Supporting table 1

Recommend Documents

Bim. TGCGCCCGGAGATACGGATT. TGGTCTTCAGCCTCGCGGTA. Bmf. TGTCATGCTGCCTTGTGG. TGAGCCTGCAGGGAAACTG. NOX4.

1 Table of Contents Supporting Information Figure 1 2 Supporting

Production of IL-6, CCL2, CCL3, CCL4, in the lung of BALB/c mice infected by K. rhinoscleromatis, Kp52.145 or Kp110. IL-6. 0. 1. 3. 5. 102. 103. 104. 105.

1 SUPPORTING INFORMATION LIST Supporting Table 1. Plasmids

Supporting Table 1. Plasmids for AAV vector production. Supporting Table 2. The titers of dual AAV vectors are similar to those of regular AAV vectors of normal ...

SUPPORTING TABLE 1. Pesticides, internal standard

Retention time (min). Time dependent windows (min). Transition1 (CE1). Transition 2 (CE2). Endrin aldehyde. 7421-93-4. C12H2C160. 380.91. 27.69. 26.9-28.1.

Supporting Information Table 1: Healthy volunteers

Sample. PMN counts. (106 per ml). Age. (years). Male/. Female. Total microparticle count (x108/ml). Healthy Volunteer. (HV) Plasma. 6.7 Â± 1.6. 41 Â± 4. 7/9.

Supporting Information Table 1. Echocardiography of cardiac

Supporting Information Table 1. Echocardiography of cardiac dimensions of 20-22- month-old VEGF-B TG and WT rats. EF, ejection fraction; FS, fractional ...

Supporting information S1 Table of contents 1

Michele G, Petrozzi L, Giraldi C, Santoro L, Servidei S, Casali C, Filla A, ..... Stromillo ML, Malandrini A, Dotti MT, Battaglini M, Borgogni F, Tessa A, et al.

Supporting Table 1. Performance summary of qHTS

Supporting Table 1. Performance summary of qHTS assays. qHTS Assay. Cell Line. Z'. Intraplate Control. AC. 50. [ÂµM] grp78-luciferase primary. U87-MG. 0.41 Â± ...

Supporting Table S5 - PLOS

Table S5: The coordinates and sequences of the 20 bp sequence tags flanking each of the 114 a-right"128T repeats in strains Z2491, MC58 and FAM18.

Supporting Table 3 - Plos

Akap4 (site 1) Fw 5'- TCAGAGCCAGCAGGAAACAG -3'. Rev 5' - CCCTTTAGATGGAAGGGGGC -3'. Akap4 (site 2) Fw 5'- GAGGCGTGTGCAAGGTAGAT -3'.

Supporting Table S1.xlsx

Table S1 page 1/159. Page 2. Table S1 page 2/159. Page 3. Table S1 page 3/159. Page 4. Table S1 page 4/159. Page 5. Table S1 page 5/159. Page 6. Table ...

SUPPORTING INFORMATION Supplementary Table 4 - Table ... - PLOS

Supplementary Table 4 - Table S4: Results of Mann-Whitney U test (mean rank and sum of ranks) for comparison of bacterial density (cells/mL X 108) in the ...

Supporting Information Table S2

0.09. 0.07 rs6477941. Chr 9,. 114,292,170. KIAA1958. GWAS. T/C. 0.12/0.05. GWAS. 0.12/0.04. Allelic. Additive. Dominant. Recessive. 2.46. 2.40. 2.60. 3.39.

Supporting information Supplementary Table S1

CKW-7. Aquaspirillum delicatum strain. LMG 4328 (AF078756). 96. Proteobacteria. (Beta). 574. 146. 1. CKW-8. Acidovorax facilis strain LMG 2193. (EU024133).

Supporting Table S2.xlsx - PLOS

Table S2 page 1/182. Page 2. Table S2 page 2/182. Page 3. Table S2 page 3/182. Page 4. Table S2 page 4/182. Page 5. Table S2 page 5/182. Page 6 ...

