min. To confirm that amplicons were virus specific, annealing analysis was performed at the end of the RT-LAMP reaction on the RT-LAMP products using the Genie® II (OptiGene Ltd.). LAMP products were heated to 98 ◦ C, then cooled to 80 ◦ C ramping at 0.05 ◦ C per second. Anneal temperature (Ta ) calculations were automated using Genie® Explorer v0.2.1.1 software (OptiGene Ltd). Samples were defined as positive if amplification had occurred and the LAMP product annealed in the virus amplicon specific temperature range: FMDV: 87.5–89.5 ◦ C; VSNJV: 83.5–84.5 ◦ C; SVDV: 86.0–87.0 ◦ C. In all cases, samples were tested in duplicate. To enable visualisation on molecular LFDs the singleplex RT-LAMP reactions for detection of VSNJV combined internal FIP and BIP primers which were labelled at the 5 termini with Flc: fluorescein (FIP) and Btn: biotin (BIP) and visualised using an immuno-chromatographic LFD (Forsite Diagnostics, York, UK). In this case, a positive was concluded if two bands were present, the T: Test line and C: Control line. To create the multiplex format, the primers were added at half the volume but twice as concentrated as the singleplex assay to account for the dilution effect of the second set of primers. In addition the internal FIP and BIP primers for the VSNJV, FMDV and SVDV assays were labelled at the 5 termini as per Table 3 to permit spatial separation on multiplex molecular LFD’s (AMODIA MultiFlow® , Germany). The multiplex format combined a total of two disease target reagents, discerning either FMDV and SVDV, or FMDV and VSNJV (Fig. 1). Multiplex LFD’s were considered positive if there was a presence of two out of a possible three bands which should include one T: Test line and one C: Control line. The first T line (anti-Flc) was always the indicator for FMDV positive samples, whilst the second T line (anti-DIG) was either an indicator for VSNJV or SVDV depending
Author's Personal Copy V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
125
Table 1 Virus isolates used for the development and validation of the RT-LAMP/RT-LAMP-LFD assay formats. Virus
Clade
Samples
Year
Location
Sample type
VSNJV
Clade I
Colorado 10 Colorado 20 Colorado 22 10−1 and 10−3 El Salvador 65 Colombia 1/93 Colombia 3/93 NJ 27946 NJ 27775 NJ 27405 NJ 29344 NJ 27324 NJ 29356 Ecuador 85 Nicaragua 71 NJ07/83NCP Costa Rica 66 NJ01/85PNB IND29356 IND29705 10−2 and 10−4
NK NK NK NK 1965 1993 1993 1998 1998 1998 2000 1998 2000 1985 1971 1983 1966 1985 2000 2000 NK
Colorado Colorado Colorado Hazlehurst, Georgia El Salvador Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Ecuador Nicaragua Nicaragua Costa Rica Panama Colombia Colombia NK (MSS)
CCS RS1 CCS BHK2 CCS RS1 RNAa Vero 1 CCS BHK4 CCS RS1 CCS RS1 ES-Cattle ES-Cattle ES-Cattle ES-Cattle ES-Cattle ES-Cattle CCS BHK3 CCS BHK3 RNAb BHK2 CCS BHK2 RNAb BHK2 ES-Cattle ES-Cattle RNAa Vero 1
Clade II Clade III
Clade IV Clade V VSIV
FMDV
O A A SAT2 Asia1 Asia1
UAE/2/2003 TUR/7/2013 TUR/4/2013 BOT/15/2013 TUR/2/2013 PAK 21/12
2003 2013 2013 2013 2013 2012
UAE Turkey Turkey Botswana Turkey Pakistan
CCS BTY 1 ES-Cattle ES-Cattle ES-Cattle ES-Cattle ES-Cattle
SVDV
1 1 1 1 1
UKG 155/80 UKG 24/72 UKG 50/72 UKG 51/72 UKG 63/73
1980 1972 1972 1972 1973
United Kingdom United Kingdom United Kingdom United Kingdom United Kingdom
ES-Porcine ES-Porcine ES-Porcine ES-Porcine ES-Porcine
