TABLE S1. Commonly used antibodies to detect ER and PR
Recommend Documents
1:800. CD45-APC. eBioscience. 1:800. CD11b-APC. eBioscience. 1:600. Stro-1. R&D system 1:100. Caspase 3 (active). R& D systems 1:1000. Ki67. Novocastra.
A881del. NF. 11bp del. F. F. PRJEB7601. Almeida et al. 2015. ZP 641. Spontaneous red wine fermentationCastelo de Vide, Portugal. Wine. 1484. NF. A881del.
SMRT 28+/- ggctccatcacacagggtac gagacgggttattgtgccct. SMRT 40b+/b- agcgcgtcaagtagggaaaa ctggttttgctgtgactggc. SMRT 44+/-145+/- cagagggcacttctgcagaa.
Table S1. The KASP primer combinations used to score the same SNPs in the genes .... these were used to define the deletion (bold black Table S2).
Table S1. Bacterial strains and plasmids used in this study. Strain/plasmid. Descriptiona. Source. S. pneumoniae. D39. Serotype 2 strain, cps 2. PcopY-lacZ.
Expression vector to generate fusions to the C-terminus of maltose binding protein (MBP). New England Biolabs. pEGFP-c1. Transfection vector. Clontech.
1, 2, 3 mvp MOs are included in this order in Tables 1, 2, and S3. mvp MO1 is ... 351. 308. 88. 351. 313. 89. 242. 238. 98 mapk3. 158. 154. 97. 158. 156. 99. 124.
May 13, 2016 - Sepsis-induced myocardial dysfunction is a common and severe complication of septic ... Septic cardiomyopathy is a well-described complica-.
Email: [email protected]. Jawwad A. Qureshi. Email: [email protected] ... using a Durand Wayland AF100-32 air blast speed sprayer operating at 1.9 mph and.
S1 Table. Strains used is this study. Strain. Genotype. Source. JC470. MATa ade2-1 trp1-1 his3-11 his3-15 ura3-1 leu2-3 leu2-112 Rad5+ (W303). R. Rothstein.
TABLE S1. Commonly used antibodies to detect ER and PR
A mouse monoclonal anti-human progesterone receptor. PRA, PRB. 15272277. Novocastra Laboratories, UK PGR-312. Reacts with both A and B forms of PR ...
TABLE S1. Commonly used antibodies to detect ER and PR Brand Manufacturer name Description DakoCytomation, Califonia Santa Cruz, CA Leica, UK *Abcam BioGenex, Califonia
ER-1D5 MC20 clone 6F11 *ab108398 PGR-1A6
Leica, UK Santa Cruz, CA
clone 1A6 H190
DakoCytomation, CA
PgR 636
Novocastra Laboratories, UK PGR-312 Novocastra Laboratories, UK
PGR-B (SAN27)
*Abcam *YR85 * Antibody used in this present study **Reference cited in this article
Specificity
References (PMID/PMCID)
Mouse IgG monoclonal antibody targeting at the A/B region of the N terminal domain of ERα
ERα
**20530450
Rabbit polyclonal IgG targeting at the C-terminus of ERα of mouse origin Mouse Monoclonal Antibody Rabbit monoclonal [EPR4097] to Estrogen Receptor alpha A mouse monoclonal antibody to human progesterone receptor A mouse monoclonal antibody to human progesterone receptor A rabbit polyclonal IgG A mouse monoclonal anti-human progesterone receptor Reacts with both A and B forms of PR by Western blot but only with the A form by Prokaryotic recombinant protein corresponding to the 164 amino acid N-terminal region unique to the PRB Rabbit monoclonal to progesterone receptor