Isolation and Sequence of a cDNA Clone That Contains the Entire

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1984 by The American Society of Biological Chemists, Inc.

Vol. 259, No. 22, Issue of November 25, pp. 14136-14143,1984 Printed in U.S.A.

Isolation and Sequence of a cDNA Clone That Contains theEntire Coding Region for Chicken Smooth-muscle a-Tropomyosin* (Received for publication, April 16, 1984)

David M. HelfmanS, James R. Feramiscog, William M. Ricci, and Stephen H. Hughes9 From the Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 1 1 724

We have constructed a cDNA-expression library of approximately 100,000 members from embryonic chicken smooth-muscle mRNA using the plasmidexpression vectors pUC8 and pUC9. Using an immunological screening procedure and 32P-labeled cDNA probes, we have identified and isolated clones encoding smooth-muscle tropomyosin. Plasmid pSMT-10 (-1 100 base pairs) was found to hybrid-select mRNA for smooth-muscle a-tropomyosin. DNA-sequence analysis revealed that pSMT-10 contained the entire coding region for a-tropomyosin and portions of the 5’- and 3”untranslated regions. Comparison of the derived amino acid sequence of smooth-muscle a-tropomyosin withknown skeletal-muscle (rabbit and chicken) and platelet (equine) sequences revealed extensive homology between the various proteins. The smooth-muscle tropomyosin showsthe greatest sequence divergence from the skeletal-muscle tropomyosins at the COOH-terminal region. In contrast, the smooth-muscle tropomyosin is most homologousto the platelet tropomyosin at the COOH-terminal end. The relationship of the various tropomyosin sequences to function (e.g. interactions with troponin) are considered.

regulate the calcium-sensitive interaction of actin andmyosin (6). By contrast,smooth-muscleand nonmuscle cells are devoid of troponin. In these tissues, the phosphorylation of myosin by the enzyme myosin light-chain kinase appears to be the majorcalcium-sensitiveregulatory mechanism controlling the interactionof actin and myosin (7). These differences in theregulation of the contractile apparatus in various cell types may require functionally distinct forms of tropomyosin.Biochemicaldifferencesin tropomyosins isolated from skeletal-muscle, smooth-muscle,and nonmuscle cells (brain and platelets) have been reported (4, 8-10). For example, tropomyosins from smooth and skeletalmuscle, brain, and platelets have different effects on the ATPase activityof actomyosin (9) and different binding affinities to fragments of troponin T (10). A first step in understanding the molecular basis for differences invarious forms of tropomyosin will be a determination of their primary structure. The amino acid sequencesof rabbit skeletal-muscle a- and P-tropomyosins (ll),rabbit cardiacmuscle tropomyosin (12), chicken skeletal-muscle a-tropomyosin (amino acids 25-284) (13), and equine platelet ptropomyosins (14) have been published. In the present study, we report the constructionof a cDNA-expression library from embryonic-chicken smooth muscle and the isolation and characterization of a cDNA clone containing the entire coding Tropomyosins are a family of highly-related proteins pres- region for smooth-muscle a-tropomyosin. Thederived amino ent in muscle (skeletal, cardiac, and smooth) andnonmuscle acid sequence is compared with the sequences of other trocells, although different forms of the protein are characteristicpomyosins. of specific cell types. On the basis of migration in one- and two-dimensional acrylamide gels, chicken skeletalmuscle conMATERIALSANDMETHODS tains at least two forms of tropomyosin called a and /3 with Preparation of Chicken Smooth-muscle Poly(A)+ RNA-Total apparent molecular weights of 34,000 and 36,000, respectively smooth-muscle RNA was prepared from 11-day-old embryonic(1). Chicken cardiac muscle contains a single form called a chicken stomachs and gizzards as described (15, 16). Poly(A)+ RNA with apparent molecular weight of 33,500 (l),and smooth was isolated by two cycles of adsorption to andelution from oligo(dT)muscle contains a t leasttwoforms called a and P with cellulose (17). apparent molecular weights of 35,000 and 43,000, respectively Construction of a Smooth-musclecDNA-expressionLibrary-Start(1). Nonmuscle cells also contain multiple formsof tropomy- ing with 25pgof poly(A)+ RNA from smooth muscle, a cDNAosin (2-5). Chicken embryonic fibroblasts havebeen reported expression library was constructed by the double-linker method (18) except that the cDNA was inserted in two vectors, pUC8 and pUC9 to contain as many as seven distinct species of tropomyosin (19). Avian myeloblastosis virus reverse transcriptase wasused in (5). Neither the structural basis nor the functional significance both the first- and second-strand cDNA reactions (20-22). The douof these various forms of tropomyosin areclear. Skeletal- and ble-stranded cDNA, with intact hairpinloops at theends corresponding to the5’ ends of the poly(A)+RNA, was filled in with the Klenow cardiac-muscletropomyosins, in association with troponin, * The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 2 Recipient of a Muscular Dystrophy postdoctoral fellowship. TO whom correspondence should be addressed. Recipient of National Institutes of Health Grant GM28277. 11 Recipient of National Institutes of Health Grant CA29569. Present address, Frederick Cancer Research Facility, P. 0. BOXB, Frederick, MD 21701.

