Development of reverse transcription recombinase ...

Journal of Virological Methods 223 (2015) 45–49

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection Nahed Yehia a,∗ , Abdel-Satar Arafa a , Ahmed Abd El Wahed b , Ahmed A. El-Sanousi c , Manfred Weidmann d , Mohamed A. Shalaby c a

National Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Dokki, Giza 12618, Egypt Unit of Infection Models, German Primate Center, Kellnerweg 4, 37077 Goettingen, Germany c Department of Virology, Faculty of Veterinary Medicine, Cairo University, Egypt d Institutes of Aquaculture, Stirling University, Scotland, UK b

a b s t r a c t Article history: Received 6 April 2015 Received in revised form 16 July 2015 Accepted 23 July 2015 Available online 28 July 2015 Keywords: Avian influenza Subtype H5N1 Recombinase polymerase amplification assay Real-time RT-PCR

The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Highly pathogenic avian influenza (HPAI) caused by H5N1 subtype of influenza A virus, is a highly contagious avian disease (OIE, 2011). Due to its transmissibility, HPAI H5N1 viruses found in poultry pose a threat to human health (FAO, 2011). Since 2003, H5N1 was the cause of economic losses in the poultry industry with 400 million poultry culled and a monetary loss of around US$20 billion (FAO, 2012). Since 2006, HPAI outbreaks have reached over

Abbreviations: HPAI, highly pathogenic avian influenza; AIV, avian influenza virus; real-time RT-PCR, real-time reverse transcription polymerase chain reaction; RPA, recombinase polymerase amplification; RT-RPA, reverse transcription RPA; nt, nucleotides; HA, hemagglutinin; ILT, infectious laryngotracheitis; IBV, infectious bronchitis virus; NDV, newcastle disease virus; MG, Mycoplasma gallisepticum; CT, cycle threshold; TT, threshold time; EID50 , embryo infectious dose5 ; RT-LAMP, real-time fluorescent reverse transcription loop-mediated isothermal amplification. ∗ Corresponding author at: National Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, 7 Nadi Elsaid Street, Dokki, Giza 12618, Egypt. E-mail address: [email protected] (N. Yehia). http://dx.doi.org/10.1016/j.jviromet.2015.07.011 0166-0934/© 2015 Elsevier B.V. All rights reserved.

60 countries (FAO, 2011). In Egypt, HPAI H5N1 caused a severe outbreak, which led to 100% mortality in 2006 (Aly et al., 2008). An H5N1 virus is now endemic in Egypt (FAO, 2011). Usually, the avian influenza virus (AIV) infects humans after close contact with infected poultry. Almost 784 laboratory-confirmed human cases of HPAI H5N1 virus have been officially reported to the World Health Organization (WHO, 2015) from 16 countries. From January to February 2015, the WHO recorded 65 cases of H5N1 infections including 13 deaths in Egypt (WHO, 2015). The rapid viral detection can help with the control of a viral spread so it can reduce serious economic losses and human infection (OIE, 2008). Routine detection and characterization of AIVs is performed with viral isolation, which needs at least 2–3 days. To directly identify AIV in field samples, real-time reverse transcription polymerase chain reaction (real-time RT-PCR) produces results more rapidly (OIE, 2014). However, it has some fundamental limitations; real-time RT-PCR requires a sophisticated thermal cycler and a complicated experimental setup. In addition, the RT-PCR assay has a runtime of 90 min (Abd El Wahed et al., 2013a; Aryan et al., 2010; Bachmann et al., 2009).

