Recombinant Expression and Characterization of ... - Semantic Scholar

J. Microbiol. Biotechnol. (2009), 19(12), 1547–1556 doi: 10.4014/jmb.0905.05006 First published online 24 August 2009

Recombinant Expression and Characterization of Thermoanaerobacter tengcongensis Thermostable α-Glucosidase with Regioselectivity for HighYield Isomaltooligosaccharides Synthesis Zhou, Cheng1,2, Yanfen Xue1, Yueling Zhang3, Yan Zeng1, and Yanhe Ma1* 1

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China The Graduate School, Chinese Academy of Sciences, Beijing 100049, China 3 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, China 2

Received: May 6, 2009 / Revised: June 16, 2009 / Accepted: July 1, 2009

A novel thermostable α-glucosidase (TtGluA) from Thermoanaerobacter tengcongensis MB4 was successfully expressed in E. coli and characterized. The TtgluA gene contained 2,253 bp, which encodes 750 amino acids. The native TtGluA was a trimer with monomer molecular mass of 89 kDa shown by SDS-PAGE. The purified recombinant enzyme showed hydrolytic activity on maltooligosaccharides, p-nitrophenyl-α-D-glucopyranide, and dextrin with an exotype cleavage manner. TtGluA showed preference for shortchain maltooligosaccharides and the highest specific activity for maltose of 3.26 units/mg. Maximal activity was observed at 60ºC and pH 5.5. The half-life was 2 h at 60ºC. The enzyme showed good tolerance to urea and SDS but was inhibited by Tris. When maltose with the concentration over 50 mM was used as substrate, TtGluA was also capable of catalyzing transglycosylation to produce α-1,4-linked maltotriose and α-1,6-linked isomaltooligosaccharides. More importantly, TtGluA showed exclusive regiospecificity with high yield to produce α-1,6-linked isomaltooligosaccharides when the reaction time extended to more than 10 h. Keywords: Thermostable α-glucosidase, Thermoanaerobacter tengcongensis, maltooligosaccharides hydrolysis, isomaltooligosaccharides synthesis

The amylolytic enzyme system (amylases, debranching enzymes, and α-glucosidases) can hydrolyze starch to produce fermentable sugars that typically are used in food processing, fermentation, and alcohol production in industry. These enzymes from thermophilic microorganisms drew much attention in the past years because of their good *Corresponding author Phone: +86-10-64807590; Fax: +86-10-64807616; E-mail: [email protected]

stability and high efficiency in the industrial processes that mostly take place at high temperature [17, 31]. In this enzyme system, α-glucosidases (E.C. 3.2.1.20) hydrolyze terminal glycosidic bonds and release α-glucose from the nonreducing end of the substrate chain [16]. They are involved in the last step of starch degradation and are the second most important enzymes during the early stages of raw starch hydrolysis [17]. Thermostable α-glucosidases, isolated from a variety of thermophiles or hyperthermophiles, are potential candidates for the improvements of industrial starch processing into glucose syrup. Thermophilic anaerobic Clostridium bacteria [2] have been proven to convert a wide range of carbohydrate substrates, which resulted in application in the processing and recycling of surplus agricultural crops and industrial waste [3]. Thermoanaerobacter and Thermoanaerobacterium are two important genera of this group. Some amylolytic enzymes of several bacterial strains closely related to these two genera have been analyzed in detail [1, 11, 19, 28]. However, α-glucosidases have only been isolated and characterized from two strains of these genera: Thermoanaerobacter thermohydrosulfuricus DSM 567 [3] and Thermoanaerobacterium thermosaccharolyticum DSM 571 [8]. However, there is no sequence information available and the knowledge about them is limited. Some α-glucosidases also catalyze transglycosylation reactions [11, 13, 20] that are exploited in biotechnology to produce food oligosaccharides [5, 7] or to conjugate sugars with biologically useful materials [27]. Thermostable αglucosidases with transglycosylation activity have been reported in past years [3, 4, 23, 26]. However, the transglycosylation products of most reported α-glucosidases are generally the mixtures of oligosaccharides with various linkages, and the yields are always low [4, 9, 11, 13, 15, 23, 30].

1548

Zhou et al.

