Primitive Neuroectodermal Tumors Expression of ...

2 downloads 0 Views 1MB Size Report
Aug 1, 1997 - by genes of the NEUROD/atonaland ACHAETESCUTE families. We analyzed expression of human NEURODJ, NEUROD2, NEUROD3, and.
Expression of Neurogenic Basic Helix-Loop-Helix Genes in Primitive Neuroectodermal Tumors Robert C. Rostomily, Olivia Bermingham-McDonogh, Mitchel S. Berger, et al. Cancer Res 1997;57:3526-3531. Published online August 1, 1997.

Updated Version

Citing Articles

E-mail alerts Reprints and Subscriptions Permissions

Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/16/3526

This article has been cited by 14 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/57/16/3526#related-urls

Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected].

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

[CANCER RESEARCH 57. 3526—3531.August 15, 19971

Expression of Neurogenic Basic Helix-Loop-Helix

Genes in Primitive

Neuroectodermal Tumors1 Robert C. Rostomily,2 Olivia Bermingham-McDonogh, Mitchel S. Berger, Stephen J. Tapscott, Thomas A. Reh, and James

M. Olson3

Departments of Neurological Surgery (R. C. R., M. S. B.J, Biological Structure fR. C. R., 0. B-M., T. A. RI, and Neurology [S. .1. Ti, The University of Washington School of Medicine, Seattle, Washington 98195; Division of Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98109 (S. J. T., J. M. 0.1; and Divisions ofNeurological Surgery (R. C. R.] and Pediatric Hematology-Oncology fJ. M. 0.], The Children ‘s Hospital and Medical Center, Seattle, Washington 98105

ABSTRACT The basic helix-loop-helix (bHLH) class of transcription factors plays a pivotal

role in tissue-specific

determination

and differentiation.

Moreover,

dysregulated expression or loss of function of these factors contributes to leukemogenesis and solid tumor development. Neurogenesis is regulated

by genes of the NEUROD/atonaland ACHAETESCUTE families. We analyzed expression of human NEURODJ, NEUROD2, NEUROD3, and ACHAETE SCUTE 1 (HASHJ) in cerebellar and cerebral primitive neu

commit progenitors to a neural fate and induce terminal neuronal differentiation. The NeuroD family, bike the myogenic MyoD family, consists of members of class I bHLH transcription factors that regulate tissue specific differentiation (3—8). MyoD family members orchestrate myogenic differentiation and are universally expressed in rhab domyosarcomas, yet rhabdomyosarcomas evade terminal differen

tiationat beastin part by inhibitingthe activityof MyoD(9—12).

variety of neuroectodermal tumors by Northern analysis and in situ hybridization. NEURODJ was expressed in each of the 12 medulloblas toma specimens, whereas NEUROD2 and NEUROD3/neurogenin were

On the basis of similarities between NeuroD and MyoD, we hypothesized that NeuroD family members may be expressed in medubbobbastomas as markers of a neurogenic lineage. Because distinct populations of neurons express different neurogenic bHLH

expressed

transcription

roectodermal

tumors

(PNETs),

in partly

gliomas,

overlapping

and

cell lines

derived

subsets of medulloblastomas.

from

a

All of the

tumors that presented with distant metastases expressed NEUROD3. The only other NEUROD3-positive tumor progressed early in treatment. Hu man ACHAETESCUTE homologue (HASHJ) was not expressed in medal loblastomas (infratentorial PNETs) but was expressed in three of five supratentorial

PNETs.

Neuroectodermal

tumor

cell lines derived

from

other sites (e.g., neuroblastoma and retinoblastoma) expressed NeuroD and ACHAETE SCUTE family members. No NEUROD message was detected in glial tumors or cell lines. Neurogenic bHLH transcription factor expression patterns suggest that specific family members may contribute to or reflect biological differences that arise during malignant transformation.

INTRODUCTION Molecular events associated with medulboblastoma and other child hood brain tumor development are very poorly understood. Currently, no

biological

markers

facilitate

stratification

of

treatment

groups,

assist with prognosis, or serve as targets for therapeutic intervention (1).