CCS: Cell culture supernatant, RS: renal swine cells, Vero: African green monkey kidney epithelial cells, BTY: primary bovine thyroid cells, VSNJ: vesicular stomatitis New Jersey virus, VSIV: vesicular stomatitis Indiana virus, FMDV: foot-and-mouth disease virus, SVDV: swine vesicular disease virus, ES: epithelial suspension, UAE: United Arab Emirates, NK: not know, MSS: Mudd Summers strain. a RNA isolated at ANSES, France. b RNA isolated at CVI, Netherlands. Table 2 Oligonucleotide primers used for RT-LAMP amplification of VSV. Mapped to vesicular stomatitis New Jersey virus isolate NJ0783NCP GenBank accession: JX121104.1. Primer name
Type
Length
Genome location
Sequence 5
F3 B3 FIP BIP F Loop B Loop
Forward Outer Reverse Outer Forward inner Reverse inner Forward loop Reverse loop
24-mer 20-mer 38-mer 45-mer 21-mer 18-mer
1383–1407 1563–1582 1408–1425; 1448–1467 1478–1502; 1541–1560 1426–1446 1513–1530
AAACTAACAGATATCATGGACAG TGAATCTGACGATTCTTCGT TCCTGCAAGGCAGAATCCAATGTTGATCGGCTCAAGAC TCTGAGGAGAGAAGAGAGGATAAATTGATAATACGACGGAGTTGA TTATCATAAGTAGCCAAATAA CCTCTTCATCGAAGATCA
Table 3 Oligonucleotide labelled primers used for multiplex RT-LAMP amplification and discrimination of FMDV, SVDV and VSV. Flc: Fluorescein, Btn: Biotin, DIG: Digoxigenin. Primer name
Length
Sequence 5
5 label
FMDV FIP FMDV BIP VSV FIP VSV BIP SVDV FIP SVDV BIP
45-mer 44-mer 38-mer 45-mer 46-mer 46-mer
CACGGCGTGCAAAGGAGAGGATTTTACAAACCTGTGATGGCTTCG GGAGAAGTTGATCTCCGTGGCATTTTAAGAGACGCCGGTACTCG TCCTGCAAGGCAGAATCCAATGTTGATCGGCTCAAGAC TCTGAGGAGAGAAGAGAGGATAAATTGATAATACGACGGAGTTGA TCCCTGCTTCAGCTAGCAGTTTTTGATGATGTGATAGCTTCATACC CAGCAGATAAAGGCGAGTGTTTTTTTTCATCTGCCCTAAARTACCT
Flc Btn DIG Flc DIG Flc
on the assay being run (Fig. 1). For both the single and multiplex LFD assays the devices were developed for eight minutes prior to reading the result.
2.5. RNA standards and RNA dilution series used to determine analytical sensitivity of RT-LAMP assays The RNA standard for determining analytical sensitivity of the VSNJV RT-LAMP singleplex assay was prepared as previously
described for FMDV (Dukes et al., 2006) using the following modified F3 primer 5 -TAA TAC GAC TCA CTA TAG GGA GAA CTA ACA GAT ATC ATG GAC AG-3 and an RNA pool to represent six VSNJVs from clades II (n = 1), III (n = 4) and IV (n = 1) (El Salvador 65, Colombia 1/93, Colombia 3/93, Ecuador 85, Nicaragua 71 and Costa Rica 66) as the template. However, in order to compare the analytical sensitivity of the VSNJV RT-LAMP singleplex and VSNJV/FMDV RT-LAMP multiplex assay directly against the rRT-PCR it was necessary to also generate an RNA decimal dilution series prepared in 0.1 g/l
Author's Personal Copy 126
V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
Fig. 1. Illustration of multiplex RT-LAMP reaction detected using molecular lateral flow devices (LFDs). Top image show illustration for LFD reporting a FMDV positive reaction. Bottom image shows illustration for LFD reporting either SVDV/VSNJV positive reaction.
carrier RNA using the same VSNJV RNA pool as described above. This was required since the VSNJV rRT-PCR targets a different location in the N protein to the new RT-LAMP assay which targets the junction between the N and P proteins. The RNA standard for determining analytical sensitivity of the VSNJV/FMDV multiplex assay when the input RNA was FMDV was prepared as previously described (Dukes et al., 2006). In order to compare the analytical sensitivity of the SVDV RT-LAMP singleplex and FMDV/SVDV multiplex assay directly against the SVDV rRT-PCR it was necessary to also generate an RNA decimal dilution series prepared in 0.1 g/l carrier RNA representing SVDV RNA extracted from SVDV UKG 155/80.