46

N. Yehia et al. / Journal of Virological Methods 223 (2015) 45–49

Recombinase polymerase amplification (RPA) has been developed for the rapid diagnosis of different pathogens (Abd El Wahed et al., 2013a,b; Amer et al., 2013; Piepenburg et al., 2006). It has shown equal sensitivity to real-time RT-PCR (Chow et al., 2008; Vincent et al., 2004). RPA is an isothermal DNA amplification method, where initial heating for DNA denaturation is not required (Kim and Easley, 2011). Instead, RPA uses oligonucleotide primers that bind with phage-derived recombinase enzyme UvsX for strand invasion. Strand displacement and the extension produced by the Sau polymerase lead to the generation of an amplified doublestranded DNA (Piepenburg et al., 2006). The real-time detection of RPA amplicons relies on the Exonuclease III, which cuts at the internal tetrahydrofuran (THF) present in exo-probes. This leads to the separation of fluorophore and quencher (Euler et al., 2012a,b, 2013). The present study describes the development of a real-time reverse transcription RPA (RT-RPA) assay for the rapid detection of the hemagglutinin (HA) gene of AIV (H5N1). 2. Material and methods 2.1. Generation of RNA molecular standard A RNA molecular standard was developed using the Egyptian H5N1 reference strain A/chicken/Egypt/1273CA/2012 (GenBank accession number KJ522712.1). To amplify 970 base pairs (bp) of the conserved region, HA2, of the H5 gene, the RNA was reverse transcribed and amplified with the use of the QIAGEN One Step RTPCR kit (Qiagen, Hilden, Germany). The forward primer H5- kha-1 “CCTCCAGARTATGCMTAYAAAATTGTC” (Slomka et al., 2007a) and the reverse primer Bm-NS-890R “ATA TCG TCT CGT ATT AGT AGG AAA CAA GGG TGT TTT” (Hoffmann et al., 2001) were used with the following protocol: reverse transcription (RT) step 50 ◦ C/30 min, initial activation at 95 ◦ C/15 min, 40 cycles of 94 ◦ C/30 s, 56 ◦ C/60 s and 72 ◦ C/2 min as well as a final extension step of 72 ◦ C/10 min. The amplified fragment was ligated into plasmid pCRII using the TA cloning kit dual promoter with one-shot chemically competent Escherichia coli (Invitrogen, Darmstadt, Germany). The ligated fragment was confirmed through sequencing (Seq lab, Gottingen, Germany). The RNA was transcribed by using the SP6/T7 transcription kit (Roche, Germany) and measured with the Quant-iTTM RiboGreen RNA Assay Kit (Life Technologies, Darmstadt, Germany) in accordance with the manufacturer’s instructions. 2.2. H5 RT-RPA primers and exo-probe Three forward, three reverse primers and one exo-probe were used to select the set yielding the highest H5 RT-RPA assay sensitivity. They were designed in reference to 600 HA gene sequence of the H5N1 AIV isolated made available from the GenBank. The multiple sequence alignment was performed using the MegAlign program (DNASTAR, Inc. in Madison, Wisconsin USA). RPA Primers and exo-probe were designed in accordance with the Twist AmpTM exo RT kits manual (Twist Dx, Cambridge, UK). The lengths of the designed primers ranged from 30 to 32 nuceotides (nt). The exoprobe was placed into the positive sense strand and consisted of 30 nt at 5 and 15 nt at 3 of the basic site mimic (Table 1). 2.3. H5 RT-RPA conditions The H5 RT-RPA was performed in a 50 ␮l reaction volume according to the following formula: 10 pmol of each RPA primers, 10 pmol of the RPA exo-probe, 14 mM of magnesium acetate, 29.5 ␮l rehydration buffer (TwistDx, Cambridge, UK), 1 ␮l RNA template and nuclease-free water (Qiagen, Hilden, Germany) to adjust the reaction volume to 50 ␮l. This mix was added to each tube of

Table 1 Sequence of selected primers and exo-probe for H5 RT-RPA assay. Name

Sequence

H5 RPA-F3 H5 RPA-R1 H5 Exo- probe

TAACGGTTGTTTCGAGTTCTATCACAGATG ACTTATTTCCTCTCTTTTTAATCTTGCTTC GTATGGAAAGTGTAAGAAACGGAACGTA (BHQ1-dT) (THF)(FAM-dT)TACCCGCARTATTC-PH

F, forward; R, reverse primers; BHQ1-dT, dT-fluorophore; THF, tetrahydrofuran; FAM-dT, dT-quencher group; PH, phosphate group.