Medullobbastomas express neuronab intermediate filaments, synap tic vesicle

proteins,

growth

factor receptors,

and adhesion

molecules,

suggesting that they arise from neurobbasts that escape terminal dif ferentiation (2). The mechanisms by which cells escape terminal differentiation can now be addressed because the NeuroD family of bHLH4 proteins was recently identified. NeuroD and the rebated achaete scute transcription factors regulate activation of genes that Received1/14/97; accepted6/10/97. The costs of publication of this article were defrayed in part by the payment of page

factors

during

that bHLH patterns would different neuronal lineages. NEUROD

and ACHAETE

development,

we further

vary between SCUTE

PNETs

genes are expressed

hypothesized

arising

from

in overlap

ping but distinct populations of neuroblasts during neuronab develop ment. A population of immature proneurab cells that reside in the ventricular zone first express NEUROD3/neurogenin at mouse em bryonic day 9.5 (E9.5; Refs. 4 and 6). Ventricular zone cells migrate to the periventricubar zone, where NEURODJ is first expressed (3, 6). NeuroD2 expression commences on Ell.5 (4). By E16, NEUROD3 can no longer be detected by Northern analysis of RNA derived from brain tissue (4). In contrast, NEURODJ and NEUROD2 are expressed throughout cerebeblar development and in adult cerebellum, primarily in the granule cell layer (3, 4). The importance of these genes in neuronal development was established by their ability to induce ectopic neurogenesis and premature neuronal differentiation when injected into Xenopus embryos (3, 4, 6). ACHAETE SCUTE homo bogues make up a distinct family of neurogenic bHLH transcription factors that share homology with the NEUROD family. Achaete scute null mutant mice failed to develop sympathoadrenal neural cells and olfactory neurons (13). Mammalian achaete scute (mashi) expression was reported in cerebellum, but it remains unclear whether it is expressed in the same neural precursors as neuroD family members (14). MATERIALS

AND METHODS

Surgical specimens from 13 medulbobbastomas, 5 supratentorial PNEIs, and 6 pediatric gliomas and cell lines derived from 14 neuroectodermal tumors and

charges. This article must therefore be hereby marked advertisement in accordance with

3 gliomas

18 U.S.C. Section 1734 solely to indicate this fact.

HASHJ by Northern analysis. Because surgicaltissue quantity was limited, not

t This work

was supported

by NINDS

NS 09458 (to R. C. R), NIH Grants ROl

28308 and NS 30304 (to T. A. R.), and the Seattle Children's

NS

Hospital, “Jesse'sPerfect

Peach― Neurooncology Research Fund (to J. M. 0). R. C. R. was supported by the Charles A. Elsberg Fellowship in Neurological Surgery of the New York Academy of Medicine

and by Neurosurgery Training Program Grant N07l44. S. J. T. was supported by an American Cancer Society grant. J. M. 0. was supported by the Emily Dorfman Founda tion through the American Brain Tumor Association. 2 Present

address:

59th

Medical

WingIMKFN,

Department

of

Neurosurgery,

whom

requests

for

reprints

should

be addressed,

at the Fred

Hutchinson

Cancer

Research Center, Mailstop C3-l68, 1100 Fairview Avenue, Seattle, WA 98109. 4 The abbreviations used are: bHLH, basic helix-loop-helix; ectodermal tumor.

evaluated

for expression

of NeuroD

family

members

and

all bHLH members were tested on each specimen. In situ analysis was used to confirm Northern data and determine whether expression was ubiquitous in

tumor cells. Studies were done in accordance with the Children's Hospital Human Subjects Institutional Review Board guidelines. Human tumor tissue samples

were

obtained

at craniotomy.

Samples

were

either

snap

frozen

in

liquid nitrogen and stored at — 80°C,or they were placed in tissue culture

Wilford

Hall Medical Center, 2200 Bergquist Drive, STE1, Lackland AFB, San Antonio, TX 78246-5300. 3 To

were

media and then mechanically dissociated and filtered, and the centrifuged cell

pellet was snap frozen and stored at — 80°C. Cell Culture. The cell lines listed in Table2 were obtainedfromAmerican Type Culture Collection with the following exceptions: NLF, NGP, and NMB

PNET, primitive neuro

(G. Brodeur, University of Pennsylvania, Philadelphia, PA); UW228, I98G, 3526

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

NEURODAND HASHI IN NEUROECI'ODERMALTUMORS

and SNB 19 (J. Silber and M. Berger, University ofWashington, Seattle, WA). Y79, WERI, H209, and H82 were grown in RPM! 1640 (Life Technologies, Inc.) with 10% FBS (Hyclone). The remainder were grown in Eagle's MEM with Earle's balanced salt solution, non-essential amino acids (Life Technol ogies, Inc.), 1 mist pyruvate (Life Technologies,

MMMMM 1 2345 A

Inc.), and 10% fetal bovine

serum or bovine calf serum. Northern Analysis. Total RNA was extracted from confluent cell lines and tissue specimens or cell pellets using Trizol reagent (Life Technolo gies, Inc.). Northern

analysis

was performed

according

to published

-2.6

pro

cedures with minor modifications (15, 16). Due to limited sample quantity, NEUROD2 and NEUROD3 expression was determined for some specimens on stripped membranes that had previously been used for NEURODI and HASHJ expression,

respectively.