2.6. Real-time RT-PCR (rRT-PCR) The rRT-PCR assay for detection of FMDV targeted the conserved 3D region of the FMDV genome and used primers and probes (Callahan et al., 2002), reagents, parameters and thermal cycling (Shaw et al., 2007) as previously described. The rRT-PCR assay for detection of SVDV targeted the conserved 5 UTR region of the SVDV genome using the primers (SASVD-2B-IR-252-275F and SASVD-2BIR-332-312R) and probe (SASVD-2B-IR-289-309P) from Reid et al. (2004) and the cycle parameters of Shaw et al. (2007). The rRT-PCR assay for detection of VSNJV targeted the conserved N protein of the VSNJV genome with primers, probes and reagents as per Wilson et al. (2009) with the exception that the VSNJV rRT-PCR assay was run for 50 cycles. Values presented in this manuscript represent cycle thresholds CT ’s and have been rounded to the nearest whole CT . All samples were tested in duplicate. Within this manuscript a cut off value was not applied, but instead all CT ’s are reported.
2.7. Proficiency test of multiplex VSNJV RT-LAMP assay The performance of the multiplex VSNJV RT-LAMP assay was conducted in collaboration with Dr Aurore Romey from ANSES (France), the European Union Reference Laboratory for Equine Diseases. Six RNA samples (A-F) blind-coded with unique identifiers were received at The Pirbright Institute which had been previously prepared at ANSES. In brief, VSV RNA and total RNA from noninfected African green monkey kidney (Vero) cells were extracted using automatic QIAcube (Qiagen) and the QIAamp viral extraction kit according to manufacturer recommendations. RNA elution was performed in 100 l. RNA samples were prepared by making dilutions of the RNA in RNA Safe Buffer (50 ng/l Carrier poly A-RNA, 0.05% Tween 20 (v/v), 0.05% sodium acid (w/v)). Decimal dilution series were prepared and checked for suitability using rRT-PCR (Hole et al., 2010). For the proficiency test two samples comprised VSNJV Hazlehurst (10−1 and 10−3 ) and another two samples comprised Indiana 1 Mudd-Summers (10−2 and 10−4 ) (Table 1) which had been passaged in Vero cells. Two additional samples were negative controls comprising cell lysate from uninfected Vero cells (10−3 ). RNA was assayed using real-time RT-PCR (Wilson et al., 2009) and also the newly developed multiplex VSNJV RT-LAMP assay. In this case the multiplex assay used incorporated VSNJV and FMDV primers. 3. Results 3.1. Optimisation and performance of single and multiplex VSNJV RT-LAMP and RT-LAMP-LFD assay Initial performance of the singleplex assay was assessed using the EP’s and IP’s primers on RNA extracted from six VSNJV cell
Author's Personal Copy V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
127
Fig. 2. Analytical sensitivity of the singleplex VSNJV RT-LAMP assay visualised by fluorescence (Time to positivity in minutes: TP )a and by molecular lateral flow device (RT-LAMP-LFD)b determined using an VSV RNA standard. Performance of the singleplex VSNJV RT-LAMP assay visualised by fluorescence (TP )c and by molecular lateral flow device (RT-LAMP-LFD)d compared to the corresponding diagnostic real-time RT-PCR (rRT-PCR; Cycle Threshold: CT )e as determined using as decimal dilution series of VSNJV pooled RNA. Grey shading indicates samples considered positive. Values have been rounded to the nearest whole number. From left to right the first blue line is the test (T) line and the second blue line is the control (C) line. In positive LFDs both lines are present, in negative LFDs only the second C line is present. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
culture isolates representing clade II (El Salvador 65), clade III (Colombia 1/93, Colombia 3/93, Ecuador 85 and Nicaragua 71) and clade IV (Costa Rica 66) and RNA extracted from epithelial suspensions of FMDV serotype O (UAE 2/2003) and SVDV UKG (155/80). RNA from all six VSNJV isolates was detected with a mean detection time of 16.75 min ± 1.62 (SD) (Genie® II) or 18.81 min ± 1.29 (SD) (Mx5000p) whereas FMDV and SVDV RNA samples were not amplified. Addition of the loop primers accelerated the assay to an average detection time of 12.30 min ± 1.33 (SD) (Genie® II) or 13.01 ± 1.06 (SD) (Mx5000P). When visualised using fluorescence or by molecular LFD the analytical sensitivity