fragment of Escherichia coli DNA polymerase I. The filled-in cDNA was then divided into two aliquots, and one aliquot was ligated to SalI octanucleotide linkers and the other aliquot to EcoRI octanucleotide linkers. The cDNA with Sal1 or EcoRI linkers attached to the end corresponding to the 3’ end of the poly(A)+RNA, then was treated with S1 nuclease to destroy the hairpin loops, and again filled in with the Klenow fragment of E. coliDNA polymerase I. EcoRI linkers were then ligated to thecDNA preparation initially ligated to SalI linkers, and SalI linkers were ligated to the cDNA preparation initially ligated to EcoRI linkers. The double-stranded cDNA with an EcoRI linker at theend corresponding to the 5’end of the RNA and

141.36

Tropomyosin

Smooth-muscle

14137

50, and a portion of the 3”untranslated region (18).Second, thelibrary was screened for bacterial colonies producing proteins antigenically relatedto tropomyosin by the procedure recently developed in our laboratory (18).Fifty-two colonies were found to hybridize to a 32P-probe made from pSMT-6; 39 of these were in the pUC8 library and 13 in the pUC9 library. The immunological screeningproceduredemonstrated that 13 of the 39 colonies in the pUC8 library and 2 of the 13colonies in the pUC9 library were producing products detectable by the anti-tropomyosin serum. In addition, two clones in the pUC8 library that produced proteins immunologically related to tropomyosin did not contain sequences that cross-hybridized to a 32P-probemade from pSMT-6. These colonies have been isolated and, based on sequence analysis and positive hybrid-selection translation, were found to encode a different species of tropomyosin, which will be described in detail elsewhere. Colonies hybridizing to pSMT6 were isolated, and the size of the cDNA inserts were determined. Insert size ranged from 500 to 1100 bp. In order to characterize thebacterial fusion proteins, colonies producing proteins antigenicallyrelated to tropomyosin were grown overnight in liquid culture and their proteins were analyzed on SDS-polyacrylamide gels (Fig. 1).As shown in Fig. 1, the fusion proteins were present in the bacteria ranging in size from M , = 17,000 to 35,000. The largest fusion proteins were found in bacteria containingplasmids with the largest cDNA inserts. pSMT-10 and pSMT-13 contained inserts of approximately 1,100 bp each. The fusion proteins made in E. coli containing pSMT-10 and pSMT-13 were M, = 35,000, approximately the size of smooth-muscle a-tropomyosin.In order to show that these proteins were tropomyosin-related, the protein products were electrophoretically transferred to nitrocellulose (Fig. 1) and checked for immunological crossreactivity. As shown in Fig. 1, these proteins were recognized by anti-tropomyosin antibody. No obvious proteins related to tropomyosin were present in the parentalbacterial DH-1, or DH-1 containing plasmids pUC8 or pUC9. In bacteria expressing some piece of tropomyosin, protein bands thatreact with anti-tropomyosin antibodies can be readily identified. Presumably in these extracts, there is some degradation of the tropomyosin fusion proteins made in the bacteria which gives rise to the lower-molecular-weight bands detected by the antiserum. However, it is unclear whether the putative degradation takes place in vivo or is a resultof the preparation of the bacterial lysates. In order to determine whether pSMT-10 encoded sequences for thea-tropomyosin(apparent M , = 35,000) or the ptropomyosin (apparent M , = 43,000), hybrid-selection translation was carried out using poly(A)+ RNA from 11-13-dayold embryonic-chicken smooth muscle. The in vitro translaRESULTS tion products of mRNA hybridized to pSMT-10 yielded a Identification of Clones Encoding Tropomyosin-Two ap- single protein product with an apparent M , of 35,000 on oneproaches were used to identify recombinant clones encoding dimensional gel electrophoresis which could be immunopretropomyosinfrom thesmooth-muscle cDNA-expression li- cipitated with anti-tropomyosin antibody (data not shown). brary. First, the librarywas screened with a 32P-labeled DNA Further examination of the in vitro translation product by probe made froma 900-bp cDNA encoding a chickensmooth- two-dimensional gel electrophoresis verified that the transmuscle tropomyosin, called pSMT-6, which we had identified lation productco-migratedwith the faster-migrating adult of the translated tropomyosin rather than the slower-migrating species (Fig. previously (18).pSMT-6 contains about 80% region of tropomyosin, beginningat approximately amino acid 2 ) . It is worth noting that the other two major spots seen in Fig. 2B were also present in the translation products when no ’ The abbreviations used are: bp, base pair; SDS, sodium dodecyl RNA was added t o the reticulocyte lysate (data not shown). sulfate; Hepes, 4-(2-hydroxyethyl)-l-piperazineethanesulfonicacid EGTA, ethylene glycol bis(P-amino ethyl)-N,N,N’,N’-tetraacetic DNA-sequence Analysis-Preliminary sequence analysis of acid. pSMT-10 indicated that it contained a portion of the 5‘-