Stripped filters exposed to film for 4 days

were found to be negative for NEURODJ bands prior to reprobing. Human NEURODJ message was detected by either a full-length 1.6-kb cDNA probe or an 800-bp divergent probe (carboxyl to bHLH domain) isolated with Kpn digestion (3). The human NEUROD2 probe spanned 500 bp in the 3' divergent

region between

Pst and Sac! excision

sites (4). The human

NEUROD3/neurogenin probe spanned 800 bp, from the Sma to the Pst restriction sites of the clone SK2OA1 (4). HASHJ probe spanned the bHLH domain using the PCR primers GTCACAAGTCAGCGCCCAAG and CGACGAGTAGGATGAGACCG.HASHJfindings were confirmed with a 0.9-kb fragment isolated from a human fetal cDNA library (Stratagene) that was homologous to the published sequence in the 3' untranslated region (17). None of the divergent

probes cross-reacted

1.1-IL -2.6

C

-1.9

with RNA from other

family members under the conditions used. In Situ Hybridization. Paraformaldehyde-fixed frozen tumor specimens

S

D

were sectioned at l2-g.@mintervals and then pretreated with 4% proteinase K, acetic anhydride, and 0.1% Triton X-lOO (NEURODI) or 4% proteinase K and

acetic anhydride (NEUROD2 and NEUROD3). In situ analysis was performed according to a published procedure except that the concentration of NBT was reduced

10-fold

for NEUROD2

and NEUROD3

assays

-2.6

(18).

E$j)S@

RESULTS Neurogenic bHLH Genes in Human Tumor Specimens. Neu roDi was expressed in each of the 12 medulbobbastoma surgical specimens analyzed (Fig. 1; Table 1). Specimens 2—4,6, and 10 also expressed NEUROD2, and specimens 1, 3, 5, 8 and 9 ex pressed NEUROD3/neurogenin. Four of the patients whose tumors expressed NEUROD3/neurogenin presented with disseminated dis ease, and the fifth developed clinical and radiographic progression in the 3-week interval between tumor resection and initiation of radiation therapy. Although the association between NEUROD3/ neurogenin expression and medulboblastoma dissemination is sig nificant using the Fisher exact test, a larger study will be necessary to conclusively evaluate the prognostic implications of NEUROD3/ neurogenin expression. In situ hybridization using antisense probes for each NEUROD gene revealed robust staining in the characteristically scant cytoplasm, whereas background hybridization with sense probes was minimal (Fig. 2 and data not shown). In an expressing tumor, nearly all of the cells were positive for the particular NeuroD mRNA, consistent with the homogeneous nature of medulboblastomas. Esthesioneuroblas

tomasamplesassayedbyinsituanalysisdemonstrated patchyexpres sion of NEURODJ and NEUROD3/neurogenin, suggesting that cx pression may be more heterogeneous in some tumors (data not shown). Medulbobbastoma (infratentoriab PNET) samples probed with sequence from a human clone of HASH! were uniformly negative (Fig. 1; Table 1). In contrast, three of five supratentorial PNETs expressed HASh (Fig. 3; Table 1). Conversely, all medulboblas toma samples expressed NEURODJ, but only one of four supra tentorial PNETs expressed NEURODI . These results suggest that although medulboblastoma and supratentoriab PNET are similar

F@ftØ Fig. 1. Representative

Northern analyses of NEURODI

(A), NEUROD2 (B), NEU.

ROD3/neurogenin (C), and HASH! (D) expression in medulloblastoma surgical speci mens. E and F, loading variability of 20 @g of RNA as assayed by a probe to the human glyceraldehyde-3-phosphate deshydrogenase gene (GAPDH). Lanes (left to right), pa tients Mt—MS.These and other patient data are summarized in Table I . Molecular weight

markers are indicated on the right.

histologically, they probably derive from distinct progenitor cell populations. Six pediatric gliomas, including cerebelbar pilocytic astrocytoma, cerebral pilocytic astrocytoma, ependymoma, and malignant astrocy toma specimens, and three human glioma cell lines failed to express any of the neurogenic bHLH messages (Table 2 and data not shown). Neurogenic bHLH Expression In Neuroectodermal Tumor Cell Lines. We next evaluated cell lines derived from neuroectodermal tumors to determine the patterns of neurogenic bHLH expression. Northern analysis was performed on thirteen cell lines derived from tumors of presumed neuroectodermal origin. Consistent with patient samples and developmental data discussed above, D283 and D34l metastatic medulloblastoma cell lines expressed NEURODI and NEUROD3/neurogenin (Table 2). Although the medulloblastoma cell lines did not express HASHI, it was notable that the neuroblastoma cell lines SKN-SH, NGP, NMB, and 1MR32 expressed HASHJ, a gene that is critical for sympathoadrenal lineage development (13). SKN-SH, NGP, and 1MR32 coexpressed NEURODI, but NEUROD2

