Supplementary Table 1. List of databases, sequence ...

Recommend Documents

Supplementary Table 1. Detailed list of EcMs

Amanita citrina. Amanita farinosa. Amanita flavipes. Amanita fuliginea. Amanita fulva. Amanita griseofarinosa. Amanita hemibapha. Amanita longistriata.

Supplementary Table 1. List of the meteorological

Supplementary Table 1. List of the meteorological stations .... 45 Saikhan. 44.0953. 103.5378. 1300 Desert ... 49 Zamiin-Uud. 43.7139. 111.9042. 964 Desert ...

Supplementary Table 1. Retained sequence reads for

Tremellomycetes. Saccharomycetes. Eurotiomycetes. Dothideomycetes. Supplementary Table 1. Retained sequence reads for individual mock community ...

Supplementary information Table 1. OTS sequence ...

-1.56699624. 9. 5. STIM2. TTATATTCAAAGATAGCAcagttctgaatgatggtggGACAAGGCATGAGAGTGT. -1.5782592. 10. 6. NC_022277.1.

1 | Page Supplementary Table 1: List of 490 proteins ...

P19838. NFKB1_HUMAN Nuclear factor NF-kappa-B p105 subunit. NFKB1. P20151. KLK2_HUMAN. Kallikrein-2. KLK2. P20700. LMNB1_HUMAN Lamin-B1.

SUPPLEMENTARY TABLE 2 SEQUENCE ANALYSIS

Total rp genes analyzed: 32 small subunit and 47 large subunit = 79 rp genes. RP. h-s h-5'n h-5'is m-s m-5'n m-5'is Other Orthologues. SA. R. 999. 634. R. 1000.

SUPPLEMENTAry TAbLE Supplementary Table 1 ...

Supplementary Table 1: Primers used for qrT-PCr. Gene name. Forward primer 5â²-3â². Reverse primer 5â²-3â². ZEB1. GACAGTGTTACCAGGGAGGAGCA.

Supplementary Table 1 Supplementary Table 2

Supplementary Table 1. Pearson's correlation coefficients (r) between nonmetric multidimensional scaling ordination axes and species of Sebastes visually ...

Supplementary Table 1. Primer sequence of cytokine ...

Supplementary Figure 1. Increased expression of VEGFR1 protein in Akita diabetic mouse retina. (A & B) Western blots (WB) results. The anti-VEGFR1 antibody.

SUPPLEMENTARY DATA Supplementary Table 1

Antiglycemic drugs (%). 230 (52%). 430 (63%). Patient characteristics at follow up of participants in the Danish arm of Anglo-Danish-Dutch. Study of Intensive ...

SUPPLEMENTARY DATA Supplementary Table 1

Deuka primo care was fed to 2.5-month-old GIPRdn transgenic pigs and controls while Deuka porfina U was fed to 5-month-old pigs; ME: metabolizable energy.

SUPPLEMENTARY FILES Supplementary Table 1

Elektra Papadopoulos. Food and Drug Administration. Indira Hills ... Jeremy Hobart. Plymouth Hospital. Adam Jacobs ... Gary Cutter. University of Alabama ...

SUPPLEMENTARY DATA Supplementary table 1

Chemical species. Murraya koenigii. Piper betle. Mentha spicata. Glycosides. +. +. +. Terpenoid. +. +. +. Tannin. +. +. +. Steroid. +. +. +. Anthraquinone. +. +. +.

Supplementary Table 1. List of known proteins ... - Semantic Scholar

HEXIM2; ABI2; TAB3; ZBTB9; NUP62; TP53; ZBTB14; ARHGEF15; MEOX2;. JAKMIP2; PRRC1; TRAF2; SPERT; RBPMS; IRAK1; TCF4; THAP7; MTUS2;.

Supplementary Table 1: List of primers used for RT ...

Olig1 Forward: TTCCGAGCTGGATGTTACGC. Olig1 Reverse: AGGGAAGTGGAGACTAAGTAAGG. Nod1 Forward: GAAGGCACCCCATTGGGTT. Nod1 Reverse: ...

Supplemental Material Supplementary Table 1. Detailed list of the ...

Detailed list of the applied inclusion and exclusion criteria for 11 randomized clinical trials ..... Hypertension (SBP >190 mm Hg and/or DBP >100 mm Hg).

Supplementary Table 1. List of materials used in the

Non-Essential Amino Acids (NEAA) 100X. 11140-020. ThermoFisher ... Antibiotic/antimycotic 100X. 15240-062 ... RT2 SYBR Green Master Mix. 330523. Qiagen.

Supplementary Table 1: List of Chromosome Clusters by ... - PLOS

BG085359. 19298. 174056902. Cluster 3. Chromosome 2. BG073109. 277396. 69660529. BG064709. 20823. 69699684. Cluster 4. Chromosome 2. BQ550512.

Supplementary Table 1. List of primer pairs used in ...

Rt-1. Rt. Hypothetical protein. (A6122_2884). TTGACCATCTGGAAGTCGACCC ACCGACCCGACAAAGGACATC. 60. 578. Rt-2. Rt. CAAX protease.

Supplementary Table 1. List of taxa used in the ...

DQ790080 DQ790037 DQ813368. Glycinde armigera Moore, 1911. DQ790079 DQ790036 DQ813367. Nephtyidae. Nephtys longosetosa (Oersted, 1842).

Supplementary Table 1. Complete list of the top KEGG ... - PLOS

Page 1. Supplementary Table 1. Complete list of the top KEGG Pathways that overlapped significantly with the predicted Steiner Forest Network. Pathway name.

Supplementary Table 1: List of the samples from

Overall Signal/Curvefit Quality (High >70% of peptides fit on average across three models, Low < 50%. [fit defined as R2 > 0.8]). 631030521A1 Primary Tumor ...

Supplementary Table 3. List of characteristic

comb. res.**, P. angulata (Ma,. 1996) comb. nov. Ma (1996), Fang et al. (2009). Gibbosulinae (Gibbosula). Crown [mid-Cretaceous]. Gibbosula Simpson, 1900 ...

Supplementary Table S4. List of significantly changed

Maltose. 825. 26.80 160 1.882 0.035. 1.831. Citric acid. 824. 18.84 273 1.290 0.038 1.600. Threonine. 814 ... 3-Hydroxybutyric acid. 427. 10.67 281 1.736 0.021 ...

Supplementary Table 1. List of databases, sequence ...

Download PDF

5 downloads 0 Views 562KB Size Report

Comment

Rhodomonas salina. Cryptomonas ovata. 0.74. Guillardia theta. 1. 0.29. Voromonas pontica. Chromera velia. 0.45. Colpodella angusta. 0.81. Microheliella maris.

Supplementary Table 1. List of databases, sequence identifiers and accessions used in the work. Supplementary Figure 1. Phylogeny of EF1A with ciliates. The tree was reconstructed using Bayesian inference (PhyloBayes) under CAT profile mixture model with 4 discrete gamma categories and the exchange rates fixed by the LG model (maxdiff=0.217; loglik effsize=58). Node support values are given for two types of tree inference methods – Bayesian posterior probability (left) and maximum likelihood bootstrap support value (right); bootstrap support was generated on the basis of 1000 replicates using RAxML and LG+G+I model. Support values for nodes with Bayesian posterior probabilities