a SalI linker corresponding to the 3’ end of the RNA were ligated to pUC8. The cDNA with the linkers in the opposite orientation was ligated to pUC9. The cDNA was digested to completion with both EcoRI and SalI, and cDNAs larger than 500 base pairs were purified on a Sepharose 4B column equilibrated with 10 mM Tris. HCl (pH 7.6) containing 1 mM EDTA and 300 mM NaC1. The cDNAwas ligated to EcoRI/SalI double-cut vectors pUC8 and pUC9. Transformation of E. coli strain DH-1with recombinant plasmids was carried out as described by Hanahan (23). The bacteria were plated onto 82mm nitrocellulose filters (Millipore Triton-free HATF) overlaid on ampicillin plates to give between 1,500 and 2,500colonies/filter. Colonies were replica-plated onto 82-mm nitrocellulose sheets (Schleicher and Schuell), and the replicas were regrown either on selective plates for antibody (18) and hybridization (24) screening or on glycerol plates for long-term storage a t -70 “C (25). The pUC8 library contained about 60,000 independent clones, and the pUC9 library contained about 40,000 independent clones, >95% of which contained cDNA inserts. Screening withAntibodies-Bacteria colonies producing protein products antigenically related to tropomyosin were screened using a rabbit anti-tropomyosin antibody (18). Screening with Nucleic Acid Probes-Wehave already reported the isolation of a tropomyosin cDNA clone, derived from chicken smoothmuscle mRNA, that contains a900-bp’ insert (18). A DNA probe was prepared from the purified insert using reverse transcriptaseand random primers (26). Colonies were lysed in situ by the technique of Grunstein and Hogness (24). Hybridization was carried out overnight in a buffer containing 50% formamide, 50 mM Hepes (pH 7.0), 1 X Denhardt’s solution (0.2 mg/ ml Ficoll, 0.2 mg/ml polyvinylpyrrolidone, 0.2 mg/ml bovine serum albumin), 3 x SSC (1 X SSC: 0.15 M NaCI, 0.015 M sodium citrate (pH 7.0)), 160 pg/ml carrier DNA, and 19 pg/ml yeast RNA. The filters were washed extensively in 0.1 X SSC, 0.1% SDS at 50 “C and autoradiographed for 1-5 days with DuPont Cronex Lightning Plus x-ray intensifying screens. DNA-sequenceAnalysis-Fragments were labeled with the Klenow fragment of E. coli DNA polymerase I or polynucleotide kinase. Sequence analysis followed the protocols of Maxam and Gilbert (27). Hybrid-selection Translation Assay-The DNA was fixed to azobenzyloxymethyl paper; embryonic smooth-muscle poly(A)’ RNA was selected by hybridization as described by Miller et al. (28); and the translations were performed essentially as described by Pelham and Jackson (29). SDS-Polyacrylamide Gel Electrophoresis of Proteins in Bacterial Lysates-3-4 ml of culture media were inoculated with appropriate clones, and the bacteria were grown overnight to stationary phase. 1 ml of each culture was removed, and the bacteria were collected in an Eppendorf centrifuge. The bacteria were resuspended in 100 pl of Laemmli sample buffer (30) containing 2 mM EDTA, 2 mM EGTA, and 2 mM phenylmethylsulfonyl fluoride. The bacteria were boiled for 3 min, and theproteins were analyzed by SDS-polyacrylamide gel electrophoresis (31). The proteins were electrophoretically transferred from polyacrylamide gels to nitrocellulose sheets by the method of Towbin et al. (32), and the tropomyosin-related proteins were identified by reaction with anti-tropomyosin antibodies. Two-dimensional gel electrophoresis was carried out as described by O’Farrell (33).

Smooth-muscle Tropomyosin

14138

B

A

“c ”

e

fb *-

. I “

4-

1 2 3 4 5 6 7 8 9 1 0 1 11 2 3 4 5 6 7 8 9 1 0 1 1 FIG. 1. E. coli fusion proteins containing portions of tropomyosin. Bacteria lysates were prepared as described under “Materials and Methods.” The proteins were analyzed on 12.5% SDS-polyacrylamide gels and electrophoretically transferred from the polyacrylamide gel to nitrocellulose by the method of Towbin et al. (32). The proteins werevisualized by staining with Amido Black (panel A ) or by reactionwith anti-tropomyosin antibodies (panel B ) . LAW I , parental strain DH-1 containing pUC9; lane 2, DH-1 containing pUC8; lane 3, DH1 containing pSMT-35; lane 4, DH-1 containing pSMT-34; lane 5, DH-1 containing pSMT-13; lane 6, DH-1 containing pSMT-10; lane 7, DH-1 containing pSMT-9;lane 8, DH-1 containing pSMT-8;lane 9, DH-1 containing pSMT-2; lane 10, DH-1 containing pSMT-3; lane 11, parental strain DH-1 without plasmid; lane 12, molecularweight markers indicated by arrows from top to bottom: 116,000 (P-galactosidase), 94,000 (phosphorylase b ) , 68,000 (bovine serum albumin), 43.000 (ovalbumin), 30,000 (carbonic anhydrase);21,000 (soybean trypsin inhibitor), and 14,000 (lysozyme).