3527

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

NEURODAND HASH! IN NEUROECTODERMALTUMORS

medulloblastomaNorthern

Table I NEUROD genes and HASH! in

analysis was performed on 20 @sg of RNA from 12 patients with cerebellar PNETs and 5 patients with supratentorial PNETs using cDNA probes to NEUROD!, NEUROD2, NEUROD3. or HASH!. Data from patientsMI—MSare shown in Fig. I, and data from patientsMb, Ml3, and Sl—S5are shown in Fig. 3. Sampleswere scoredpositive if the

appropriate —80°C.DistantPatient size band was present after ovemight hybridization under high-stringency conditions followed by 24—72h of film exposure at HASH!Medulloblastomas Age PNETs)Ml

Sex

metastasis

NEURODI

NEUROD2

NEUROD3

(infrasentorial

—M2

S

M―

Yes

+

—

+

—M3 -M4

7 9

M M

No Yes

+ +

+ +

— +

10

M

No

+

+

—

to

M

No―

+

—

+

—

M? —M6

—M7

I

F

No

+

+

-M8 —M9 -MlO

7 13 7

M M F

No Yes Yes

+ + ND

ND ND

+ +

9

M

No

+

+

ND

8 6 3

M M M

No No No

+ + +

ND

ND ND ND

SI +52

17

M

ND

-

ND

ND

+S3' -54 +S5

2 2 3 7

M M M F

ND ND ND ND

ND + -

ND ND ND ND

ND ND ND ND

-Mll -Ml2 -Ml3 -Supratentorial

—

PNETs

aM.male: F,female, ND, not done. I, Tumor

progressed

( Recurrent

tumor

early in treatment. specimen

from

patient

52.

and NEUROD3 were absent in neuroblastoma cell lines. None of the NEUROD

-

mRNAs

were detectable

by Northern

analysis

other than those tested (e.g. , atonal homobogues) or that expression is below the limit of detection by Northern analysis. Retinoblastoma cell lines expressed NEUROD genes but did not express HASh. Y79, a cell line derived from familial retinobbastoma,

in DAOY

and UW228 medubboblastoma cells or NLF and SKN-MC neuroblas toma cells. It is possible that these cell lines express bHLH proteins

;A

Fig. 2. In situ analysis of NEUROD!, NEUROD2, and NEUROD3 in medulloblastoma samples. Top row, patient samples Ml0 (A), M4 (B), and M3 (C) stained with H&E. Bottom row, in situ analysis using antisense digoxin-labeled riboprobes NEUROD! on sample MlO (D), NEUROD2 on sample M4 (E), and NEUROD3 on sample M3 (F). Ten-gsm markers are shown in bottom left comer of each specimen in the top row. 3528

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

NEUROD AND HASH! IN NEUROECFODERMAL TUMORS

MSMSSSS

lines;

(c) all of the medubbobbastomas

1

312345

tisera

C

patients

who presented

reactive

to

neurod2

demonstrated

that

protein

expression

correlated with in situ and Northern analysis data.6 Every tumor sample derived from neuroectodermal tissue cx pressed one or more neurogenic bHLH genes, whereas no glial tumors expressed NeuroD family members. Medulboblastomas expressed

-2 6

11

NEURODJ, NEUROD2, and NEUROD3/neurogenin, allofwhich are expressed in developing cerebellum or cerebellar precursors (3, 4, 6). Likewise, neuroblastomas expressed HASH] and NEURODI, both of which

•0Sa

D,...@,..

Fig. 3. Northem analysis ofNEUROD! and HASH expression in supratentorial PNETs. A, NEUROD! expression in medulloblastoma samples MlO and Ml3 and in supratentorial

PNET samples S1-S5; B, HASH! expression in corresponding samples; C and D, GAPDH expression on lanes represented in rows A and B, respectively.

expressed NEURODJ and NEUROD3/neurogenin. WERI, a sponta neous retinoblastoma cell line, expressed NEURODJ but no others. NEURODJ is expressed in developing and mature retina, and retinal expression of NEUROD2 and NEUROD3/neurogenin is not yet known.5 Achaete scute homobogues are expressed in late but not early retinal progenitors (19, 20). The lineage from which small cell lung cancers arise remains controversial. The H82 cell line expressed NEURODJ and NEU ROD3/neurogenin, and H209 cells expressed HASHJ and NEUROD3 (Table 2). Additional experiments are needed to determine whether neurogenic bHLH factors are expressed because these tumors arise from neuroendocrine cells or whether NEUROD/ACHAETE SCUTE genes are deregulated in these tumors conferring a neuronal pheno type to cells derived from a nonneuronab lineage. NeuroD2 was not expressed in any neuroectodermal tumor line tested. It is possible that none of the cell lines tested were derived from NEUROD2-expressing tumors. Alternatively, NeuroD2 expres sion might confer a growth disadvantage to cells so that they are selected against in culture. DISCUSSION