In this paper, we describe the expression, purification, and biochemical characterization of a thermostable αglucosidase from another Thermoanaerobacter strain, Thermoanaerobacter tengcongensis MB4, and present evidence that this enzyme possesses some physical and hydrolyzing properties different from the other two characterized Thermoanaerobacter α-glucosidases. More attractively, this enzyme presents transglycosylation regiospecificity and high yield for α-1,6-linked isomaltooligosaccharides synthesi which differs from other characterized α-glucosidases. MATERIALS AND METHODS Bacterial Strains, Plasmids, Restriction Enzymes, and Chemicals The genomic DNA of Thermoanaerobacter tengcongensis MB4 was extracted with a bacteria genomic DNA extraction kit (Tiangen, China). The expression vector pET-28a was from Novagen (U.S.A.). E. coli DH5α and BL21 (DE3) strains were from Stratagene (U.S.A.). The restriction enzymes were from TaKaRa (Japan). The oligosaccharides were from Sigma (U.S.A.). The isopropyl-β-D-thiogalactopyranoside (IPTG), kanamycin, imidazole, protein denaturants, and acetonitrile were from Merck (U.S.A.). All the other chemicals used were of reagent grade. Construction of TtgluA Expression System The α-glucosidase gene TtgluA (GenBank Accessions No. AAM23323) was amplified from the genomic DNA of Thermoanaerobacter tengcongensis MB4 by PCR with a primer pair of the forward (GCTAGCTAGCATGCTTCAAAGAAC, where the underline indicates the NheI site) and the reverse (CCGGAATTCCTATTTCACTACAATC, the underline indicates the EcoRI site) and pfu DNA polymerase. The PCR product was purified with the Gel Extraction Kit (OMEGA Bio-tek, U.S.A.) and then digested with NheI and EcoRI to insert the digested pET28a vector. The resultant recombinant plasmid, pET28a-TtgluA, was transformed into E. coli DH5α for cloning. DNA sequencing was performed by SinoGenoMax Co., Ltd, China. The purified pET28a-TtgluA was then transformed into E. coli BL21(DE3) for gene expression. Gene Expression and Protein Purification E. coli BL21 (DE3) harboring the pET28a-TtgluA plasmid was cultured in 0.5 l of LB medium containing kanamycin (60 µg/ml) until the OD reached to 0.6. IPTG was added at a final concentration of 1 mM, and the cells were continuously cultivated for 5 h at 37 C. Cells were harvested by centrifugation at 6,000 ×g at 4 C for 15 min, washed with binding buffer (20 mM sodium phosphate buffer containing 500 mM NaCl and 5 mM imidazole, pH 7.9), and then suspended in 50 ml of the same buffer. The suspended cells were disrupted by sonication and the supernatant was obtained by centrifugation at 12,000 ×g for 20 min at 4 C. The supernatant was incubated at 65 C for 30 min to denature the thermolabile proteins and then centrifuged at 12,000 ×g for 30 min at 4 C. The second supernatant was loaded onto a His·Bind column (5PKG) (Novogen, Germany). The column was washed with 10 ml of binding buffer and subsequently with 15 ml of washing buffer (20 mM sodium phosphate buffer containing 500 mM NaCl and 60 mM imidazole, pH 7.9). Finally, the protein was eluted with 3 ml of elution buffer (20 mM phosphate buffer containing 600

500 mM NaCl and 1 M imidazole, pH 7.9). The obtained protein solution was desalted on a desalting column (GE Healthcare, U.S.A.) with 20 mM sodium phosphate buffer (pH 7.5) and then loaded onto a Superdex 10/300 column (GE Healthcare, U.S.A.) equilibrated with 20 mM phosphate buffer containing 150 mM NaCl (pH 7.5). Elution was performed with the equilibration buffer at a flow rate of 0.6 ml/min and the desired protein fractions were collected. The eluted protein was desalted again with 20 mM sodium phosphate buffer (pH 7.5). The protein concentration was defined with the Bio-Rad Protein Assay Reagent (Bio-Rad, U.S.A.) using bovine serum albumin as a standard. The purity of the protein was examined by SDS-PAGE. Molecular Mass Determination and Circular Dichroism Spectra The apparent molecular mass of the recombinant enzyme was determined by both gel filtration chromatography and Superdex 10/300 column using cytochrome c (12.4 kDa), carbonic anhydrase (29 kDa), bovine serum albumin (66 kDa), alcohol dehydrogenase (150 kDa), and β-amylase (200 kDa) (Sigma, St. Louis, U.S.A.) as molecular mass standards and DynaPro dynamic light scattering systems (Wyatt Technology, U.S.A.) with 0.1 mg/ml enzyme in 20 mM phosphate buffer (pH 7.5) at 25 C. The monomer molecular mass was calculated from the putative amino acid sequence and estimated by SDS-PAGE. Circular dichroism (CD) spectra of pure recombinant TtGluA were measured using the Jasco J-810 spectropolarimeter (Jasco, Japan) over a wavelength ranging from 190 to 260 nm under constant nitrogen flush. The bandwidth was set to 1 nm. The secondary structure content of the enzyme was estimated using the program JASCOW32. All spectra were recorded at room temperature, and three scans were averaged and blank-subtracted to give the spectra. o