untranslated region. In addition, it contained the identical 3‘untranslated sequences as thetwo tropomyosin cDNA clones we previously identified, pSMT-6 and pSMT-3 (18).Thus, pSMT-10 contained the entirecoding region of tropomyosin, while pSMT-6 (900-bp insert) and pSMT-3 (600-bp insert) contained coding sequences from approximately amino acid 50 and 151, respectively, to the COOH terminus of the protein (Fig. 3). The sequence of the cDNA inserts was determined by the method of Maxam and Gilbert (27). Any ambiguities within the sequence of a given region were resolved by either resequencing the same strand or by analysis of the complementary strand. The completenucleotide sequence of pSMT-10 is shownin Fig. 4 along with thededuced amino acid sequence. The insert consists of approximately 1100 nucleotidesderivedfroma smooth-muscle a-tropomyosin mRNA of which 852 encode the entire translatedregion of the protein,22 are from the5’untranslated region, and 223 are from the 3”untranslated region. The absence of a poly(A) sequence suggests that the entire 3”untranslated region is not present. Also absent from the3”untranslated region isthe sequence AATAAA or ATAAA usually found near the site of addition of the poly(A) tail in eukaryotic mRNA sequences(34). pSMT-10, pSMT-6, andpSMT-3 all containidentical3”untranslated regions which begin at the same position. This would suggest the presence of an internal restriction site for SalI in the 3’untranslated region. This natural SalI site would be cleaved when the linkers were digested. Talbot and MacLeod (35) recently published the COOH-terminalsequence of a chicken tropomyosin cDNA, termed pTM-7, isolated from a skeletalmuscle cDNA library. This clone, coding foramino acids207284, is identicalinsequence topSMT-10.Theseauthors

suggested that clone pTM-7 may have arisen from a nonskeletal-muscle cell RNA, present in the skeletal-muscle tissue usedfor construction of their cDNAlibrary. Theresults presented here are consistentwith this notion. pSMT-10 was found to encode a portion of the 5”untranslated leader sequence of tropomyosin (Fig. 4). However, the bacteria containing this plasmid synthesizea fusion protein of approximately M, = 35,000. It isunclearwhetherthe bacteria are using theAUG start codon of 8-galactosidase or of tropomyosin since both products would be of approximately the same size. Experiments currently in progress should answer this question. In Fig. 5, the aminoacid sequenceof chicken smooth-muscle a-tropomyosin is comparedwith the aminoacid sequences of rabbitskeletal-muscle a- and &tropomyosin (12), chicken pskeletal-muscle a-tropomyosin (13), and equine platelet tropomyosin (14). Inspection of the sequences reveals extensive homology between the different species of tropomyosin. A comparison of the chicken smooth-muscle a-tropomyosin with the rabbit skeletala-and /3-tropomyosins shows that all three contain 284 amino acids. Of these, 215 amino acids are identical among the three proteins. Thirty-nine amino acids of the chicken smooth-muscle a-tropomyosin are different from either of the rabbit tropomyosins, although the majority of these changes areconservative, e.g. Glu + Asp, Arg + Lys, etc. Of the remaining30 amino acids, 27 of these areidentical between the chicken a-tropomyosinsequences and the rabbit /3-tropomyosin, while onlythree are identical between chicken tropomyosin and rabbit a-tropomyosin. A comparison of the available chicken skeletal-muscle atropomyosinsequence (amino acids 24-284) withchicken smooth-muscle a-tropomyosin sequenceshows that of 261

Smooth-muscle Tropomyosin

14139

c

c FIG.2. Two-dimensional gel electrophoresis of cell-free translation of mRNA selected by hybridization to plasmid pSMT-10. Adultchickensmooth-muscle a- and@-tropomyosins were mixed with [35S] methionine-labeled in vitro translation products of 13-day-old embryo poly(A)’ RNA selected by pSMT-10. A, Coomassie Blue-stained gels of the mixed smooth-muscletropomyosinsandthe hybrid-selected translation products; B, the corresponding fluorograph. The arrowhead, in A and B indicates the position of a-tropomyosin from smooth-muscle. The molecular-weight markers indicated by arrowheads from top to bottom are: 200,000 (myosin), 116,000 (8-galactosidase), 94,000 (phosphorylase b ) ,68,000 (bovine serum albumin),43,000 (ovalbumin), 30,000 (carbonic anhydrase), and21,000 (soybean trypsin inhibitor). 5’-untronsloted

a.a.284

a.a. I

pSMT-IO

FIG.3. Clones used for sequence analysis of smooth-muscle a-tropomyosin. pSMT-10 included portions of the .5’- and 3’-untranslated regions as well as theentirecoding regionfrom aminoacids (a.a.) 1-284. pSMT-6and pSMT-6 pSMT-3 began a t approximately amino acid 50 and 151, respectively, and contained a portion of the 3”untranslated region. All threeclonescontainedthe identical 3”untranslated region.

3’-untranslated

CODING

t

t

Eco R I

Sal I

0.0.-50

I

t

0.0.284 CODING

Eco R I 0.0.151

pSMT- 3

I

t

a.o.284 CODING

Eco R I amino acids, 198 amino acids are identical between the two sequences,while 63aredifferent,althoughmost of the changes are conservative. As previously reported (13), the chickenskeletal-musclea-tropomyosin shows greater than 90% homology withrabbitskeletal-musclea-tropomyosin. Two hundred and eighteen amino acids are identical with both a- and @-tropomyosins from rabbit skeletalmuscle. Of theremaining43aminoacidsfromthechickenskeletalmuscle a-tropomyosin, 32 are identical with rabbit a-tropomyosin, five are identical with rabbit@-tropomyosin, and six are different from eithera-or @-tropomyosinsfrom rabbit.

t

SalI

t

SalI

Close inspection of the sequences of the various tropomyosins reveals that the region of greatest homology is from amino acids 1-190. The majority of amino acid substitution occurs between positions 190-213 and 259-284. The smoothmuscletropomyosinshowsmaximumdivergence from the chickenandrabbitskeletal-muscle tropomyosinsin the COOH-terminal region. In contrast, the COOH-terminal end of the smooth-muscle a-tropomyosin very is homologous with the equine plateletP-tropomyosin sequence, differing in only 6 of 23 positions, and most of these are conservative substitutions.