(a) NEUROD] was expressed in all medulboblastomatumorsand two medublobbastoma cell lines; (b) NEUROD2 and NEUROD3/neuroge nm were expressed in subsets of medulboblastoma tumor specimens, and NEUROD3/neurogenin was expressed in medulboblastoma cell and T. A. Reh, unpublished

data.

are expressed

in the developing

autonomic

nervous

system

(3,

13, 14). In this study, HASH] expression distinguished some suprat entorial PNETs from infratentonal PNETs (medubloblastoma). Cur rently, PNETs from both sites are classified together and treated similarly, although they respond differently to therapy (1, 2 1—23). Thus, along with other genes expressed in restricted regions of the developing nervous system, such as pax, homeobox, and zinc finger genes, bHLH genes may provide clues to the lineage of tumor origin (24—26). Transcription factors contribute to malignant transformation by either dysregulation of factors that enhance growth and loss of cell cycle control (oncogenes) or by inactivation of transcription factors that normally regulate cell cycle or terminal differentiation (tumor suppressors or anti-oncogenes). bHLH family members have been described in each of these roles, although they have not traditionally been called proto-oncogenes or tumor suppressors. For example, chromosomal translocations of the bHLH genes E2A and Ta! to the DNA-binding domain of a homeobox gene and to the enhancer region of a T-cell receptor, respectively, result in leukemic transformation, presumably by inducing transcription of inappropriate target genes (27—29).In contrast, MyoD normally maintains a tumor suppressor robe by orchestrating myogenic cell cycle control and terminal differ entiation, but its function is diminished in rhabdomyosarcomas by expression of MyoD repressors and by limited availability of neces sary cofactors

(1 1, 12).

Within the limits of Northern analysis sensitivity, NEUROD3/ neurogenin has been described in two populations: the immature proneural cells that reside in the mitotically active ventricular zone and medulloblastoma samples from patients who presented with dis tant metastasis or who rapidly progressed (4, 7). This raises the question of whether NEUROD3/neurogenin serves a different role in normal development and malignancy than the other neurogenic bHLH factors tested. We previously localized NEURODJ, NEUROD2, and NEUROD3/neurogenin to chromosome regions 2q32, 17ql2, and 5q23—31, respectively (30, 3 1). Comparative genomic hybridization analysis

In this study, we examined the expression of neurogenic bHLH transcription factors in neuroectodermal tumors and cell lines by Northern analysis and in situ hybridization. We found the following:

5 0. Bermingham-McDonogh

from

with early signs of biologically aggressive disease expressed NEU ROD3/neurogenin; (d) NEUROD family members were also cx pressed in other neuroectodermal cell lines, including neuroblastomas, retinoblastomas, and small cell lung cancer; and (e) HASHJ was not expressed in medulloblastoma tumor samples or cell lines but was expressed in supratentorial PNETs and cell lines derived from periph eral nervous system neuroectodermal tumors, including neuroblas toma and small cell lung cancer. Preliminary experiments using an

of medulboblastoma

samples

demonstrated

gain of distal

5q

in 3 of 18 cases, consistent with the possibility that NeuroD3 is amplified or translocated in a subset of medulboblastomas (32). The more downstream neuronal differentiation factors, NEURODJ and NEUROD2, are more reminiscent of MyoD in rhabdomyosar coma. Whether these transcription factors regulate terminal differen tiation and induce cell cycle control in mammalian cells remains to be determined.

6 J@ M.

Olson,

If so, then the paradoxical

unpublished

observations.

3529

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

expression

of these genes

in

NEUROD

linesRNA

AND HASH)

IN NEUROECTODERMAL

4. McCormick,

Table 2 NEUROD genes and HASH! in cell

activation potentials within the neuroD gene family. Mol. Cell. Biol., !6: 5792—5800, 1996. 5. Kume, H., Maruyama, K., Tomita, T., Iwatsubo, T., Saido, T. C., and Obata, K. Molecular cloning of a novel basic helix-loop-helix protein from the rat brain. Biochem. Biophys. Rca. Commun., 2!9: 526—530, 1996.

byNorthem cancer, and glioma cell lines near confluence. Twenty @sg of RNA were analyzed

analysis and scored following ovemight hybridization at high stringency fol lowed by 24—72h film—80°C.NEURODI exposure at NEUROD2