a RPA Twist Amp exo RT strip containing a dried enzyme pellet (TwistDx, Cambridge, UK). In order to avoid false negative and positive results, external positive and negative controls were included in our assay workflow. Fluorescence detection in the FAM channel was performed in an ESE Quant tubescanner (Qiagen, GmbH, Germany) at 42 ◦ C for 20 min. A combined threshold confirmed by 1st derivative analysis offered by the tubescanner studio software (Qiagen, GmbH, Germany) was used for signal interpretation. A true positive must present an increase in the fluorescence intensity in both the accumulative fluorescence over time and in the 1st derivative analysis (Fig. S1). A negative sample might show a slight increase in the fluorescence intensity over time but not in the 1st derivative analysis (Abd El Wahed et al., 2015). 2.4. H5 RT-RPA assay sensitivity The analytical sensitivity of the H5 RT-RPA assay was tested using a dilution range of in vitro transcribed H5 molecular RNA standard from 105 to one molecules/␮l in eight reaction replicates and compared to the real-time RT-PCR. The real-time RT-PCR condition and primers/probe were performed as previously described (Slomka et al., 2007b) using the Quantitect probe RT-PCR kit (Qiagen, Inc., Valencia, CA). The RT-RPA threshold time was plotted against RNA molecules detected and a semi-log regression was calculated with PRISM (Graphpad Software Inc. version 6.0 Mac, San Diego, California). 2.5. H5 RT-RPA specificity The specificity of the H5 RT-RPA assay was determined by testing H5N1 virus A/chicken/Egypt/1273CA/2012(H5N1) containing 105 RNA molecule/␮l and nucleic acid from other pathogens listed in Table 2. 2.6. Clinical performance of H5 RT-RPA Thirty tracheal swabs from field cases in Egypt (Table S1) as well as twelve H5 negative tracheal swabs from SPF chicks and apparently healthy chicken were tested by both H5 RT-RPA and real-time RT-PCR assays. The swabs were promptly transported to the laboratory. During transportation, the sample was kept on ice and was stored at −80 ◦ C in the laboratory until used. Two-hundred microliter of phosphate-buffered saline (PBS) suspensions containing tracheal swabs were used in the extraction. The viral RNA was extracted by using the QIAamp Viral RNA Mini Kit following the manufacturer’s instructions (Qiagen, Hilden, Germany). RNA was eluted in a final volume of 60 ␮l and stored at −80 ◦ C. To determine the relationship between real-time RT-PCR cycle threshold (CT) values and H5 RT-RPA threshold time (TT), a linear regression analysis was performed with PRISM (Graphpad Software Inc. version 6.0 Mac, San Diego, California). To check the impact of new virus mutations on the primers and exo-probe binding sites of HA gene, a multiple sequence alignment was generated with five sequences from recent field samples;

N. Yehia et al. / Journal of Virological Methods 223 (2015) 45–49

47

Table 2 List of pathogens used for testing the specificity of the H5 RT-RPA. No unspecific amplification was detected. Name

AIV H9N2 AIV H7N1 Infectious Bronchitis Virus (IBV) Newcastle Disease Virus (NDV) Mycoplasma gallisepticum (MG) Infectious Laryngotracheitis (ILT)

Source

Identification

Reference

Technique

Result (CT)

GD Lab., the Netherlands

Real-time RT-PCR

Cornell University Diagnostic Lab., New York, USA. GD Lab., the Netherlands

Real-time PCR PCR

20 17 16 14 17 Positive

Ben Shabat et al. (2010) Veterinary laboratories agency, UK Meir et al. (2010) Wise et al. (2004) Callison et al. (2006) Chacon and Ferreira (2009)

Fig. 1. Sensitivity of H5 RT-RPA assay using in vitro transcription molecular standard of a dilution range from 105 to one molecule of RNA. F3 + R1 + exo-probe detected down to one RNA molecule represented by dot; 10, triangular; 102 , box; 103 , star; 104 , cross, 105 , circle; negative control, line. After 3 min, a mixing step is used to increase the assay sensitivity. This interrupts reading of the fluorescence signal.