Supporting Information Table S2 - PLOS

0.36. 0.35. 0.34. 0.49. 0.42. 0.78. 0.80. 0.51. 0.27. 0.41. 0.29. 0.27. 0.42. 0.32 rs4836493. Chr 5,. 129,499,621. CSS3. GWAS. A/G. 0.11/0.07. Allelic. Additive.

Supporting Information Table of Contents

... as loading control. (C; errors bars, standard deviation). .... 4.1 Â± 3.5. Spleen (% and absolute numbers). B cells. 50.4% Â± 5.6. 45.9% Â± 9.3. (48.9.106 Â± 15.9) ...

Supporting Information Table of contents

were recorded at the UCSD Chemistry and Biochemistry Mass Spectrometry ... (BocNH)2C=NTf (12 eq)/NaHCO3/dioxane-H2O, rt, 5d, 31%; b) ..... molar ratio.

Supporting table 1 Prevalence (% A. astaci positive ...

13 3 12 18 12. 7 4 1. Saimaa (B). 27. 10. 80 %. 1. 1 1 2 4. 1 -. -. Saimaa (B). 29. 10. 90 %. -. 1. - 5 2. 2 -. -. Saimaa (B). 31. 20. 85 %. 3. -. - 6 6. 4 1 -. Saimaa (B).

1 Supporting Information for MAX Pregnancy Cohort Table S1 ... - PLOS

01969 Anesthesia for cesarean hysterectomy following neuraxial labor ... 59614 Vaginal delivery only, previous cesarean delivery; w/postpartum care.

Supporting Table 1. Total list of the 103 probes. - PLOS

MB247; tub-Gal80ts. >UAS-PKACA. CG4650. 0.05462545. 0.18353308. Proteolysis. CG13646. 0.38492279. 0.33395972. Amino acid transport. CG7763.

Supporting Information Table 1 Cell numbers Experiment Total cell

Feb 6, 2014 - Experiment. Total cell numbers Cancer cells. Stellate cells (PS1 unless specified). Cancer cells alone organotypic. 5 x 10. 5. 0. Cancer: stellate ...

SUPPORTING TABLE 1. Data collection Space group C2 Unit cell

SUPPORTING TABLE 1. Data collection. Space group. C2. Unit cell dimensions (Ã) a = 179.71; b = 41.73; c =108.40. Resolution range (Ã). 48.8 â 1.8.

Supporting Information Table 1 The serine protease inhibitors ... - PLOS

TIL. Yes. BmSPI28 BGIBMGA004726. BmSPI29 BGIBMGA007721. BmSPI30 BGIBMGA004736. BmSPI31 BGIBMGA013903. BmSPI32 BGIBMGA013848.

Supporting table 1

Download PDF

19 downloads 0 Views 153KB Size Report

Comment

Dinoflagellate Pfiesteria piscicida (Peridiniales, Alveolata). Gwang Hoon Kim, Hae Jin Jeong, Yeong Du Yoo, Sunju Kim, Ji Hee Han, Jong Won. Han, Giuseppe ...

Supporting table 1 Still Acting Green: Continued Expression of Photosynthetic Genes in the Heterotrophic Dinoflagellate Pfiesteria piscicida (Peridiniales, Alveolata)

Gwang Hoon Kim, Hae Jin Jeong, Yeong Du Yoo, Sunju Kim, Ji Hee Han, Jong Won Han, Giuseppe C. Zuccarello

1

Table S1. Used primer sets for 5’RACE PCR.

Primer name

Sequence

Ppi-SL

TCCGTAGCCATTTTGGCTCAA

Ppi-FruBPAld320C18990SR1

GGTCCTTGAAGCCCTCGAT

Ppi-GAPDH320C19675SR1

GCTGGTAGACCATGTACTTC

Ppi-GAPDH320C19675SR2

TCACGGCCTTGATGCTCACG

2