Smooth-muscle Tropomyosin

14140

10 Met Glu Ala Ile Lys Lys Lys Met Gln Met Leu LYS Leu ASP LYS Glu Ass Ala CCCCGCCGCCGCCCCGCCGCACC ATG GAG GCC ATC AAG AAG AAG ATG CAG ATG CTC AAA CTG GAC AAG GAG AAC GCC ATc 30 20 Asp Arg Ala G l u Gln Ala G l u Ala Asp Lys Lys Gln Ala Glu Asp Arg Cy8 Lya Gln Leu Glu Glu Glu G l n Gln G1Y Leu C A C C G T G C C G A G CAG GCG G A G G C T GAC A A G A A G C A G G C G G A G G A T C G C T G C A A G C A G C T G G A G G A G G A G C A G C A C G G C C T G 50 60 70 Gln Lys Lye Leu Lys Gly Thr Glu Asp Glu V a l Glu Lys Tyr Ser Glu S e r V a l Lys Glu Ala Gln Glu Lys Leu G l u Gln C A G A A G A A G C T G A A G G G C A C A G A A G A T G A G G T G G A G A A G T A C T C T G A A T G C G T C A A G G A G G C C CAG G A G A A G C T G G A G C A G

ao 90 100 Ala Glu Lys Lys Ala Thr Aap Ala Glu Ala G l u Val Ala S e r Leu A s n A r g A r g Ile Gln Leu Val Glu G l u G l u Leu A s p GCG GAG AAG AAA GCC ACG GAC GCC GAG GCC GAG GTG GCT TCT CTG AAC CGC CGC ATC CAG CTG GTG GAG GAG GAG CTG GAC 120 110 A r g A l a G l n G l u A r g L e u A l a T h r A l a L e u G l n L y s L e u G l u G l u A l a G l u L y s A l a A l a A s p G l u S e r G l u A r g G l y Mer C G G GCC CAG GAG CGC CTG GCC ACC GCC CTG CAG AAG CTG GAA GAG G C T GAG AAG GCG GCG G A T GAG AGC GAG AGA G G C ATG

140 150 130 Lys V a l I l e Glu A s n A r g A l a M e t Lys A s p G l u G l u L y s Met Glu L e u G l n G l u M e t Gln Leu L y e G l u A l a L y S His I l e AAG GTC A T T GAG AAC AGG GCC ATG AAG GAT GAG GAG AAA ATG GAA CTC CAG GAA ATG CAA CTG AAG GAG GCC A A A C A C A T A 170 180 160 A l a G l u G l u A l a A s p A r g L y s T y r G l u G l u V a l A l a A r g L y s L e u V a l V a l L e u G l u G l y Clu L e u G l u A r g S e r G l u G l u GCG GAA GAG GCC GAC CGC AAA TAT GAG GAG GTG GCC CGC AAG CTG GTG GTC C T T GAG GGA GAG CTG GAG CGC T C A G A G GAG 200 190 Arg Ala Glu Val Ala G l u Ser Arg Val Arg Gln Leu Glu G l u Glu Leu Arg Thr Met Asp Gln Ser Leu Lys Ser Leu I l e CGA GCA GAG GTC GCG GAG AGC CGA GTG AGA CAG CTG GAG GAG GAG CTG CGG ACC ATG GAC CAG AGC CTC AAA TCC CTC ATT

210 2 20 230 A l a S e r G l u G l u G l u T y r S e r T h r L y s G l u A s p L y s T y r G l u G l u G l u I l e L y s L e u L e u C l y G l u L y s L e u L y s Glu. A l a G C C T C A CAC G A A GAG T A T T C C A C C A A G G A G G A C A A G T A C G A G GAG G A A A T C A A G C T T C T A C G G G A G A A A C T G A A G G A G G C T

240 2 50 260 Glu Thr A r g Ala Glu P h r Ala G l u A r g S e r Val Ala L y e Leu G l u Lys T h r Ile A s p A s p L e u Glu G l u S e r Leu A l a S e r GAG A C C A G G GCA GAG T T T C C T GAG C G G T C T G T G GCA A A G CTG GAG A A A A C C A T T G A T G A C T T A G A A G A G A G T CTG G C C A G T 27 0 2 80 Ala LYS c l u G l u A s n V a l C l Y I l e His G l s V a l L e u A s p G l n T h r L e u L e u G l u L e u A s n A s n L e u G C C A A A G A G G A G A A T G T G G G G A T A C A C C A G G T C C T G G A C C A G A C C T T G C T G G A G C T G A A C A A C CTC TGAGCTGCCTGGCGAG

CCCTCATCCCCCTACCCTACC~~~~~~AT~~~~CCCCTGGCACGCTCACGACGTCACCAGCTAAACTGCATCTTGGCCAAATCTACACATCCATTCAGAA~~~ A A C C C T G C A G C C T T A A A C C A T G G c T c G G ~ G ~ ~ ~