of the singleplex VSNJV RT-LAMP assay was determined to be 101 copies using VSNJV RNA standards (Fig. 2). Using a decimal dilution series of pooled VSNJV RNA the rRT-PCR yielded above threshold CT values for dilutions 10−1 to 10−4 . The VSNJV RT-LAMP and RT-LAMP-LFD assays detected VSNJV RNA to dilutions 10−5 and 10−4 respectively (Fig. 2). The VSNJV RT-LAMP assay did not detect VSIV samples (IND29705 and IND29356) (data not shown) confirming the specificity of the assay to the VSV NJ serotype. There was no evidence of false amplification in RT-LAMP single or multiplex assays for samples considered negative by rRT-PCR. 3.2. Adaptation of RT-LAMP assays to multiplex virus detection and visualisation on lateral flow devices (LFDs) For all singleplex RT-LAMP-LFD assays, the internal FIP and BIP primers were labelled at the 5 termini with Flc (FIP) and Btn (BIP) as per Waters et al. (2014). To enable multiplex visualisation the FIP and BIP primers were labelled with DIG (FIP) and Flc (BIP) for both VSNJV and SVDV detection (Figs. 2 and 3). Multiplexing the new VSNJV RT-LAMP assay with FMDV primers reduced the analytical sensitivity of the test by one log (dilution of 10−5 to 10−4 ) when assessed using VSNJV RNA dilution series and visualising the result by fluorescence maintaining detection limit of 10−5 . Multiplexing did not affect the detection limit when visualised by LFD. Multiplexing the new VSNJV RT-LAMP assay with FMDV primers did not affect the analytical sensitivity of the test when assessed using a FMDV RNA standard and visualising the result by fluorescence or LFD. The singleplex SVDV RT-LAMP assay when visualised using fluorescence was two logs less sensitive than the real-time RT-PCR, however when visualised using LFD was equivalent when assessed using a SVDV RNA dilution series. Multiplexing the SVDV RT-LAMP assay with FMDV primers did not affect the analytical
sensitivity of the test when assessed using SVDV RNA standard and visualising the result by fluorescence or LFD. Multiplexing the FMDV RT-LAMP assay with SVDV primers did not affect the analytical sensitivity of the test when assessed using a FMDV decimal dilution and visualised by LFD, however when visualised using fluorescence there was a two log reduction in analytical sensitivity. No false RT-LAMP amplification was observed in samples considered negative by rRT-PCR.
3.3. Performance of multiplex RT-LAMP and RT-LAMP-LFD on clinical samples Four epithelial suspensions from cattle naturally infected with VSNJV Colombia were diluted 1:5 in nuclease free water and evaluated in the VSNJV singleplex and multiplex RT-LAMP and RT-LAMP-LFD assays without performing an RNA extraction step. Amplification of all four samples was observed in both the single and multiplex formats (Fig. 4). No amplification was noted when the above was applied to two VSIV samples (IND29705 and IND29356) (data not shown). Five cattle epithelial suspensions obtained from the WRLFMD representing three FMDV serotypes were evaluated in singleplex FMDV and multiplex FMDV/VSNJV and FMDV/SVDV RT-LAMP assays. As above samples had been diluted 1:5 in nuclease free water with no additional extraction. In the singleplex FMDV RT-LAMP assay all five FMDV samples were detected. When the VSNJV primers were added to the reaction there was no effect on the assays ability to detect the FMDV samples with visualisation by fluorescence and LFD. This was also true when the FMDV RT-LAMP assay was multiplexed with SVDV primers and the result interpreted using LFD’s, however when interpretation was based on fluorescence the assay failed to detect two samples (which had been previously detected as positive when using singleplex format). Additionally, there was a large increase in the Tp for two of the three detected samples (Fig. 4). Four porcine epithelial suspensions obtained from the WRLFMD were evaluated in singleplex SVDV and SVDV/FMDV RT-LAMP assays. As above samples had been diluted 1:5 in nuclease free water with no additional extraction. The results obtained from the multiplex assay were comparable to the singleplex format. As above there was no evidence of false amplification in any of the RT-LAMP assay formats when the input material was negative epithelial samples.