Effects of pH, Temperature, and Chemicals on Enzyme Activity and Stability The optimal pH was assayed at 60 C for 10 min in 50 mM citric acidsodium phosphate buffer (pH 4.0-8.0) with 0.5 mM p-nitrophenylα-D-glucopyranoside (pNPG; Sigma). The effect of pH on enzyme stability was analyzed with enzyme being incubated in buffer from pH 2-11 at 50 C for 30 min. The optimal temperature was assayed at 30-80 C for 10 min with standard reaction buffer (50 mM citric acid-sodium phosphate buffer, pH 6.0). Thermal stability was analyzed by assessing enzyme activity after incubation at various temperatures for the indicated time. To determine the effects of chemicals, the enzyme (0.4 mg/ml) was incubated with various metal ions and EDTA (final concentration of 5 mM), and protein denaturants of different concentration at 50 C for 30 min. The residual activity was measured under the standard hydrolytic assay condition. o

o

o

o

o

o

o

o

o

Standard Hydrolytic Activity Assays α-Glucosidase hydrolytic activity was determined by measuring the release of p-nitrophenol from pNPG at 60 C for 10 min with standard reaction buffer. The reaction was terminated by addition of an equal volume of 1 M Na CO solution. The absorbance of the liberated p-nitrophenol was measured at 410 nm. One unit of α-glucosidase activity was defined as the amount of enzyme liberating 1 µmole of p-nitrophenol in 1 minute. The activity on maltooligosaccharide, soluble starch, dextrin, and other oligosaccharides was determined by measuring the release of glucose at 60 C for 15 min with 0.5% (w/v) substrates in standard reaction buffer. Reactions were terminated by incubation for 10 min in a boiling water bath. Glucose was assayed with the glucose o

2

o

3

T. TENGCONGENSIS THERMOSTABLE α-GLUCOSIDASE

oxidase reagent from a glucose assay kit (Sigma Diagnostics No. 510). One unit of activity was defined as the amount of the enzyme liberating 1 µmole of glucose in 1 minute. All values are expressed as the averages of three experiments. Transglycosylation Activity Analysis The transglycosylation activity was performed with 5 µg of purified enzyme and different concentrations of maltose ranging from 20 mM to 300 mM in the standard reaction buffer at 45 C. After different time intervals, the reaction mixture was terminated in a boiling water bath for 10 min. After centrifugation (10,000 ×g, 10 min), 1-µl samples were spotted on Silica Gel 60 plates (Merck, Germany) and thin-layer chromatography (TLC) analysis was performed as described previously by Kanda et al. [12]. Transglycosylation products analyses were carried out by HPLC using a 4.6 mm ID×150 mm Zorbax

1549

carbohydrate analysis column (Agilent Technology, U.S.A.), with acetonitrile/water (75/25, v/v) as the mobile phase at 2 ml/min, and a refractive index detector. The column was kept constant at 30 C. Integration was carried out using the Agilent ChemStation software. o

RESULTS AND DISCUSSION

o

Sequence Analysis of TtGluA The α-glucosidase gene TtgluA cloned from T. tengcongensis MB4 contains 2,253 bp, which encodes 750 amino acids with a predicted molecular mass of 88.6 kDa. The deduced protein sequences showed the highest homology to microbial annotated α-glucosidases from several other

Fig. 1. Multiple alignment of the amino acid sequences of α-glucosidases from Thermoanaerobacter tengcongensis MB4 (GenBank No. AAM23323), Thermoanaerobacter sp. X514 (GenBank No. ABY91330), Thermoanaerobacter pseudethanolicus ATCC 33223 (GenBank No. ABY93679), Thermoanaerobacter ethanolicus (GenBank No. ABR26230), Bacillus thermoamyloliquefaciens (GenBank No. BAA76396), and Dictyoglomus thermophilum (GenBank No. ACI19412). Identical residues are shaded black. The characteristic consensus motif of family II α-glucosidase is highlighted by a dotted black line.

1550

Zhou et al.

Table 1. Purification of recombinant α-glucosidase (TtGluA) from Thermoanaerobacter tengcongensis MB4. Preparation Supernatant of crude extract after sonication Supernatant after heating treatment Affinity (His-tag column) Gel-filtration (Superdex10/300)

Total protein (mg)

Total activity (mU)

Yield (%)

Specific activity (mU/mg)

Purification fold

378.2 137.8 2.42 1.08

3,060.2 2,400.3 507.6 391.2

100 78.4 16.6 12.8

8.1 17.4 209.7 362.2

1.0 2.1 25.9 44.7

Thermoanaerobacter strains: Thermoanaerobacter sp. X514, T. pseudethanolicus, and T. ethanolicus with 79%, 79%, and 78% identities, respectively. However, the functions of these three proteins are yet to be investigated. Fig. 1 shows a multiple sequence alignment of the deduced amino acid sequences of TtGluA and several other microbial αglucosidases of which sequence identities were more than 43%. The characteristic consensus motifs of α-glucosidase ([GFY]-[LIVMF]-W-x-D-M-[NSA]-E-[VP] and G-[AV]-D[TIV]-[CG]-G-F) were found to exist in this protein ([G]-[I]W-N-D-M-[N]-E-[P] from G373 to P381, and G-[A]-D-[V][G]-G-F from G482 to F488). This indicated that TtGluA belongs to family II α-glucosidase [16] and glycoside hydrolase family 31 (http://www.cazy.org/fam/GH31.html). Purification and Properties of the Recombinant TtGluA The TtgluA gene was successfully expressed in E. coli BL21(DE3) and purified to homogeneity by a three-step process including heating treatment, and His-tag affinity column and gel-filtration chromatographies. The purification results using pNPG substrate are summarized in Table 1.

