Page 1 Table S1: List of the primers used in this study. Primer ...
Recommend Documents
Q-RT-PCR. Human Hsp70-2 forward. TGTTTGTCTTTGAGGTGGAC. Human Hsp70-2 reverse. AAGAATTCTAATGAACATATCGGT. TG. Human NFAT5 forward.
51.25 kDa recombinant OsPAP21b protein (2 µg) purified by Ni2+-affinity chromatography. (d) Western blot analysis of purified 6XHIS-OsPAP21b with anti-.
CGA ATT GTG GAT AAG CTT TCA TCT GC. pG+host4 flanking multiple cloning site. M14. TTG TAA AAC GAC GGC CAG TGA. RedR. ACA GGA AAC AGC TAT ...
Primer Number. Sequence. Information. CGCGCGCCAAGCTTGATGTCTTTGTTCA Clone LapD for B2H Fwd. AACAGCTGTTGATCGCTATC.
Oct 8, 2014 - DONOR VECTOR. USED. pAA11. attL4::wee-1.3 short promoter::attR1. oAKA2 and oAKA3. pDONR(P4-P1r). pAA13. attR2::wee-1.3 3'UTR:: ...
Sequence (5' to 3'). Primers for gene cloning. ccpAF. CTAGCTAGCGGCTATTTTTATATGGAAAAACAAAC. ccpAR. CGAACTTAATCAGCAGACTTGG. Primers for ...
AGT ATA AAG AC-3'. Forward Primer to amplify. 3AB. 2. 5'-CGT TAG CGG CCG CTT ACT ATT GTA CCT TTG. CTG TCC GAA TG-3'. Reverse Primer to amplify.
Supplementary Data ... Product size (bp). Reference. dT17-adapter. GACTCGAGTCGACATCGA-T17 ... -263, -542, - 563, -713, ... sequences, including the basal TATA- and CAAT-box promoter elements for transcription, pollen-specific.
This study. fhlA+2106/P2. CAGGCAGATCTGTCCGGCAATTTGCAGTTAAATCAATGCCcatatgaatatcctccttag. This study. glnG-50/P1.
and Evolutionary Scenario Based on Genomic and Phenotypic Characterization. Neyrolles O, editor. PLoS ONE. 2009 Mar 25;4(3):e4982. 9. Regue M, Hita B, ...
Table S1 List of primers (Sequence 5' to 3') used in this study. Description. Left primer sequence. Right primer sequence. AtActin2.
family transcriptional regulator RokA of Streptococcus pneumoniae D39. Microbiology 158, 2917â2926. Table S1. List of primers used in this study. Restriction ...
Table S3. List of the primers used in the study. Primers used to produce U6shSLY vectors. Primer name. Sequence sh136 reverse primer.
PF138. CACACTTTGCTATGCCATAG. PF139. GCTACTGCCGCCAGG. F for pBAD30 MCS. R for pBAD30 MCS. Primers for engineered CRISPR entry plasmids.
EA7 h Addb1::kanMX Aspd1:hphMX ura4::adh::dmdNK-natMX-adh::HENT1 ura4-aim. Eg545 ht Amat 2,3. Eg2261 ht Acdt 2::ura4+ ura4-D18 leul-32 ade6-704.
Table S3. Primers used in this work. Primer. Sequence (5`-3`)a. Locationb. PCR product size (bp). Use. Reference or source. ACrnaF.
pNE1 PermAM-FLAG-RitR (C128A). Maule et.al. 2015. pE-SUMO. N-terminal His6-SUMO fusion protein expression vector. Life Sensors Inc. pE-SUMO-RitRWT.
Cytokinin (BAP) bud induction assay. WT protonemal tissue (a) and (c);. âdek1 protonemal tissue (b) and (d). Protonemal tissue in (c) and (d) were treated for 48.
$2,400. $99,776. Oligo Pool amplification with. Kapa HiFi Uracil+. $24. -. USER treatment + End Repair. $36. -. Assembly PCR. $12. -. Sequence Verification.
Page 1 Table S1: List of the primers used in this study. Primer ...