Author's Personal Copy 128
V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
Fig. 3. Performance of the multiplex RT-LAMP assays compared to the singleplex equivalents visualised by fluorescence (Time to positivity in minutes: TP )a and by molecular lateral flow device (RT-LAMP-LFD)b using decimal dilution series of either FMDV (O/UAE/2003), SVDV (UKG 155/80) or VSNJV (pooled) RNA or FMDV RNA standard (O/UAE/2/2003). Performance of the multiplex and singleplex RT-LAMP assays were benchmarked against the equivalent gold standard real-time RT-PCRsc (Cycle Threshold: CT) . Grey shading indicates samples considered positive. Values have been rounded to the nearest whole number. From left to right for singleplex LFDs the first blue line is the test (T) line and the second blue line is the control (C) line. In positive LFD’s both lines are present, in negative LFD’s only the second C line is present. For multiplex LFDs the first red line is the text (T) line for FMDV, the second red line denotes either VSNJV or SVDV (depending on the assay) and the third red line is the control (C) line. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.4. Proficiency test evaluation of VSV RT-LAMP assay The multiplex VSNJV/FMDV RT-LAMP assay correctly identified VSNJV serotype samples (n = 2) and did not amplify the negative samples (n = 2) with excellent concordance to two rRT-PCR assays (Wilson et al., 2009; Hole et al., 2010). The multiplex VSNJV/FMDV RT-LAMP did not detect VSIV serotype (n = 2) reconfirming restricted specificity for New Jersey serotype only (Fig. 5).
4. Discussion This study describes the development of a new RT-LAMP assay for the detection of VSNJV. This new assay can be visualised simply using molecular LFD’s, and demonstrates analytical sensitivity concordant (or greater) with rRT-PCR, detecting ten copies of RNA in 14 min and can be conducted on clinical samples (epithelial suspensions) without the need for RNA extraction. This VSNJV RT-LAMP assay reliably detected VSNJV viruses (the serotype responsible for the majority of the clinical cases in the Americas) from all clades tested so far including representative strains from clades I, II, III, IV,
V. In addition, the VSNJV RT-LAMP assay shows no cross-reaction with SVDV, FMDV or VSIV (serotype Indiana). To permit multiplex detection, the internal FIP and BIP primers were modified by labelling with DIG and Flc. Adaption of the FMDV RT-LAMP assay for visualisation on molecular LFD’s had already been accomplished (Waters et al., 2014) however, this had not been previously undertaken for the SVDV RT-LAMP assay (Blomström et al., 2008) and was therefore undertaken within this project. When the SVDV RT-LAMP assay was performed in singleplex format and visualised by LFD the analytical sensitivity was comparable to rRT-PCR, however, when visualised by fluorescence (using unlabelled primers) the analytical sensitivity was two log10 –fold less sensitive than rRT-PCR. This same observation was also apparent when the SVDV assay was multiplexed with FMDV primers. These reductions in analytical sensitivity were unexpected and because they cannot be accountable as a result of viral load or sequence variability (if this was true the same observation would be seen in the labelled primers), could be hypothesised to result from the FIP and BIP labels preventing an unknown detrimental primer interaction associated with unlabelled primer sets (e.g. primer-dimers). Multiplexing the RT-LAMP assays had no effect on the analytical sensitivity of any of the assay formats or visualisation methods with
Author's Personal Copy V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
129
Fig. 4. Performance of the singleplex and multiplex RT-LAMP assays visualised by fluorescence (Time to positivity in minutes: TP )a and by molecular lateral flow device (RT-LAMP-LFD)b using 1:5 dilutions of epithelial suspensions of either VSNJVc , FMDVd or VSNJVe isolates. Performance of the multiplex and singleplex RT-LAMP assays were benchmarked against the equivalent gold standard real-time RT-PCRf (Cycle Threshold: CT ). Grey shading indicates samples considered positive. Values have been rounded to the nearest whole number. From left to right for singleplex LFDs the first blue line is the test (T) line and the second blue line is the control (C) line. In positive LFD’s both lines are present, in negative LFD’s only the second C line is present. For multiplex LFD’s the first red line is the test (T) line for FMDV, the second red line denotes either VSV or SVDV (depending on the assay) and the third red line is the control (C) line. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5. Tabulated results from the VSV proficiency test panel. VSV rRT-PCR assay was performed as per Wilson et al. (2009). VSNJV multiplex assay included VSNJV and FMDV primers.