The final preparation showed an approximate 44.8-fold increase in purity with a recovery of 12.8% relative to the amount of the crude enzyme. The specific activity of the purified enzyme was 362.2 mU/mg protein using pNPG as substrate. As expected for protein from a thermophilic bacterium, TtGluA did not have much activity loss (less than 20%) after heating at 65oC for 30 min, under which 65% of E. coli total protein was denatured. As shown in Fig. 2, the recombinant TtGluA was finally purified to homogeneity with a molecular mass of approximately 89 kDa, in accordance with the calculated mass of 88.6 kDa deduced from the amino acid sequence. This was smaller than the α-glucosidase from T. thermohydrosulfuricus (160 kDa) [3] but larger than the enzyme from T. thermosaccharolyticum (60 kDa) [8]. On the other side, primary gel-filtration chromatography showed that the molecular mass of the native TtGluA was beyond the detection range of 200 kDa, which indicated that the native TtGluA was an oligomer. In order to measure the accurate molecular mass of the native TtGluA, we performed dynamic light scattering analysis. A peak with a hydrodynamic radius of 6.7 nm was observed (Fig. 3), corresponding to a molecular mass of about 285 kDa. This clearly suggested that the dominant form of native TtGluA is a trimer in

Fig. 2. SDS-PAGE analysis of the recombinant TtGluA at different stages of purification. Lane 1, supernatant of crude extract from BL21(DE3) with pET28a; lane 2, Supernatant of crude extract from BL21(DE3) with pET28a-TtgluA; lane 3, Supernatant after heating treatment from BL21(DE3) with pET28a-TtgluA; lane 4, Affinity (His-tag column) chromatography of heating supernatant; lane 5, Gel-filtration (Superdex10/300) chromatography-purified enzyme; lane M, molecular mass marker.

Fig. 3. The regularization graph of the native recombinant TtGluA in the dynamic light scattering experiment. The Rayleigh Spheres model was used. The x-axis indicates the hydrodynamic radius.


1551

Japan), TtGluA contained 50.0% α-helix, 12.2% β-sheet, 14.5% β-turn, and 23.3% random coil. Like all spectroscopic techniques, the CD signal reflects an average of the entire molecular population. Thus, although CD can determine that a protein contains about 50% α-helix, it cannot determine which specific residues are involved in the αhelical portion. Hence, from this CD spectra data, we cannot know the details about the α-helix of TtGluA.

Fig. 4. Far-UV CD spectra of TtGluA in 20 mM sodium phosphate buffer (pH 7.5). Each spectrum is the mean of three independent acquisitions.

solution. The secondary structural information was obtained by the “far-UV” CD spectra (Fig. 4). Based on the program JASCOW32 in the Jasco J-810 spectropolarimeter (Jasco,

Physical Properties of the Recombinant TtGluA The effects of pH and temperature on the catalytic activity of TtGluA were determined using pNPG as substrate, and the results are shown in Fig. 5. TtGluA exhibited the maximum activity at pH 5.5 and 60oC (Fig. 5A and 5B). Around 50% activity was retained at pH 4.5-7, whereas rapid activity decline happened at higher or lower pH values. The data also showed that TtGluA was stable over a wide range of pH 3-9 at 50oC (Fig. 5C). In this pH range, more than 80% of its original activity was retained after 30-min incubation. TtGluA was also stable for more than 10 h up to 40oC and had the half-life of 5 h, 2 h, and 50 min at 50oC, 60oC, and 65oC, respectively (Fig. 5D).

Fig. 5. The effects of pH and temperature on TtGluA activity and stability.

A. pH optimum. B. Temperature optimum. C. pH stability. D. Thermal stability ( ■ : 40 C; ○ : 50 C; ▲ : 60 C; ▽ : 65 C). All the residual hydrolytic activities were measured at 60 C in 50 mM citric acid-Na HPO buffer (pH 6.0) with pNPG as substrate. Values are expressed as the averages of three experiments. o

o

2

4

o

o

o

1552

Zhou et al.

Fig. 6. The effects of protein denaturants and Tris on TtGluA stability and activity.