M. B., Tamimi, R. M., Snider, L., Asakura, A., Bergstrom, D., and

Tapscott. S. J. NeuroD2 and neuroD3: distinct expression patterns and transcriptional

celllung was harvested from medulloblastoma, neuroblastoma, retinoblastoma, small

HASH!MedulloblastomaD283

TUMORS

NEUROD3

6. Ma, Q., Kintner, C., and Anderson, D. J. Identification of neurogenin, a vertebrate —D34l + —UW228 + -DAOY -NeuroblastomaSKN-SH -

— — -

+ + -

+NLF -NGP

+ -

-

-

+NMB

+

-

-

+1MR32 +SKN-MC

+

—

—

-

-

-

-RetinoblastomaY79

+

-

+

—Small

—WERI

+

—

—

cancerH82 cell lung —H209 +GliomaSNBI9

+ -

— -

+ +

—T98G -SF767 —a

— —

ND,

— NDa —

neuronal determination gene. Cell, 87: 43—52,1996. 7. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krause, M., Benezra, R.,

Blackwell, T. K., Tumer, D., Rupp, R., Hollenberg, S., Zhuang, Y., and Lassar, A. The myoD gene family: nodal point during specification of the muscle cell lineage. Science (Washington DC), 25!: 761—766,1991. 8. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P-F., Weintraub, H., and Lassar,

A. B. MyoDl : a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science (Washington DC), 242: 405—411, 1988.

9. Clark, J., Rocques, P. J., Braun, T., Bober, E., Arnold, H. H., Fisher, C., Fletcher, C., Brown, K., Gusterson, B. A., Carter, R. L., and Cooper, C. S. Expression of members of the myfgene family in human rhabdomyosarcomas. Br. J. Cancer, 64: 1039—1042, 1988. 10. Tonin, P. N., Scrable, H., Shimada, H., and Cavenee, W. K. Muscle-specific gene expression in rhabdomyosarcomas and stages of human fetal skeletal muscle devel

opment. Cancer Res., 5!: 5100—5106,1991. I I . Tapscott, S. J., Thayer, M. J., and Weintraub, H. Deficiency in rhabdomyosarcomas of a factor required for MyoD activity and myogenesis. Science (Washington DC). 259: 1450—1453,1993. 12. Fiddler, T. A., Smith, L., Tapscott, S. J., and Thayer, M. J. Amplification of MDM2 inhibits MyoD-mediated myogenesis. Mol. Cell. Biol., 16: 5048—5057, 1996. 13. Guillemot, F., La L-C., Johnson, J. E., Auerback, A., Anderson, D. J., and Joyner,

— ND —

A. L. Mammalian achaete-scute homolog-l is required for the early development of

not done.

14.

neuroectodermal tumors suggests that these cancer cells may gain a growth advantage by limiting the function of bHLH transcription factors. Prior to the isolation of NEURODJ, a study of MyoD function in neuroblastoma and medulboblastoma cell lines suggested that rhab domyosarcomas and neuroectodermal tumors may share mechanisms of evading bHLH transcription control (33). In addition, NEUROD2 expression or function might be affected by rearrangements associated with isochromosome 17q, the most common cytogenetic abnormality in medubboblastomas (32, 34). The study of mammalian neurogenic bHLH transcription factors promises to be rather complex. Multiple proneurab bHLH genes work combinatorialby with each other and with other devebopmen tal transcription activators to orchestrate development of the rela tively simple neural structures in Drosophila (35—37). From the more intricate vertebrate nervous system, a number of neurogenic bHLH proteins have been described (3—6, 19, 38—44). Basic information about these proteins, such as dimerization partners, DNA binding preferences, and biological targets, remains to be elucidated. As that work progresses, the current study shows that NeuroD family members may be useful diagnostically and pro vides a rationale

for a study addressing

of NEUROD3/neurogenin

the prognostic

implications

to this

work;

17.

Cumaraswamy, A., Borges, M., and Nelkin, B. D. Identification of a human achaete

sautehomologhighlyexpressedin neuroendocrinetumors.Proc.Natl.Acad.Sci. USA, 90: 5648—5652,1993. I 8. Schaeren-Wiemers, N., and Gerfin-Moser, A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry. !00: 431— 440, 1993. 19. Jasoni, C. L., Walker, M. B., Morris, M. D., and Reh, T. A. A chicken achaete-scute

homolog (CASH-l) is expressed in a temporally and spatially discrete manner in the developing nervous system. Development (Camb.), 120: 769—783, 1994. 20. Jasoni, C. L., and Reh, T. A. Temporal and spatial pattem of MASH-I expression in the developing rat retina demonstrates progenitor cell heterogeneity. J. Comp. Neu

rol., 319—327,1996. 21. Rorke, L. B., Gilles, F. H., Davis, R. L., and Becker, L. E. Revision of World Health Organization classification of brain tumors for childhood brain tumors. Cancer (Phila.), 56: 1869—1886, 1996.