the exception of when the VSNJV RT-LAMP assay was multiplexed with the FMDV as discussed above. However, the small decrease in analytical sensitivity observed as a result of multiplexing the test is unlikely to impact on the value of this as a diagnostic/differentiation tool at the pen-side, since the input sample would be epithelial
tissue containing virus expected to greatly exceed the analytical sensitivity of this test. Translating these assays for field deployment is an important step and as such sample preparation should avoid complex RNA extraction steps. Simple sample preparation methods detailed pre-
Author's Personal Copy 130
V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131
viously by Waters et al. (2014) and Howson et al. (2015) were adopted within this study and evaluated for SVDV and VSNJV detection. Importantly, the dilution factor of 1:5 for epithelial suspensions was shown to be suitable for preparation of epithelial tissue from all three diseases which allowed all assays to be conducted using a common single sample/single tube multiplex assay protocol. Multiplexing the RT-LAMP assays had no effect on the ability of the assay to correctly detect and type the virus (between diseases) for any of the assay formats or visualisation methods with the exception of when the SVDV RT-LAMP assay was multiplexed with the FMDV primers and visualised using fluorescence. In this scenario, and similar to observations made above, two FMDV clinical samples were not detected. Therefore, in this study, and when using extracted RNA the lowest analytical sensitivity was achieved using molecular LFD’s, rather than visualising the assay using fluorescence. In conclusion, this paper presents the development and evaluation of a novel singleplex RT-LAMP assay for the rapid detection of VSNJV, and the preliminary laboratory validation of multiplex formats to differentiate between FMD, SVD and VS. There is no requirement for prior RNA extraction, thus allowing the addition of raw epithelial homogenates to the assay directly, whilst maintaining a similar analytical sensitivity to the equivalent rRT-PCR assay. Further work is now required to confirm that the VSNJV RTLAMP assay can detect viruses within NJ clade VI, to confirm how the assay would be affected in the unlikely event of more than one target virus being present and to then formulate this assay into kit formats suitable for field deployment, in addition to continuing validation and assessment of further sample types. Acknowledgements The authors acknowledge the support provided from the U.S. Department of Homeland Security under award no. HSHQDC-12J-00415 through Texas A&M AgriLife Research and the Institute for Infectious Diseases (IIAD). The views expressed herein should not be interpreted as necessarily representing the official policies, either expressed or implied, of the U.S. Department of Homeland Security. The authors would also like the acknowledge the support provided by UK Department of Environment, Food and Rural Affairs (Project SE1127) and the European Union FP7-KBBE-2011-5 under grant agreement no. 289364 (RAPIDIA-Field), the views expressed herein can in no way be taken to reflect the official opinion of the European Union. Additional core-fund funding was provided by an Institute Strategic Programme Grant from the Biotechnology and Biological Sciences Research Council (BBSRC). The authors would like to thank Dr Alfonso Clavijo (Institute for Infectious Animal Diseases, Texas A&M), NCFAD-Canadian Food Inspection Agency, Dr Aurore Romey (Agence nationale de sécurité sanitaire de l’alimentation, de l’environnement et du travail), Klaas Weerdmeester and Aldo Dekker from Central Veterinary Institute and colleagues in the WRLFMD (The Pirbright Institute, UK) for provision of virus samples. References Blomström, A., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147, 188–193. Callahan, J.D., Brown, F., Osorio, F.A., Sur, J.H., Kramer, E., Long, G.W., Lubroth, J., Ellis, S.J., Shoulars, K.S., Gaffney, K.L., Rock, D.L., Nelson, W.M., 2002. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J. Am. Vet. Med. Assoc. 220, 1636–1642. Chen, H.T., Zhang, J., Liu, Y.S., Liu, X.T., 2011a. Detection of foot-and-mouth disease virus RNA by reverse transcription loop-mediated isothermal amplification. Virol. J. 9 (November (8)), 510, http://dx.doi.org/10.1186/1743-422X-8-510.