A, B, and C show the effects of SDS, urea, and guanidine hydrochloride, respectively, on the stability of TtGluA. The purified enzyme of 0.4 mg/ml was incubated with protein denaturants of different concentrations for 30 min at 50 C. D shows the effect of Tris on TtGluA activity. The activity was assayed in Tris-HCl buffer (pH 6.0) with different concentrations of Tris. Values are expressed as the averages of three experiments. o

However, the enzyme activity decreased rapidly when the preincubation temperature reached to 75oC. Only about 17% activity was retained after 20-min incubation. The αglucosidase from T. thermohydrosulfuricus DSM 567 showed maximal activity at pH 5 and 75oC and was stable at least for 7 h at this temperature [3]. These indicated that TtGluA was a moderate thermostable enzyme, which was similar to the α-glucosidase from T. thermosaccharolyticum with optimal activity at 65oC and pH 5.5 [8] but more thermolabile than the enzyme from T. thermohydrosulfuricus. The effects of various metal ions and chemicals on the activity of TtGluA was studied at 50oC in 50 mM citric acid-sodium phosphate buffer, pH 6.0. Only Ag+, Hg2+, and Pb2+ evidently inhibited the activity of TtGluA, whereas EDTA and other metal ions did not. As we know, these heavy metals have strong affinities for sulfhydral (SH) groups [21]. The amino acid sequence analysis of TtGluA shows that there are four cysteines (Cys109, Cys261, Cys346, and Cys492). So this means that there are some -SH groups close to the catalytic region of TtGluA. The activity loss is because these heavy metal ions bind to the -SH groups and act as an irreversible inhibitor. No evident inhibition or activation of other metal ions suggests

that none of them is a cofactor of TtGluA. TtGluA showed good tolerance to SDS and urea, with about 50% and 76.5% activities retained after treatment with 6 M urea and 1% SDS at 50oC for 30 min, respectively (Fig. 6A and 6B), but was sensitive to guanidine hydrochloride, with only 18.6% activity retained by incubation in 1 M guanidine hydrochloride (Fig. 6C). It was observed that TtGluA showed much less activity in Tris-HCl buffer than in other buffers with the same pH. Further studies on the effects of Tris concentration (the pH of all the buffers with different concentration of Tris was 6.0) on the activity of TtGluA showed that about 80% activity was lost when the Tris concentration was increased from 5 mM to 100 mM (Fig. 6D). Since Tris is a well-known saccharide analog, the activity loss was most possibly due to the competitive inhibition. Similar results were also reported for the α-glucosidases from Aspergillus niger and Bacillus thermoamyloliquefaciens [14, 26]. Substrate Specificity of TtGluA The hydrolytic activity of TtGluA towards various substrates was studied at 60oC. Like the α-glucosidase from T. thermohydrosulfuricus, TtGluA was capable of cleaving


Table 2. Kinetic parameters of α-glucosidase from T. tengcongensis MB4 for hydrolysis of various substrates. Substrate Maltose Maltotriose Maltotetraose Maltopentaose pNPG Dextrin

Specific activity (units/mg)

Km (mM)

kcat (s−1)

kcat/Km (s−1mM−1)

3.26 2.85 1.09 2.38 0.36 0.73

6.31 4.58 16.55 6.72 1.08 n.d.

253.53 217.17 330.09 315.96 19.92 n.d.

40.17 47.43 19.95 47.01 18.45 n.d.

n.d.: not determined.

maltose, maltooligosaccharides, and aryl-substrate pNPG, with the highest specific activity for maltose of 3.26 units/mg (Table 2). This was different from the α-glucosidase from T. thermosaccharolyticum, which had no activity on maltose [8]. TLC analysis of the hydrolytic products from maltopentaose and maltohexaose showed that TtGluA released glucose from maltooligosaccharides one by one from the nonreducing end (data not shown). This indicated that TtGluA cleaved substrate maltooligosaccharides by an exo-type manner. The kinetic parameters of TtGluA for various substrates were calculated. As shown in Table 2, the substrate preferences of TtGluA were maltotriose> maltopentaose>maltose>maltotetraose>pNPG (kcat/Km values of 47.43, 47.01, 40.17, 19.95, and 18.45 s−1·mM−1, respectively). Under optimal conditions, the activity of pNPG cleavage was approximately 11% of maltose hydrolysis, suggesting that TtGluA belongs to the type II α-glucosidase [6]. The less hydrolytic activity on pNPG than maltose or other maltooligosaccharides indicated that TtGluA has no preference on glycosyl moieties in disaccharide substrates for hydrolysis. However, the Km of pNPG was 1.08 mM, which was lower than other substrates. This indicated that TtGluA bound pNPG more easily than other maltosaccharides. No activity was detected towards polymeric substrates

