List of primers. Primer. Sequence 5' to 3'. Position to. TSS. Reference. Antp-P1. CGTGGGCTAAGTCAACGGAA. 0. AAGGAGTTCTCGCTGGGATT. Antp-P1 +0.1K.
Page 1. Table 1: Primer-Oligonucleotide Sequences. Name. Primer Sequence 5'-3'. Fragment length (including Primers). H2Dt1F. GGATGCTATGACTCACCA.
Oligo Name. Sequence(5' to 3'). RefSeq Accession. Primers used for genotyping. Mutyh15182F. GAGTTTTGTGGGATATGAATTGTGG. NG_008189.1.
siRNA Target Gene. siRNA sequence (5' to 3'). Human c-Kit. 1. UCAUUCUUGAUGUCUCUGGtt. 2. UUUGAGUUCAGACAUGAGGtt. 3.
Primer Sequences. Gene. Sequence (5' to 3'). Dystrophin F AACTCATCAAATATGCGTGTTAGTG. R GTCACTCAGATAGTTGAAGCCATTTAA (mutated).
Number. Primer Sequence 5'-3'. Primer. Name. SFA2 LIC tacttccaatccactatggggcaagg. SFA2 LIC tectccagttocaa tttcgaaggccc. R. SFA3 LIC.
Qrr2 was present at 1.4 µM in each case. On the right, the upper panels show a ribbon representation of Qrr2, predicted by iFoldRNA (26,27), superimposed with.