A/chicken/Egypt/14126S/2014, A/turkey/Egypt/14125S/2014, A/chicken/Egypt/1456CAL/2014 (available on the GenBank accession numbers: KP209299, KP209298, KR002638, respectively) and A/duck/Egypt/144A/2014, A/chicken/Egypt/14168CA/2014 (available on the GISAID accession numbers: EPI573323, EPI573327-8, respectively). 3. Results 3.1. H5 RT-RPA sensitivity A dilution range of 105 –1 molecules/␮l of the H5 RNA standard was used to determine the analytical sensitivity of the H5 RT-RPA assay. Primers F3 and R1 (Table 1) yielded an analytical sensitivity of one RNA molecule detected at a runtime between 5 and 7 min (Figs. 1 and S1). While, the real-time RT-PCR detected one RNA molecule in 60–90 min (Fig. S2). To determine the assay reproducibility, the RT-RPA assay was performed eight times on the molecular RNA standard and a semi-logarithmic regression analysis was performed (Fig. 2). The RT-RPA consistently detected 105 to one RNA molecules in all eight runs and therefore a probit regression was not applied.

3.2. H5 RT-RPA specificity The F3 and R1 primers were highly specific. It detected only the H5N1 viruses but not the H9N2, H7N1, ILT, IBV, NDV and MG (Table 2 and Fig. S3). Moreover, when using tracheal swabs from apparent healthy chicken and SPF chicks, no unspecific amplification was noticed.

Fig. 2. Semi logarithmic regression of the data collected from eight H5 RT-RPA test runs on the RNA standard using PRISM. It yielded results between 5 and 7 min. In the H5 RT-RPA assay, 105 -one RNA molecules were detected in 8 out of 8 RT-RPA runs. No error bars are shown in 105 –103 RNA molecules because the results were consistence in the eight RT-RPA runs.

3.3. Clinical performance of H5 RT-RPA The clinical sensitivity of the H5 RT-RPA assay was tested in 30 field samples (Table S1). The sensitivity of both the H5 RT-RPA and real-time RT-PCR assays was 100%. The linear regression analysis of H5 RT-RPA TT and real-time RT-PCR CT was performed. The R2 value was 0.02 (Fig. 3). The H5 RT-RPA assay detected the H5N1 field viruses isolated recently in Egypt. These viruses have shown some point mutations in the HA gene. Multiple alignments of sequences from five field samples at the binding sites of the RPA primers and probe were performed. Two to four point mutations were found at the binding

48

N. Yehia et al. / Journal of Virological Methods 223 (2015) 45–49

Fig. 3. Comparison between RT-RPA and real-time RT-PCR for the detection of H5 gene in clinical samples. Linear regression analysis of H5 RT-RPA threshold time (TT, Y-axis) and real-time RT-PCR cycle threshold values (CT, X-axis) were determined by PRISM. Total number of sample tested was thirty. Results of 30 samples are represented by dots. Seven dots represent doubles with CT and TT values at the same points (see Table S1).

site of the exo-probe and one mutation was present at the RPA forward primer (Fig. 4). 4. Discussion AIV can lead to severe economic losses in the poultry industry and poses a serious risk for humans. Rapid detection of AIV in the field can limit the viral spread in poultry and decrease the susceptibility of the infection to humans (FAO, 2011; OIE, 2008). During the past decade, AIV diagnosis by real-time RT-PCR provided sensitive detection and therefore became the method of choice in many laboratories (OIE, 2014; Suarez et al., 2007). However, since quite heavy, complex and costly devices are needed, it is difficult to perform in the field (Boyle et al., 2013). In this study, the RT-RPA assay was developed for the sensitive and specific detection of the H5 gene. RPA relies on a 5 strand invasion of the primers at the region of homology. Properties of the RPA primers for an efficient strand invasion are not discernible (Euler et al., 2013). Therefore, three forward, three reverse primers and one exo-probe sets were designed. There were nine possible combinations of primer pairs that were tested to amplify as little as one copy of in vitro transcribed RNA standard. The F3+R1 primers produced the highest sensitivity (one RNA molecule detected). There are different approaches of assessing the analytical sensitivity of molecular assays for the detection of Influenza strains: Embryo Infectious Dose5 (EID50 ) dilution ranges or in vitro transcribed quantitative RNA standards. EID50 traces the presence of completely infective viral particles. However, the estimation of real-time RT-PCR sensitivity using EID50 is a laborious technique and can only be performed in