1553

starch and pullulan. Only low activity was detected towards dextrin. This is possibly due to the inaccessibility of TtGluA to the linkages in the crystal structures of these polysaccharides. These were different from the other two characterized Thermoanaerobacter α-glucosidases. The αglucosidase from Thermoanaerobacter thermohydrosulfuricus can hydrolyze not only maltooligosaccharides and pNPG but also polysaccharides such as starch and pullulan [3]. However, the α-glucosidase of Thermoanaerobacterium thermosaccharolyticum can hydrolyze pNPG and isomaltose but has no activity on maltose, and the highest activity is shown towards pNPG [8]. These differences indicate probably different catalytic mechanisms of TtGluA and the two Thermoanaerobacter α-glucosidases. This enzyme also showed no activity on sucrose, trehalose, raffinose, melizitose, isomaltooligsaccharides, and p-nitrophenyl-βD-glucopyranoside. Thus, it was concluded that TtGluA was a typical α-1,4-glucosidic maltooligosaccharideshydrolyzing enzyme, more like a maltase, which preferred similar to the enzyme from Sulfolobus solfataricus [25]. This property, in combination with the thermostability, makes T. tengcongensis α-glucosidase potentially useful in the amylose saccharification process in industry. Transglycosylation Activity To assess whether TtGluA could perform transglycosylation, TtGluA was incubated with maltose of different concentrations (20-300 mM) for 5 h. As shown in Fig. 7A, TLC analysis of the products revealed that a strong transglycosylation activity was presented when the maltose concentration reached 50 mM, producing more oligosaccharides with higher degree of polymerization than the substrates, whereas only hydrolytic product was released with 20 mM maltose. This indicated that TtGluA possessed transglycosylation activity, which showed dependence on the substrate concentration. From Fig. 7A, a concomitant increase of transglycosylation products and maltose substrate concentration was observed.

Fig. 7. TLC analysis of transglycosylation products. Left: 5 h incubation with different concentrations of maltose. Lane 1, 20 mM; lane 2, 50 mM; lane 3, 100 mM; lane 4, 150 mM; lane 5, 200 mM; lane 6, 300 mM; lane M, marker. Right: Different reaction times with 200 mM maltose. Lane 1, 0 h; lane 2, 2 h; lane 3, 5 h; lane 4, 10 h; lane 5, 16 h; lane 6, 20 h; lane M, marker. G1, glucose; G2, maltose; G3, maltotriose; G4, maltotetraose; G5, maltopentaose.

1554

Zhou et al.

Fig. 8. HPLC chromatogram of the reaction mixture in the transglycosylation assay.

A. After 2 h incubation; B. After 5 h incubation; C. After 10 h incubation; D. After 16 h incubation. For the reaction at 45 C, 200 mM maltose in 50 mM citric acid-Na HPO buffer (pH 6.0) was used with 5 µg of purified recombinant TthGluA. G, glucose; G2, maltose; G3, maltotriose; IG2, isomaltose; IG3, isomaltotriose; IG4, isomaltotetraose. The integral area ratio of each peak in the chromatogram of 16 h reaction products was 4.9 (G): 1.2 (G2): 2.0 (IG2): 1.0 (IG3): 1.4 (IG4), which corresponded to the concentration of 144.9 mM (G), 22.7 mM (G2), 30.1 mM (IG2), 13.0 mM (IG3), and 26.7 mM (IG4), respectively. o

2

4

To further investigate the constituents of the transglycosylation products, HPLC was used to detect the products from 200 mM maltose for reaction at different times (2 h, 5 h, 10 h, 16 h, and 20 h). As shown in Fig. 7B, the yield of transglycosylation products increased when the incubation time was extended. The HPLC results in Fig. 8 showed that the transglycosylation products were a mixtures of maltotriose (α-1,4-linkage), isomaltotriose, and isomaltetraose (α-1,6-linkage) after 2 h reaction (Fig. 8A). Isomaltose was present after 5 h of incubation (Fig. 8B). This indicated that not only maltose but also glucose was used as acceptors for glycosyl transfer. When the incubation time was extended to 10 h and 16 h, isomaltose replaced maltotriose and isomaltooligosaccharides were the main transglycosylation products (Fig. 8C and 8D). These properties are significantly different from the α-glucosidase of T. thermohydrosulfuricus, which only uses maltose as the acceptor and the final transglycosylation products are only α-1,4-linked maltooligosaccharides [3]. In addition, the yield of glucose increased concomitantly with the decrease of the maltose when the incubation time increased (Fig. 8).