22. Packer, R. J., Sutton, L. N., Elterman, R., Lange, B., Goldwein, J., Nicholson, H. S., Mulne, L., Boyets, J., Dangio, G., Wechslerjentzsch, K., Reaman, G., Cohen, B. H., Bruce, D. A., Rorke, L. B., Molloy, P., Ryan, J., Lafond, D., Evans, A. E., and Schut,

L. Outcome for children with medulloblastoma treated with radiation and cisplatin, CCNU, and vincristine chemotherapy. J. Neurosurg., 8!: 690—698,1994. S. B., Wisoff, J., Stevens, K. R., and Albright, A. L. Prognostic factors and treatment results for supratentorial primitive neuroectodermal tumors in children using radiation

We thank Jackie Lee, Anthony Gerber, Mary Beth McCormick, and Rulla for contributions

16.

23. Cohen, B. H., Zeltzer, P. M., Boyett, J. M., Geyer, J. R., Allen, J. C., Finlay, J. L., McGuire-Cullen, P., Milstein, J. M., Rorke, L. B., Stanley, P., Stehbens, J. A., Shurin,

expression.

ACKNOWLEDGMENTS

Tamimi

15.

olfactory and autonomic neurons. Cell, 75: 463—476, 1993. Guillemot, F., and Joyner, A. L. Dynamic expression of the murine Achaete-Scute homologue Mash-I in the developing nervous system. Mech. Dcv., 42: 171—185, 1993. Bennahmias, S. An altemative to the water bath/plastic bag method for hybridization of Southem and Northem blots. Am. Biotechol. Lab., 10—12,1989. Chen, M. S., Bermingham-McDonogh, 0., Danehy, F. T., Nolan, C., Scherer, S. S., Lucas, J., Gwynne, D., and Marchionni, M. A. Expression of multiple neuregulin transcripts in postnatal rat brains. J. Comp. Neurol., 349: 389—400, 1994. Ball, D. W., Azzoli, C. G., Baylin, S. B., Chi, D., Dou, S., Donis-Keller, H.,

Kathleen

Patterson

for pathology

assistance; Wendy Leisenring for statistical assistance; and J. Russel Geyer for critical evaluation of the manuscript.

and chemotherapy: a children's cancer group randomized trial. J. Clin. Oncol., 13: 1687—1696, 1995. 24. Kozmik, Z., Sure, U., Ruedi, D., Busslinger, M., and Aguzzi, A. Deregulated expression of PAX5 in medulloblastoma. Proc. Nail. Acad. Sci. USA, 92: 5709— 5713, 1996. 25. Yokota, N., Aruga, J., Takai, S., Yamada, K., Hamazaki, M., Iwase, T., Sugimura, H., and Mikoshiba, K. Predominant expression of human zic in cerebellar granule cell lineage and medulloblastoma. Cancer Res., 56: 377—383,1996. 26. Aruga, J., Yokota, N., Hashimoto, M., Furuichi, T., Fukuda, M., and Mikoshiba, K.

A novel zinc finger protein, zic, is involved in neurogenesis, especially in the cell

REFERENCES 1. Heideman, R. L., Packer, R. J., Albright, L. A., Freeman, C. R., and Rorke, L. B.

Tumors of the central nervous system. In: P. A. Pizzo and D. G. Poplack (eds.), Principles and Practice of Pediatric Oncology. ed. 2, pp. 633—682.Philadelphia: J. B. Lippincott Co., 1993. 2. Trojanowski, J. Q., Tohyama, T., and Lee, V. M-Y. Medulloblastomas and related

primitiveneuroectodennalbraintumorsofchildhood recapitulatemolecularmilestonesin the maturationof neuroblasts.Mol. Chem. Neuropathol.,!7: 121—135, 1992. 3. Lee, J. E., Hollenberg, S. M., Snider, L., Tumer, D. L., Lipnick, N., and Weintraub,

H. NeuroD, a new basic helix-loop-helix protein, can convert Xenopus ectoderm into neurons. Science (Washington DC), 268: 836—844, 1995.

lineage of cerebellar granule cells. J. Neurochem., 63: 1880—1890, 1994. 27. Nourse, J., Mellentin, J. D., Galili, N., Wilkinson, J., Stanbridge, E., Smith, S. D., and

Cleary,M.,L.Chromosomaltranslocationt(l;19)resultsin synthesisof a homeobox fusion mRNA that codes for a potential chimeric transcription factor. Cell, 60: 535—545, 1990. 28. Chen, Q., Yang, C., Tsan, J. T., Xia, Y., Ragab, A. H., Peiper, S. C., Carroll, A., and Baer, R. Coding sequences of the tal-l gene are disrupted by chromosomal translo cation in human T-cell leukemia. J. Exp. Med., 172: 1403—1408,1990. 29. Aplan, P. D., Begley, C. G., Bertness, V., Nussmeier, M., Ezquerra, A., Coligan, J.,

and Kirsch, I. R. The SCL gene is formed from a transcriptionally complex locus. Mol. Cell. Biol., !0: 6426—6435,1990.