specialized laboratories. It however does not consider free RNA molecules (Lee and Suarez, 2004), which can lead to the loss of analytical sensitivity. In contrast, molecular RNA standards are more accurate, easy, quick and reproducible methods (Fronhoffs et al., 2002). The H5 RT-RPA is highly specific and does not detect different pathogen producing similar respiratory manifestation in poultry or apparently healthy chicken. This is probably due to the long AIV H5 specific RPA primers and exo-probe. The specificity of H5 RT-RPA is similar to real-time RT-PCR, which can amplify target nucleic acids in the presence of the background DNA (Slomka et al., 2007b). Internal positive and negative controls were not included in our assay. We used external positive and negative controls to avoid false results. RT-RPA assay for the detection of Sigma virus was recently developed (Euler et al., 2013). Sigma virus is a good candidate to be used in the future as an externally added positive control. The clinical performance of the H5 RT-RPA assay was tested using 30 field samples. The results were compared with the realtime RT-PCR results. The clinical sensitivity of both H5 RT-RPA and real-time RT-PCR was 100%. The H5 RT-RPA detected samples containing low viral RNA titers (two samples were detected at CT 35 and three above at CT 35 in real-time RT-PCR). Linear regression analysis of CT and TT values of real-time RT-PCR and H5 RT-RPA showed no correlation because the regular cycle fashion in real-time PCR, accordingly, the RT-RPA is not suitable for the quantitative analysis of nucleic acid. The H5 RT-RPA can detect multiple mutant strains of H5N1 field samples in the presence of up to four mutations in the sequence of RPA primers and exo-probe (Fig. 4). The long RPA primers and exo- probe compensate the mismatches in the target sequence. As previously reported in a study using an HIV-1 RPA assay, nine mutations within the RPA primers and the exo- probe did not affect the assay performance (Boyle et al., 2013) and in a foot and mouth disease virus RT-RPA assay, up to five mutations were tolerated (Abd El Wahed et al., 2013a). In addition, the position of the mismatches did not influence the clinical sensitivity of the RT-RPA assay (Abd El Wahed et al., 2013a; Amer et al., 2013). Altogether, this indicates that RT-RPA detection is a reliable tool even in the face of new emerging virus variants in the field. Recently, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of the AIV H5 gene (Imai et al., 2006, 2007; Jung et al., 2015; Liu et al., 2013; Postel et al., 2010). The H5 RT-RPA is faster than RT-LAMP (5–7 min in H5 RT-RPA compared to 30–60 min in real time RTLAMP). Moreover, RPA requires a single pair of primers and a probe, while RT-LAMP needs at least six primers. In conclusion, the developed H5 RT-RPA used for the detection of H5 AIV was rapid (results in a maximum of 7 min), simple and sensitive. It was operated with a portable device and is therefore easily implemented in the field. RT-RPA assay could assist to decide on proper strategic and control measures. This technique can be used for epidemiological surveillance activities for H5N1 rapid detection to identify hot spots. Nevertheless, due to the legislation in many countries including Egypt, the results must be confirmed by governmental laboratories.

Fig. 4. Multiple alignments of the RPA F3, R1 primers and exo-probe with five field samples sequences.