Although previously characterized glycosidases are being applied for oligosaccharide synthesis, their applications are often limited by low yields and poor regioselectivity [22, 24]. The low yield was because of the inevitable drawback of glycosidase reactions, in which the products of transglycosylation were also the substrates for the enzymes and undergo hydrolysis [18]. Applications of α-glucosidases for synthesis of oligosaccharides by transglycosylation reactions using maltose as the sugar acceptor/donor have been extensively explored. However, the synthetic products produced by most reported α-glucosidases were mixtures of oligosaccharides consisting of α-1,2, α-1,3, α-1,4, or α1,6 linkages [9, 11, 13, 15], or only products of α-1,4linked maltooligosaccharides [3]. As revealed by HPLC analysis, TtGluA showed exclusive regiospecificity for producing α-1,6-linked oligosaccharides with a long reaction time (more than 10 h). The quantitative HPLC analysis showed that the ratio of isomaltose, isomaltotriose, and isomaltetraose of the products was 2.3: 1:2.1 after 16 h reaction. About 53% of maltose was transformed to isomaltooligosaccharides, whereas about 36% was hydrolyzed


to glucose after 16 h reaction, with only 11% of maltose left in the reaction mixture. At the same time, the transglycosylation products of TtGluA were mainly isomaltooligosaccharides, which cannot be further degraded by TtGluA, leading to a high yield. These make TtGluA a superior enzyme to synthesize isomaltooligosaccharides, which is a promising dietary constituent and functional food supplement in industry. In conclusion, the moderate thermostable α-glucosidase (TtGluA) from T. tengcongensis MB4 is successfully expressed in E. coli and purified. The biochemical properties of TtGluA showed much difference with reported αglucosidases. Since T. tengcongensis MB4 is a saccharolytic bacterium, TtGluA with maltooligosaccharides hydrolytic activity probably plays an important function in the saccharometabolism of this obligately anaerobic strain [29]. The regiospecificity and high yield for α-1,6-linked oligosaccharides synthesis make TtGluA appear to be an excellent candidate for application in the industrial production of isomaltooligosaccharides.

9.

10.

11.

12.

13.

14.

Acknowledgments This work was supported by NSFC Grant 30621005 and Ministry of Sciences and Technology of China (863 programs) Grants 2006AA020201 and 2007AA021306.

15.

REFERENCES

16. 17.

1. Antranikian, G., C. Herzberg, and G. Gottschalk. 1987. Production of thermostable α-amylase, pullulanase, and α-glucosidase in continuous culture by a new Clostridium isolate. Appl. Environ. Microbiol. 53: 1668-1673. 2. Antranikian, G. 1990. Physiology and enzymology of thermophilic bacteria degrading starch. FEMS Microbiol. Rev. 75: 201-218. 3. Bernhard, W., L. Friedrich, R. Johannes, and B. Karin. 1997. A novel type of thermostable α-glucosidase from Thermoanaerobacter thermohydrosulfuricus exhibiting maltodextrinohydrolase activity. Biochem. J. 328: 581-586. 4. Broek, L. A. M., K. Struijs, J. C. Verdoes, G. Beldman, and A. G. J. Voragen. 2003. Cloning and characterization of two αglucosidases from Bifidobacterium adolescentis DSM20080. Appl. Microbiol. Biotechnol. 61: 55-60. 5. Buchholz, K. and J. Seibel. 2003. Isomaltooligosaccharides, pp. 63-74. In G. Eggleston and G. L. Cote (eds.). Oligosaccharides in Food and Agriculture. ACS Symposium Series, Vol. 849. American Chemical Society, Washington, DC. 6. Chiba, S. 1997. molecular mechanism in α-glucosidase and glucoamylase. Biosci. Biotech. Biochem. 61: 1233-1239. 7. Crittenden, R. G. and M. J. Playne. 1996. Production, properties and applications of food-grade oligosaccharides. Trends Food Sci. Technol. 7: 353-361. 8. Ganghofner, D., J. Kellermann, W. L. Staudenbauer, and K. Bronnenmeier. 1998. Purification and properties of an

18.

19.

20.

21.

22. 23.

24.