3530

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

NEUROD AND HASH) IN NEUROECTODERMAL

30. Tamimi, R., Steingrimsson,

E., Copeland, N. G., Dyer-Montgomery,

K., Lee, J. E.,

Hemandez,R.,Jenkins,N. A.,andTapscou,S. J. TheneuroDgenemapsto human chromosome 2q32 and mouse chromosome 2. Genomics, 34: 418—421,1996. 31. Tamimi, R. M., Steingrimsson, E., Montgomery-Dyer, K., Copeland, N. G., Jenkins, N. A., and Tapscott, S. J. NEUROD2 and NEUROD3 genes map to human chromo

somes llql2 and 5q23—q31 and mousechromosomes11 and 13, respectively. Genomics, 40: 355—357,1997. 32. Schutz, B. R., Scheurlen, W., Krauss, J., du Manoir, S., Joos, S., Betas, M., and

Lichter, P. Mapping of chromosomal gains and losses in primitive neuroectodermal tumors by comparative genomic hybridization. Genes Chromosomes & Cancer, !6: 196—203, 1996. 33. Gerber, A. N., and Tapscott, S. J. Tumor cell complementation groups based on myogenic potential: evidence for inactivation of loci required for basic helix-loop

helix protein activity. Mol. Cell. Biol., 16: 3901—3908,1996. 34. Biegel, J. A., Rorke, L. B., Jansa, A. J., Sutton, L. N., and Parmiter, A. H. Isochro mosome 17q demonstrated by interphase fluorescence in situ hybridization in prim

A., and Dambly-Chaudiere,

C. From DNA to form: the achaete-scute

proneural gene atonal is a positive transcriptional regulator expressed in the devel oping nervous system. J. Biol. Chem., 270: 8730—8738, 1995. 42. Shimizu, C., Akazawa, C., Nakanishi, S., and Kageyama, R. Math-2, a mammalian helix-loop-helix factor structurally related to the product of Drosophila proneural 239—248, 199S. 43. Naya, F. J., Stellrecht, C. M. M., and Tsai, M-J. Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dcv., 9:

1009—1019,1995.

complex. Genes Dcv., 2: 495—501,1988. 36. Ghysen. A., Dambly-Chaudiere,

38. Johnson, J. E., Birren, S. J., and Anderson, D. J. Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors. Nature (Land.), 346: 858—861. 1990. 39. Sasai, Y., Kageyama, R., Tagawa, Y., Shigemoto, R.. and Nakanishi, S. Two mammalian helix-loop-helix factors structurally related to Drosophila hairs' and enhancer ofsplit. Genes Dcv., 6: 2620—2634, 1992. 40. Bartholoma, A., and Nave, K-A. Nex-l : a novel brain-specific helix-loop-helix protein with autoregulation and sustained expression in mature cortical neurons. Mech. Dcv.,48:217—228, 1994. 41. Akazawa, C., Ishibashi, M.. Shimizu, C., Nakanishi, S., and Kageyama, R. A mammalian helix-loop-helix factor structurally related to the product of Drosophila

gene atonal, is specifically expressed in the nervous system. Eur. J. Biochem., 229:

itive neuroectodermal tumors of the central nervous system. Genes Chromosomes & Cancer, 14: 85—96,1995. 35. Ghysen,

TUMORS

C., Jan, L. Y., and Jan, Y. N. Cell interactions and

44. Yasunami., M., Suzuki, K., Maruyama. H., Kawakami, H., Nagai. Y.. Hagiwara, M.,

gene interactions in peripheral neurogenesis. Genes Dev., 7: 723—733,1993.

and Ohkubo, H. Molecular cloning and characterization of a cDNA encoding a novel

37. Jan, Y. N., and Jan, L. Y. HLH proteins, fly neurogenesis, and vertebrate myogenesis. Cell, 75: 827—830, 1993.

basic helix-loop-helix protein structurally related to NeuroDIBHFl . Biochem. Bio phys. Res. Commun., 220: 754—758, 1996.

3531

Downloaded from cancerres.aacrjournals.org on July 16, 2011 Copyright © 1997 American Association for Cancer Research

Suggest Documents