N. Yehia et al. / Journal of Virological Methods 223 (2015) 45–49

Acknowledgements The study was funded by National Laboratory for Quality Control on Poultry Production. The Authors thank the Andrea Koch, Department of Virology, University Medical Center, Goettingen, Germany, for producing the in vitro transcribed RNA standard. We thank Shereen Petersen for English proofreading. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jviromet.2015. 07.011 References Abd El Wahed, A., El-Deeb, A., El-Tholoth, M., Abd El Kader, H., Ahmed, A., Hassan, S., Hoffmann, B., Haas, B., Shalaby, M.A., Hufert, F.T., Weidmann, M., 2013a. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus. PLoS ONE 8, e71642. Abd El Wahed, A., Patel, P., Heidenreich, D., Hufert, F.T., Weidmann, M., 2013b. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus. PLoS Curr. 5, 1–11. Abd El Wahed, A., Patel, P., Faye, O., Thaloengsok, S., Heidenreich, D., Matangkasombut, P., Manopwisedjaroen, K., Sakuntabhai, A., Sall, A.A., Hufert, F.T., 2015. Recombinase polymerase amplification assay for rapid diagnostics of dengue infection. PLoS ONE 10, e0129682. Aly, M.M., Arafa, A., Hassan, M.K., 2008. Epidemiological findings of outbreaks of disease caused by highly pathogenic H5N1 avian influenza virus in poultry in Egypt during 2006. Avian Dis. 52, 269–277. Amer, H.M., Abd El Wahed, A., Shalaby, M.A., Almajhdi, F.N., Hufert, F.T., Weidmann, M., 2013. A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay. J. Virol. Methods 193, 337–340. Aryan, E., Makvandi, M., Farajzadeh, A., Huygen, K., Bifani, P., Mousavi, S.L., Fateh, A., Jelodar, A., Gouya, M.M., Romano, M., 2010. A novel and more sensitive loop-mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex. Microbiol. Res. 165, 211–220. Bachmann, L.H., Johnson, R.E., Cheng, H., Markowitz, L.E., Papp, J.R., Hook 3rd, E.W., 2009. Nucleic acid amplification tests for diagnosis of Neisseria gonorrhoeae oropharyngeal infections. J. Clin. Microbiol. 47, 902–907. Ben Shabat, M., Meir, R., Haddas, R., Lapin, E., Shkoda, I., Raibstein, I., Perk, S., Davidson, I., 2010. Development of a real-time TaqMan RT-PCR assay for the detection of H9N2 avian influenza viruses. J. Virol. Methods 168, 72–77. Boyle, D.S., Lehman, D.A., Lillis, L., Peterson, D., Singhal, M., Armes, N., Parker, M., Piepenburg, O., Overbaugh, J., 2013. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification. mBio 4, e00135–e00213. Callison, S.A., Riblet, S.M., Sun, S., Ikuta, N., Hilt, D., Leiting, V., Kleven, S.H., Suarez, D.L., Garcia, M., 2006. Development and validation of a real-time Taqman polymerase chain reaction assay for the detection of Mycoplasma gallisepticum in naturally infected birds. Avian Dis. 50, 537–544. Chacon, J.L., Ferreira, A.J., 2009. Differentiation of field isolates and vaccine strains of infectious laryngotracheitis virus by DNA sequencing. Vaccine 27, 6731–6738. Chow, W.H., McCloskey, C., Tong, Y., Hu, L., You, Q., Kelly, C.P., Kong, H., Tang, Y.W., Tang, W., 2008. Application of isothermal helicase-dependent amplification with a disposable detection device in a simple sensitive stool test for toxigenic Clostridium difficile. J. Mol. Diagn. 10, 452–458. Euler, M., Wang, Y., Nentwich, O., Piepenburg, O., Hufert, F.T., Weidmann, M., 2012a. Recombinase polymerase amplification assay for rapid detection of Rift Valley fever virus. J. Clin. Virol. 54, 308–312. Euler, M., Wang, Y., Otto, P., Tomaso, H., Escudero, R., Anda, P., Hufert, F.T., Weidmann, M., 2012b. Recombinase polymerase amplification assay for rapid detection of Francisella tularensis. J. Clin. Microbiol. 50, 2234–2238.