1555

amylopullulanase, a glucoamylase and α-glucosidase in the amylolytic enzyme system of Thermoanaerobacterium thermosaccharolyticum. Biosci. Biotechnol. Biochem. 62: 302-308. Giuseppina, A., G. Assunta, T. Annabella, M. Ernesto, and T. Antonio. 2006. Hydrolyses and transglycosylations performed by purified α-D-glucosidase of the marine mollusk Aplysia fasciata. J. Biotechnol. 122: 274-284. Hannes, M. 1988. Purification and some properties of the extracelluar α-amylase-pullulanase produced by Clostridium thermohydrosulfuricum. Biochem. J. 250: 813-818. Hung, V. S., Y. Hatada, S. Goda, J. Lu, Y. Hidaka, Z. Li, et al. 2005. α-Glucosidase from a strain of deep-sea Geobacillus: A potential enzyme for the biosynthesis of complex carbohydrates. Appl. Microbiol. Biotechnol. 68: 757-767. Kanda, T., H. Yatomi, S. Makishima, Y. Amano, and K. Nisizawa. 1989. Substrate specificities of exo- and endo-type cellulases in the hydrolysis of β-1,3- and α-1,4-mixed D-glucans. J. Biochem. 150: 127-132. Kato, N., S. Suyama, M. Shirokane, M. Kato, T. Kobayashi, and N. Tsukagoshi. 2002. Novel α-glucosidase from Aspergillus nidulans with strong transglucosylation activity. Appl. Environ. Microbiol. 68: 1250-1256. Kimura, A., M. Takata, Y. Fukushi, H. Mori, H. Matsui, and S. Chiba. 1997. A catalytic amino acid and primary structure of active site in Aspergillus niger α-glucosidase. Biosci. Biotech. Biochem. 61: 1091-1098. Kobayashi, I., M. Tokuda, H. Hashimoto, T. Konda, H. Nakano, and S. Kitahata. 2003. Purification and characterization of a new type of α-glucosidase from Paecilomyces lilacinus that has transglucosylation activity to produce α-1,3- and α-1,2-linked oligosaccharides. Biosci. Biotechnol. Biochem. 67: 29-35. Krasikov, V. V., D. V. Karelov, and L. M. Firsov. 2001. αGlucosidase. Biochemistry (Moscow) 66: 267-281. Leveque, E., S. Janecek, B. Haye, and A. Belarbi. 2000. Thermophilic archaeal amylolytic enzymes. Enz. Microb. Technol. 26: 3-14. Lu, L., M. Xiao, X. Xu, Z. Li, and Y. Li. 2007. A novel betagalactosidase capable of glycosyl transfer from Enterobacter agglomerans B1. Biochem. Biophys. Res. Commun. 356: 78-84. Madi, E., G. Antranikian, K. Ohmiya, and G. Gottschalk. 1987. Thermostable amylolytic enzymes from a new Clostridium isolate. Appl. Environ. Microbiol. 53: 1661-1667. Mala, S., H. Dvorakova, R. Hrabal, and B. Kralova. 1999. Towards regioselective synthesis of oligosaccharides by use of alpha-glucosidases with different substrate specificity. Carbohydr. Res. 322: 209-218. Mizrahi, L. and Y. Achituv. 1989. Effect of heavy metals ions on enzyme activity in the Mediterranean mussel, Donax trunculus. Bull. Environ. Contam. Toxicol. 42: 854-859. Monsan, P. and F. Paul. 1995. Enzymatic synthesis of oligosaccharides. FEMS Microbiol. Rev. 16: 187-192. Nakao, M., T. Nakayama, M. Harada, A. Kakudo, H. Ikemoto, S. Kobayashi, and Y. Shibano. 1994. Purification and characterization of a Bacillus sp. SAM1606 thermostable αglucosidase with transglucosylation activity. Appl. Microbiol. Biotechnol. 41: 337-343. Plou, F. J., M. T. Martin, S. Gomez, M. Alcalde, and A. Ballesteros. 2002. Glucosyltransferases acting on starch or sucrose for the synthesis of oligosaccharides. Can. J. Chem. 80: 743-752.

1556

Zhou et al.

25. Rolfsmeier, M. and P. Blum. 1995. Purification and characterization of a maltase from the extremely thermophilic Crenarchaeote Sulfolobus solfataricus. J. Bacteriol. 177: 482-485. 26. Suzuki, Y., M. Nobiki, M. Matsuda, and T. Sawa. 1997. Bacillus thermoamyloliquefaciens KP1071 α-glucosidase I1 is a thermostable M, 540 000 homohexameric α-glucosidase with both exo-α-1,4glucosidase and oligo-1,6-glucosidase activities. Eur. J. Biochem. 245: 129-136. 27. Takenaka, F. and H. Uchiyama. 2000. Synthesis of alpha-Dglucosylglycerol by alpha-glucosidase and some of its characteristics. Biosci. Biotechnol. Biochem. 64: 1821-1826. 28. Ulrike, S., M. Frank, and A. Garabed. 1991. Purification and properties of a thermoactive glucoamylase from Clostridium thermosaccharolyticum. Appl. Environ. Microbiol. 57: 2317-2323.

29. Xue, Y., Y. Xu, Y. Liu, Y. Ma, and P. Zhou. 2001. Thermoanaerobacter tengcongensis sp. nov., a novel anaerobic, saccharolytic, thermophilicbacterium isolated from a hot spring in Tengcong, China. Int. J. Syst. Evol. Microbiol. 51: 13351341. 30. Yamamoto, T., T. Unno, Y. Watanabe, M. Yamamoto, M. Okuyama, H. Mori, S. Chiba, and A. Kimura. 2004. Purification and characterization of Acremonium implicatum α-glucosidase having regioselectivity for α-1,3-glucosidic linkage. Biochim. Biophys. Acta 1700: 189-198. 31. Zdzieblo, A. and Synowiecki. 2002. New source of the thermostable α-glucosidase suitable for single step starch processing. Food Chem. 79: 485-491.