FIG. 4. Nucleotide sequence and deduced protein sequence of smooth-musclea-tropomyosin. Sequence analysis was carried out using the method of Maxam and Gilbert (27). The deduced protein sequence is numbered according to the known amino acid sequence of rabbit skeletal-muscle a-tropomyosin. The coding strand of clone pSMT-10 specifying the entire 284 amino acids is shown as well as the 5’- and 3’-untranslated regions.

myosin, although we have made no direct testof this hypothesis. An internal SalI restriction site would result in a high We previously reported the identification of clones that percentage of cDNAs unclonable in pUC9 due to the formaencode tropomyosin by direct immunological screening of a of cDNAs containing SalI restriction sites on both their tion cDNA-expression library (18).In the construction of a cDNAexpression library, two different synthetic linkers(e.g. EcoRI 5’ and 3’ ends. The relatively low number of total cDNAs and SalI) are ligated to the cDNA sequentially (18). The encoding a-tropomyosin in the pUC9 library compared with sequentialaddition of linkers permits most of the cDNA the pUC8 library supports this notion. We previously suggested the use of both the pUC8/pUC9 molecules to be inserted into the vector in a defined orientasystems in order toovercome problems due to internal restriction (18).Under these conditions, when thecDNA is ligated to a plasmid-expression vectorthat contains both a transcrip- tion sites (18). Since somecDNAs will contain restriction these give either an tional and translational start site, one bacterial clone in three sites that are the same as the linkers, will or an insert that is always cloned in unclonable DNA insert should have a cDNA capable of expressing a t least a portion of the protein the template mRNAnormally translates (18). thesame, possibly incorrect,translational readingframe. In the present study, we used an immunological screening These results demonstrate the advantage of using both vecapproach, in additionto using a 32P-labeled probe,to isolate tors. Comparingtheamino acidsequences of thechicken clones encoding tropomyosin. Of the clones detected by hyof chicken skeletalbridization, 39 were in the pUC8 library and 15 were in the smooth-muscle a-tropomyosin with those pUC9 library. Of these, 13 of the 39 in pUC8 and2 of the 15 muscle a-tropomyosin (13), rabbit skeletal-muscle a- and pin pUC9 were detected by immunological screening. The 13 tropomyosins (ll),and equine platelet @-tropomyosin (14) revealed extensive homology between the various proteins. of 39 in pUC8 agrees with the predicted one in three that would be in the right translational reading frame for expres- The majority of differences in amino acids represented conservative amino acid substitutions. Two regions where the sion. However, the lower percentage of expressors in the pUC9 library (2 of 15) would suggest some bias against expression greatest sequence divergence is evident are between amino acids 190-213 and 259-284. When the chicken smooth-muscle of a-tropomyosin cDNAs in pUC9. We believe that there is a SalI restriction site in the 3’- sequence is compared to the othertropomyosins, nonconservative amino acid substitutions are found a t positions 190, untranslated region of the chicken smooth-muscle a-tropoDISCUSSION

Smooth-muscle Tropomyosin

14141

10 20 1 IctCluAlaI1aLy~L~~Ly.WcLCl.lcLL.uLyaLcuAapL~~Al~AanAlaI~eA~p **P **P A I a C l y L r u A a n S e Vr aL le u

Art

Ile

Ala

C l n C 1 n C 1 o A l a A e Cp lC ul u

30 bo Ar~AlaCluC1nA1aCluAlaAapL~~L~~ClnAlaCluAapAr~C~~L~~ClnL~uCluCluCluClnCln Aap L*uValAla Clu 1 . Ala ter Aap LeuVal8.r Ala A .1

""""""""""_

FIG. 5. Comparison of the amino acid sequences of various tropomyosins. The amino acid sequences of chicken smooth-muscle a-tropomyosin (CSM-a),chicken skeletal-muscle a-tropomyosin (CSK-a),rabbit skeletal-muscle a- and j3-tropomyosins (RSK-a, RSK-j3),and equine platelet j3-tropomyosin (EPL-j3)are shown. Where the various sequences are identical with chicken smooth-muscle a-tropomyosin, only the smooth-muscle sequence is shown, while portions of divergence are indicated. Broken lines indicate putative deletions in the equine platelet tropomyosin sequence. The available chicken skeletalmuscle a-tropomyosin sequence is from amino acids 24-284.

110 I20 100 CluCluCIuLcuAapArsAlaClnCluAr~LruAlaIhrAlaL~uC~nL~aLauCluCluAlaC~uL~~AlaAla

I Ic

191, 192,201,208, 211, and 213. Inaddition,thechicken tutions at positions259, 261, 266, 267,268, 271,272, and 273. smooth-muscle a-tropomyosin is substantially different fromInterestingly, the COOH-terminal endof the equine platelet tropomyosins isolated from skeletal muscle between amino @-tropomyosin isnearlyidenticaltothechickensmoothacids 259 and 284, with nonconservative amino acid substi- muscle a-tropomyosin between aminoacids 259 and 284,