Chen, H.T., Zhang, J., Liu, Y.S., Liu, X.T., 2011b. Rapid typing of foot-and-mouth disease serotype Asia 1 by reverse transcription loop-mediated isothermal amplification. Virol. J. 8 (October (31)), 489, http://dx.doi.org/10.1186/1743422X-8-489. Ding, Y.Z., Zhou, J.H., Ma, L.N., Qi, Y.N., Wei, G., Zhang, J., Zhang, Y.G., 2014. A reverse transcription loop-mediated isothermal amplification assay to rapidly diagnose foot-and-mouth disease virus C. J. Vet. Sci. 15 (3), 423–426, Epub 2014 Apr 2. Dukes, J.P., King, D.P., Alexandersen, S., 2006. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 151, 1093–1106. Ferris, N.P., Nordengrahn, A., Hutchings, G.H., Reid, S.M., King, D.P., Ebert, K., Paton, D.J., Kristersson, T., Brocchi, E., Grazioli, S., Merza, M., 2009. Development and laboratory validation of a lateral flow device for the detection of foot-and-mouth disease virus in clinical samples. J. Virol. Methods 155 (January (1)), 10–17, http://dx.doi.org/10.1016/j.jviromet.2008.09.009, Eub 2008 Nov 5. Ferris, N.P., Nordengrahn, A., Hutchings, G.H., Paton, D.J., Kristersson, T., Brocchi, E., Grazioli, S., Merza, M., 2010a. Development and laboratory validation of a lateral flow device for the detection of serotype SAT 2 foot-and-mouth disease viruses in clinical samples. J. Virol. Methods 163 (February (2)), 474–476, http://dx.doi.org/10.1016/j.jviromet.2009.09.022, Epub 2009 Oct 6. Ferris, N.P., Nordengrahn, A., Hutchings, G.H., Paton, D.J., Kristersson, T., Merza, M., 2010b. Development and laboratory evaluation of a lateral flow device for the detection of swine vesicular disease virus in clinical samples. J. Virol. Methods 163 (February (2)), 477–480, http://dx.doi.org/10.1016/j.jviromet.2009.09.023, Eub 2009 Oct 9. Ferris, N.P., Clavijo, A., Yang, M., Velazquez-Salinas, L., Nordengrahn, A., Hutchings, G.H., Kristersson, T., Merza, M., 2012. Development and laboratory evaluation of two lateral flow devices for the detection of vesicular stomatitis virus in clinical samples. J. Virol. Methods 180 (March (1–2)), 96–100, http://dx.doi. org/10.1016/j.jviromet.2011.12.010, Epub 2011 Dec 29. Hole, K., Velazques-Salina, L., Clavijo, A., 2010. Improvement and optimization of a multiplex real-time reverse transcription polymerase chain reaction assay for the detection and typing of vesicular stomatitis virus. J. Vet. Diagn. Invest. 22, 428–433, http://dx.doi.org/10.1177/104063871002200315. Howson, E.L.A., Armson, B., Madi, M., Kasanga, C.J., Kandusi, S., Sallu, R., Chepkwony, E., Siddle, A., Martin, P., Wood, J., Mioulet, V., King, D.P., Lembo, T., Cleaveland, S., Fowler, V.L., 2015. Evaluation of two lyophilised molecular assays to rapidly detect foot-and-mouth disease virus directly from clinical samples in field settings. Transbound. Emerg. Dis., http://dx.doi.org/10.1111/ tbed.12451. James, H.E., Eberta, K., McGonigle, R., Reid, S.M., Boonham, N., Tomlinson, J.A., Hutchings, G.H., Denyer, M., Oura, C.A.L., Dukes, J., King, D.P., 2010. Detection of African swine fever virus by loop-mediated isothermal amplification. J. Virol. Methods 164, 68–74. King, D.P., Dukes, J.P., Reid, S.M., Ebert, K., Shaw, A.E., Mills, C.E., Boswell, L., Ferris, N.P., 2008. Prospects for rapid diagnosis of foot-and-mouth disease in the field using reverse transcriptase-PCR. Vet. Rec. 162, 315–316, http://dx.doi.org/10. 