49

Euler, M., Wang, Y., Heidenreich, D., Patel, P., Strohmeier, O., Hakenberg, S., Niedrig, M., Hufert, F.T., Weidmann, M., 2013. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents. J. Clin. Microbiol. 51, 1110–1117. FAO, 2011. Approach to Controlling, Preventing and Eleminating H5N1 Highly Pathogenic Avian Influenza Endemic Countries Animal Production and Health Paper. No. 171 (electronic resource). FAO, 2012. Global Overview H5N1 HPAI, 31 (electronic resource). Fronhoffs, S., Totzke, G., Stier, S., Wernert, N., Rothe, M., Bruning, T., Koch, B., Sachinidis, A., Vetter, H., Ko, Y., 2002. A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Mol. Cell Probes 16, 99–110. Hoffmann, E., Stech, J., Guan, Y., Webster, R.G., Perez, D.R., 2001. Universal primer set for the full-length amplification of all influenza A viruses. Arch. Virol. 146, 2275–2289. Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., Tashiro, M., Odagiri, T., 2006. Development of H5-RT-LAMP (loop-mediated isothermal amplification) system for rapid diagnosis of H5 avian influenza virus infection. Vaccine 24, 6679–6682. Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., Van Tu, P., Tien, N.T., Tashiro, M., Odagiri, T., 2007. Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop-mediated isothermal amplification method. J. Virol. Methods 141, 173–180. Jung, J.H., Oh, S.J., Kim, Y.T., Kim, S.Y., Kim, W.J., Jung, J., Seo, T.S., 2015. Combination of multiplex reverse-transcription loop-mediated isothermal amplification with an immunochromatographic strip for subtyping influenza A virus. Anal. Chim. Acta. 853, 541–547. Kim, J., Easley, C.J., 2011. Isothermal DNA amplification in bioanalysis: strategies and applications. Bioanalysis 3, 227–239. Lee, C.W., Suarez, D.L., 2004. Application of real-time RT-PCR for the quantitation and competitive replication study of H5 and H7 subtype avian influenza virus. J. Virol. Methods 119, 151–158. Liu, Y., Tang, J.M., Tao, H., Sun, J., Lu, T.K., Liao, L.S., Liu, J.L., Zeng, S.L., Cao, C.F., Zhang, C.H., Ruan, Z.X., Lv, J.Q., Yang, J.X., Hua, Q.Y., Chen, Z.L., Qin, Z.F., 2013. Establish and optimization of real-time fluorescent reverse transcription loop-mediated isothermal amplification for detection of avian influenza H5 hemagglutinin gene. Bing Du Xue Bao 29, 488–494. Meir, R., Maharat, O., Farnushi, Y., Simanov, L., 2010. Development of a real-time TaqMan RT-PCR assay for the detection of infectious bronchitis virus in chickens, and comparison of RT-PCR and virus isolation. J. Virol. Methods 163, 190–194. OIE, 2008. Avian Influenza in Manual of Diagnostic Tests and Vaccines for Terrestrial Animals., pp. 465–481. OIE, 2011. Terrestrial Animal Health Code Volume II, Section 10.4 (electronic resource). OIE, 2014. Avian Influenza, Chapter 2.3.4 (electronic resource). Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., 2006. DNA detection using recombination proteins. PLoS Biol. 4, e204. Postel, A., Letzel, T., Frischmann, S., Grund, C., Beer, M., Harder, T., 2010. Evaluation of two commercial loop-mediated isothermal amplification assays for detection of avian influenza H5 and H7 hemagglutinin genes. J. Vet. Diagn. Invest. 22, 61–66. Slomka, M.J., Coward, V.J., Banks, J., Londt, B.Z., Brown, I.H., Voermans, J., Koch, G., Handberg, K.J., Jorgensen, P.H., Cherbonnel-Pansart, M., Jestin, V., Cattoli, G., Capua, I., Ejdersund, A., Thoren, P., Czifra, G., 2007a. Identification of sensitive and specific avian influenza polymerase chain reaction methods through blind ring trials organized in the European Union. Avian Dis. 51, 227–234. Slomka, M.J., Pavlidis, T., Banks, J., Shell, W., McNally, A., Essen, S., Brown, I.H., 2007b. Validated H5 Eurasian real-time reverse transcriptase-polymerase chain reaction and its application in H5N1 outbreaks in 2005–2006. Avian Dis. 51, 373–377. Suarez, D.L., Das, A., Ellis, E., 2007. Review of rapid molecular diagnostic tools for avian influenza virus. Avian Dis. 51, 201–208. Vincent, M., Xu, Y., Kong, H., 2004. Helicase-dependent isothermal DNA amplification. EMBO Rep. 5, 795–800. WHO, 2015. Monthly Risk Assessment (electronic resource). Wise, M.G., Suarez, D.L., Seal, B.S., Pedersen, J.C., Senne, D.A., King, D.J., Kapczynski, D.R., Spackman, E., 2004. Development of a real-time reverse-transcription PCR for detection of newcastle disease virus RNA in clinical samples. J. Clin. Microbiol. 42, 329–338.