14142

Smooth-muscle Tropomyosin

differing in only 6 of the last 25 amino acids, and of these only two at positions 259 and 279 are nonconservative substitutions. In contrast, theplatelet tropomyosin is more similar to the skeletal-muscle tropomyosins from amino acids 190-213, exhibitinglittle homology tothe smooth-muscle form of the protein. The structural and functional significance of the differences in theCOOH-terminal region of the various tropomyosins is unclear at present, but may have important implications with respect to their interactions with the members of the troponin complex. Biochemical studies have indicated that the site of troponin binding is close to or at the COOH-terminal end of skeletal-muscle tropomyosin (10,3649). It is believed that there are atleast two regions on both skeletal-muscle tropomyosin and troponinT involved in their mutual interaction (10, 40, 47-49). Using defined fragments of troponin T, it hasbeen shown that theT1 (residues 1-158) and CB1 (residues 1-151) fragments of troponin interact with the COOH-terminal end of tropomyosin (10). The T2 fragment (residues 159-259) of troponin T interacts with tropomyosin in the region around the cysteine at position 190 in tropomyosin. Studies of the binding of rabbit skeletal-muscle troponin T to various types of tropomyosin have indicated biochemical differences in the tropomyosins (10). The smooth-muscle tropomyosin and platelet tropomyosin bind troponin T and its T1 and CB1 fragments less well than the skeletal-muscle protein binds troponin (10). This is intriguing since the smooth-muscle and platelet proteins are quite similar at theirCOOH-terminal ends (aminoacids 260-284), the region in which they differ substantially from the skeletalmuscle proteins. The skeletal-muscle form is known to be phosphorylated at serine 283, while the smooth-muscle and platelet forms are not (1). This serine is absent from both the smooth-muscle and the platelet tropomyosins where it is replaced by asparagine and cysteine, respectively. The functional significance of the phosphorylation of the skeletalmuscle tropomyosin is unclear, but may have a role in the regulation of these proteins. The T2fragment (residues159-259) of troponin T interacts equally well with smooth-muscle, platelet, and skeletal-muscle tropomyosins (10). These results suggested that the binding region for T2 would be similar between these tropomyosins (10). As predicted, a comparison of platelet and skeletalmuscle tropomyosins in the region of cysteine 190 reveals extensive sequence homology. The smooth-muscle protein, by contrast, is substantially different from either the platelet or skeletal-muscle tropomyosins around cysteine 190. Thus, although there aredifferences in the primary structure of these proteins in the neighborhood of T2 binding (cysteine 1901, this is not reflected in their ability to bind the T2 fragment of troponin T. Whether there is a conservation of the gross three-dimensional structure of the protein in this region or a certain amount of flexibility in the structural requirements for the binding of troponin to tropomyosin in this region is unclear at present. Alternatively, the actual binding site for the T2 fragment of troponin T on tropomyosin may be to the amino-terminal side of cysteine 190, where the proteins are quite similar. It is clear that different forms of tropomyosin existin various cell types. Whether each protein species is functionally distinct remainsto be determined.For example, the physiological significance of differences in troponin binding to various tropomyosins i n vitro is unknown. Smooth-muscle and nonmuscle cells do not contain a troponin complex for the regulation of actomyosin (7). Instead, regulation of actomyosin in these cells seems to occur by phosphorylation of the light chains of myosin by the enzyme myosin light-chain

kinase (7). It would appear that smooth-muscle and nonmuscle cells may require functionally, as well as structurally, different forms of tropomyosin compared to the skeletalmuscle proteins. In this respect, tropomyosins isolated from smooth-muscle and nonmuscle cells have been found to stimulate the ATPase activity of reconstituted skeletal-muscle actomyosin (9). In contrast,under the same conditions, skeletal-muscle tropomyosin had no effect (9). Whether these studies areof any significance in vivo remains unanswered. It is clear from the primary sequence data that tropomyosins are highly-conserved proteins. However, substantial sequence differences exist near the COOH-terminal region of the protein. The obvious implication is either that the COOH-terminal region in some cell types is not essential for tropomyosin function or that such altered sequence confers different functional properties to the protein. The latter alternative may be more likely, but the problem remains unresolved. Finally, while we have determined the structure of the atropomyosin from smooth-muscle, the sequence of the P form remains to be determined. We recently isolated a cDNA clone from the smooth-muscle cDNA library encoding P-tropomyosin.'We arecurrentlyin the process of determining its sequence and obtaining clones to theCOOH-terminal region. Acknowledgments-We thank J. D. Watson for his encouragement in the initiation of this work. For rabbit anti-tropomyosin antisera, we thank Jim Lin and Fumio Matsumura. We are also grateful to Tom Kost for helpful discussions and Marilyn Goodwin, Madeline Szadkowski, and Phil Renna for preparation of this manuscript. REFERENCES 1. Montarras, D., Fiszman, M. Y., and Gros, F. (1981)J. Bwl. Chem. 256,4081-4086 2. Cohen, I., and Cohen, C. (1972) J. Mol. Biol. 68,383-387 3. Fine, R. E., Blitz, A. L., Hitchcock, S. E., and Kaminer, B. (1973) Nut. New Biol. 245, 183-185 4. Fine, R. E., and Blitz, A. L. (1975) J. Mol. Biol. 95, 447-454 5. Lin, J. J.-C., Matsumura, F., and Yamashiro-Matsumura, S. (1984) J. Cell Biol. 98, 116-127 6. Ebashi, S., and Endo, M. (1968) Prog. Biophys. Mol. Biol. 18, 125-183 7. Adelstein, R. S.,Pato, M. D., Sellers, J. R., DeLanerolle, P., and Conti, M. A. (1981) Cold Spring Harbor Symp. Quunt. Biol. 46, 921-928 8. Woods, E. F. (1969) Biochemistry 8 , 4336-4344 9. Sobieszek, A., and Small, J. V. (1981) Eur. J. Biochem. 118, 533-539 10. Pearlstone, J. R., and Smillie, L. B. (1982) J. Biol. Chem. 2 5 7 , 10587-10592 11. Mak, A. S., Smillie, L. B., andStewart, G. R. (1980) J. Biol. Chem. 255,3647-3655 12. Lewis, W. G., and Smillie, L. B. (1980)J.Biol. Chem. 255,68546859 13. MacLeod, A. R. (1982) Eur. J. Biochem. 126,293-297 14. Lewis, W. G., Cote, G. P., Mak, A. S., and Smillie, L. B. (1983) FEBS Lett. 156,269-273 15. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Bi~~hemistry 18,5294-5299 16. Feramisco, J. R., Smart, J. E., Burridge, K., Helfman, D. M., and Thomas, G. P. (1982) J. Biol. Chem. 257, 11024-11031 17. Aviv, H., and Leder, P. (1972) Proc. Natl. Acad. Sci. U. A. 69, 1408-1412 18. Helfman, D. M., Feramisco, J. R., Fiddes, J. C., Thomas, G. P., and Hughes, . S. H. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 31-35 19. Vieira, J., and Messing, J. (1982) Gene (Amst.) 19, 259-268 20. Fiddes, J. C., and Goodman, H. M. (1979) Nature (Lond.1 2 8 1 , 351-355 21. Kurtz, D. T., andNicodemus, C. F. (1981) Gene (Amst.) 13,145152