1136/vr.162.10.315. Letchworth, G.J., Rodriguez, L.L., Barrera, J.C., 1999. Vesicular stomatitis. Vet. J. 157, 239–260. Madi, M., Hamilton, A., Squirrell, D., Mioulet, V., Evans, P., Lee, M., King, D.P., 2012. Rapid detection of foot-and-mouth disease virus using a field-portable nucleic acid extraction and real-time PCR amplification platform. Vet. J. 193 (July (1)), 67–72, http://dx.doi.org/10.1016/j.tvjl.2011.10.017, Epub 2011 Nov 23. Morioka, K., Kukai, K., Yoshida, K., Kitano, R., Yamazoe, R., Yamada, M., Nishi, T., Kanno, T., 2015. Development and evaluation of a rapid antigen detection and serotyping lateral flow antigen detection system for foot-and-mouth disease virus. PLoS One 10 (August (8)), e0134931, http://dx.doi.org/10.1371/journal. pone.0134931, eCollection 2015. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), e63. Oem, J.K., Ferris, N., Lee, K.-N., Joo, Y.-S., Hyun, B.-H., Park, J.-H., 2009. Simple and rapid lateral-flow assay for the detection of foot-and-mouth disease virus. Clin. Vaccine Immunol. 16 (November (11)), 1660–1664, http://dx.doi.org/10.1128/ cvi.00213-09, Epub 2009 Sep 2. Rainwater-Lovett, K., Pauszek, S.J., Kelley, W.N., Rodriguez, L.L., 2007. Molecular epidemiology of vesicular stomatitis New Jersey virus from the 2004–2005 US outbreak indicates a common origin with Mexican strains. J. Gen. Virol. 88, 2042–2051. Reid, S.M., Ferris, N.P., Hutchings, G.H., King, D.P., Alexandersen, S., 2004. Evaluation of real-time reverse transcription polymerase chain reaction assays for the detection of swine vesicular disease virus. J. Virol. Methods 116 (March (2)), 169–176. Shao, J.J., Chang, H.Y., Zhou, G.Q., Cong, G.Z., Du, J.Z., Lin, T., Gao, S.D., He, J.J., Liu, X.T., Liu, J.X., Gao, J.L., 2010. Rapid detection of foot-and-mouth disease virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP). Intern. J. Appl. Res. Vet. Med. 8 (2), 133–142. Shaw, A.E., Reid, S.M., Ebert, K., Hutchings, G.H., Ferris, N.P., King, D.P., 2007. Implementation of a one-step real-time RT-PCR protocol for diagnosis of foot-and-mouth disease. J. Virol. Methods 143, 81–85. Velazquez-Salinas, L., Pauszek, S.J., Zarate, S., Basurto-Alcantara, F.J., Verdugo-Rodriguez, A., Perez, A.M., Rodriguez, L.L., 2014. Phylogeographic characteristics of vesicular stomatitis New Jersey viruses circulating in Mexico from 2005 to 2011 and their relationship to epidemics in the United States.
Author's Personal Copy V.L. Fowler et al. / Journal of Virological Methods 234 (2016) 123–131 Virology 449 (January (20)), 17–24, http://dx.doi.org/10.1016/j.virol.2013.10. 025, Eub 2013 Nov 14. Waters, R.A., Fowler, V.L., Armson, B., Nelson, N., Gloster, J., Paton, D.J., King, D.P., 2014. Preliminary validation of direct detection of foot-and-mouth disease virus within clinical samples using reverse transcription loop-mediated isothermal amplification coupled with a simple lateral flow device for detection. PLoS One 9, e105630. Wilson, W.C., Letchworth, G.J., Jiménez, C., Herrero, M.V., Navarro, R., Paz, P., Cornish, T.E., Smoliga, G., Pauszek, S.J., Dornak, C., George, M., Rodriguez, L.L., 2009. Field evaluation of a multiplex real-time reverse transcription polymerase chain reaction assay for detection of vesicular stomatitis virus. J. Vet. Diagn. Invest. 21 (March (2)), 179–186.
131
Yamazaki, W., Mioulet, V., Murray, L., Madi, M., Haga, T., Misawa, N., Horii, Y., King, D.P., 2013. Development and evaluation of multiplex RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J. Virol. Methods 192 (September (1–2)), 18–24, http://dx.doi.org/10.1016/j.jviromet.2013.03.018, Epub 2013 Apr 12. Yang, M., Goolia, M., Xu, W., Bittner, H., Clavijo, A., 2013. Development of a quick and simple detection methodology for foot-and-mouth disease virus serotypes O, A and Asia 1 using a generic RapidAssay Device. Virol. J. 10 (April (22)), 125, http://dx.doi.org/10.1186/1743-422x-10-125.