s.

* D. M. Helfman, J. R. Feramisco, W. M. Ricci, and S. H. Hughes, unpublished observations.

Smooth-muscle Tropomyosin 22. Payvar, F., and Schimke, R. T. (1979) J. Biol. Chem. 254,76367642 23. Hanahan, D. (1983) J. Mol. Biol. 166,557-580 24. Grunstein, M., and Hogness, D. (1975) Proc. Natl. Acad. Sci. U. S. A. 72,3961-3965 25. Hanahan, D., and Meselson, M. (1980) Gene (Amst.) 10,63-67 26. Shank, P.R., Hughes, S. H., Kung, H.-J., Majors, J. E., Quintrell, N., Guntaka, R.V., Bishop, J. M., and Varmus, H. E. (1978) Cell 1 5 , 1383-1395 27. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65, 41. 499-560 28. Miller, J. S., Paterson, B. M., Ricciardi, R. P., Cohen, L., and Roberts, B. E. (1983) Methods Enzymol. 101, 650-67442. 29. Pelham, H.R. B., and Jackson, R. J. (1976) Eur. J.Biochem. 6 7 , 247-256 30. Laemmli, U. K. (1970) Nature (Lord.)2 2 7 , 680-685 31. Blattler, D. P., Garner, F., Van Slyke, K., and Bradley, A. (1972) J. Chromatogr. 64, 147-155 32. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,4350-4354 33. O’Farrell, P. H. (1975) J . Biol. Chem. 250,4007-4021 34. Proudfoot, N. J., and Brownlee, G . G. (1976) Nature (Lord.) 263,211-214 35. Talbot, K.,and MacLeod, A. R. (1983) J. Mol. Biol. 164, 159174

14143

36. Nonomura, Y., Drabikowski, W., and Ebashi, S. (1968) J. Biochem. (Tokyo) 64, 419-422 37. Higashi, S., and Ooi, T. (1968) J. Mol. Biol. 34,699-701 38. Cohen, C., Caspar, D. L. D., Parry, D. A. D., and Lucas, R. M. (1971) Cold Spring Harbor Symp. Quunt. Biol. 36,205-216 39. Cohen, C., Caspar, D. L. D., Johnson, J. P., Nauss, K., Margossian, S. S., and Parry, D. A. D. (1971) Cold Spring Harbor Symp. Quant. Biol. 37,287-297 40. Hitchcock, S. E., Huxley, H. E., and Szent-Gyorgyi, A. G. (1973) J.Mol. Biol. 80,825-836 S., S. and Cohen, C. (1973) J. Mol. Biol. 81, 409Margossian, 413 Ohtsuki, I. (1974) J. Biochem. (Tokyo) 75, 753-765 43.Yamaguchi,M., Greaser, M. L., and Cassens, R. G. (1974) J. Ultrastruct. Res. 48, 33-58 44. Stewart, M., and McLachlan, A. D. (1976) J. Mol. Biol. 103, 251-260 45. McLachlan, A. D., and Stewart, M. (1976) J. Mol. Biol. 106, 1017-1022 46. Chong, P. C. S., and Hodges, R. S. (1982) J. Biol.Chem. 257, 9152-9160 47. Ohtsuki, I. (1979) J. Biochem. (Tokyo) 86,491-497 48. Pearlstone, J. R., and Smillie, L.B. (1981)FEBS Lett. 128,119122 49. Mak, A. S., and Smillie, L. B. (1981) J . Mol. Biol. 149, 541-550